ID: 957766038

View in Genome Browser
Species Human (GRCh38)
Location 3:84625171-84625193
Sequence GTGTTCTTGTCAAAGTGTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957766038_957766039 6 Left 957766038 3:84625171-84625193 CCTAGACACTTTGACAAGAACAC No data
Right 957766039 3:84625200-84625222 AGCATTAGAATAAAATTGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957766038 Original CRISPR GTGTTCTTGTCAAAGTGTCT AGG (reversed) Intergenic
No off target data available for this crispr