ID: 957773941

View in Genome Browser
Species Human (GRCh38)
Location 3:84730781-84730803
Sequence CTGTGTGAGAAGAAAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957773941_957773945 21 Left 957773941 3:84730781-84730803 CCTTCCTCTTTCTTCTCACACAG No data
Right 957773945 3:84730825-84730847 TTGCATATTTAATCATATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957773941 Original CRISPR CTGTGTGAGAAGAAAGAGGA AGG (reversed) Intergenic
No off target data available for this crispr