ID: 957738634

View in Genome Browser
Species Human (GRCh38)
Location 3:84233868-84233890
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957738625_957738634 7 Left 957738625 3:84233838-84233860 CCCTCTACTCACAGCTCCACTAG No data
Right 957738634 3:84233868-84233890 CCCAGTGGGAACCCCGTGTGGGG No data
957738629_957738634 -9 Left 957738629 3:84233854-84233876 CCACTAGGCAGTGACCCAGTGGG No data
Right 957738634 3:84233868-84233890 CCCAGTGGGAACCCCGTGTGGGG No data
957738626_957738634 6 Left 957738626 3:84233839-84233861 CCTCTACTCACAGCTCCACTAGG No data
Right 957738634 3:84233868-84233890 CCCAGTGGGAACCCCGTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type