ID: 957769036

View in Genome Browser
Species Human (GRCh38)
Location 3:84663935-84663957
Sequence CAGGGGAGAAGGAGAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957769028_957769036 17 Left 957769028 3:84663895-84663917 CCTCATGAACAAGATGGGTAGGA No data
Right 957769036 3:84663935-84663957 CAGGGGAGAAGGAGAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957769036 Original CRISPR CAGGGGAGAAGGAGAGAGGA AGG Intergenic
No off target data available for this crispr