ID: 957750863

View in Genome Browser
Species Human (GRCh38)
Location 3:84413533-84413555
Sequence ATGCCCTTCTAGAATAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957750863_957750866 7 Left 957750863 3:84413533-84413555 CCTTCACTATTCTAGAAGGGCAT No data
Right 957750866 3:84413563-84413585 TAGGTCCTTTTTCCATGGATTGG No data
957750863_957750869 18 Left 957750863 3:84413533-84413555 CCTTCACTATTCTAGAAGGGCAT No data
Right 957750869 3:84413574-84413596 TCCATGGATTGGAATAAAGGAGG No data
957750863_957750865 2 Left 957750863 3:84413533-84413555 CCTTCACTATTCTAGAAGGGCAT No data
Right 957750865 3:84413558-84413580 TTCGTTAGGTCCTTTTTCCATGG No data
957750863_957750868 15 Left 957750863 3:84413533-84413555 CCTTCACTATTCTAGAAGGGCAT No data
Right 957750868 3:84413571-84413593 TTTTCCATGGATTGGAATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957750863 Original CRISPR ATGCCCTTCTAGAATAGTGA AGG (reversed) Intergenic
No off target data available for this crispr