ID: 957750868

View in Genome Browser
Species Human (GRCh38)
Location 3:84413571-84413593
Sequence TTTTCCATGGATTGGAATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957750863_957750868 15 Left 957750863 3:84413533-84413555 CCTTCACTATTCTAGAAGGGCAT No data
Right 957750868 3:84413571-84413593 TTTTCCATGGATTGGAATAAAGG No data
957750860_957750868 23 Left 957750860 3:84413525-84413547 CCAGGAAGCCTTCACTATTCTAG No data
Right 957750868 3:84413571-84413593 TTTTCCATGGATTGGAATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957750868 Original CRISPR TTTTCCATGGATTGGAATAA AGG Intergenic
No off target data available for this crispr