ID: 957738630 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:84233854-84233876 |
Sequence | CCACTAGGCAGTGACCCAGT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
957738626_957738630 | -8 | Left | 957738626 | 3:84233839-84233861 | CCTCTACTCACAGCTCCACTAGG | No data | ||
Right | 957738630 | 3:84233854-84233876 | CCACTAGGCAGTGACCCAGTGGG | No data | ||||
957738625_957738630 | -7 | Left | 957738625 | 3:84233838-84233860 | CCCTCTACTCACAGCTCCACTAG | No data | ||
Right | 957738630 | 3:84233854-84233876 | CCACTAGGCAGTGACCCAGTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
957738630 | Original CRISPR | CCACTAGGCAGTGACCCAGT GGG | Intergenic | ||