ID: 957776415

View in Genome Browser
Species Human (GRCh38)
Location 3:84760854-84760876
Sequence CAGGGCAAGCAGAAGCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957776405_957776415 24 Left 957776405 3:84760807-84760829 CCTGGCTTATGTCATTGGGACAG No data
Right 957776415 3:84760854-84760876 CAGGGCAAGCAGAAGCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957776415 Original CRISPR CAGGGCAAGCAGAAGCAGGG TGG Intergenic
No off target data available for this crispr