ID: 957750869 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:84413574-84413596 |
Sequence | TCCATGGATTGGAATAAAGG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
957750863_957750869 | 18 | Left | 957750863 | 3:84413533-84413555 | CCTTCACTATTCTAGAAGGGCAT | No data | ||
Right | 957750869 | 3:84413574-84413596 | TCCATGGATTGGAATAAAGGAGG | No data | ||||
957750860_957750869 | 26 | Left | 957750860 | 3:84413525-84413547 | CCAGGAAGCCTTCACTATTCTAG | No data | ||
Right | 957750869 | 3:84413574-84413596 | TCCATGGATTGGAATAAAGGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
957750869 | Original CRISPR | TCCATGGATTGGAATAAAGG AGG | Intergenic | ||
No off target data available for this crispr |