ID: 957757029

View in Genome Browser
Species Human (GRCh38)
Location 3:84503484-84503506
Sequence AAGAAGAAGCAGAGTGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957757029_957757032 20 Left 957757029 3:84503484-84503506 CCACCTTCACTCTGCTTCTTCTT No data
Right 957757032 3:84503527-84503549 GAACATTTTGTGTGAACTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957757029 Original CRISPR AAGAAGAAGCAGAGTGAAGG TGG (reversed) Intergenic
No off target data available for this crispr