ID: 957746030

View in Genome Browser
Species Human (GRCh38)
Location 3:84344605-84344627
Sequence TTGTTGATGTATAGGAATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957746028_957746030 2 Left 957746028 3:84344580-84344602 CCTTTGTTGGCTCTTGGCTTGGC No data
Right 957746030 3:84344605-84344627 TTGTTGATGTATAGGAATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957746030 Original CRISPR TTGTTGATGTATAGGAATGC TGG Intergenic
No off target data available for this crispr