ID: 957762996

View in Genome Browser
Species Human (GRCh38)
Location 3:84583769-84583791
Sequence CACCGTATGTTCTCATTCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957762996_957762999 19 Left 957762996 3:84583769-84583791 CCTATGAATGAGAACATACGGTG No data
Right 957762999 3:84583811-84583833 TGACAGTTTGCTGAGAATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957762996 Original CRISPR CACCGTATGTTCTCATTCAT AGG (reversed) Intergenic