ID: 957750865

View in Genome Browser
Species Human (GRCh38)
Location 3:84413558-84413580
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957750860_957750865 10 Left 957750860 3:84413525-84413547 CCAGGAAGCCTTCACTATTCTAG No data
Right 957750865 3:84413558-84413580 TTCGTTAGGTCCTTTTTCCATGG No data
957750863_957750865 2 Left 957750863 3:84413533-84413555 CCTTCACTATTCTAGAAGGGCAT No data
Right 957750865 3:84413558-84413580 TTCGTTAGGTCCTTTTTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr