ID: 957768071

View in Genome Browser
Species Human (GRCh38)
Location 3:84651598-84651620
Sequence AGATGAACATATAACTTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957768069_957768071 10 Left 957768069 3:84651565-84651587 CCCTACAACTGCTGCAGCATACG No data
Right 957768071 3:84651598-84651620 AGATGAACATATAACTTCACTGG No data
957768070_957768071 9 Left 957768070 3:84651566-84651588 CCTACAACTGCTGCAGCATACGC No data
Right 957768071 3:84651598-84651620 AGATGAACATATAACTTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957768071 Original CRISPR AGATGAACATATAACTTCAC TGG Intergenic
No off target data available for this crispr