ID: 957757032

View in Genome Browser
Species Human (GRCh38)
Location 3:84503527-84503549
Sequence GAACATTTTGTGTGAACTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957757029_957757032 20 Left 957757029 3:84503484-84503506 CCACCTTCACTCTGCTTCTTCTT No data
Right 957757032 3:84503527-84503549 GAACATTTTGTGTGAACTTTTGG No data
957757030_957757032 17 Left 957757030 3:84503487-84503509 CCTTCACTCTGCTTCTTCTTCAA No data
Right 957757032 3:84503527-84503549 GAACATTTTGTGTGAACTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957757032 Original CRISPR GAACATTTTGTGTGAACTTT TGG Intergenic
No off target data available for this crispr