ID: 957738631

View in Genome Browser
Species Human (GRCh38)
Location 3:84233866-84233888
Sequence GACCCAGTGGGAACCCCGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957738626_957738631 4 Left 957738626 3:84233839-84233861 CCTCTACTCACAGCTCCACTAGG No data
Right 957738631 3:84233866-84233888 GACCCAGTGGGAACCCCGTGTGG No data
957738625_957738631 5 Left 957738625 3:84233838-84233860 CCCTCTACTCACAGCTCCACTAG No data
Right 957738631 3:84233866-84233888 GACCCAGTGGGAACCCCGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957738631 Original CRISPR GACCCAGTGGGAACCCCGTG TGG Intergenic