ID: 957744484

View in Genome Browser
Species Human (GRCh38)
Location 3:84321237-84321259
Sequence AACCCACTCCTTTTTCCTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957744484_957744485 6 Left 957744484 3:84321237-84321259 CCAATAGGAAAAAGGAGTGGGTT No data
Right 957744485 3:84321266-84321288 GTGTTGACATGCTTGTGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957744484 Original CRISPR AACCCACTCCTTTTTCCTAT TGG (reversed) Intergenic
No off target data available for this crispr