ID: 957777480

View in Genome Browser
Species Human (GRCh38)
Location 3:84772530-84772552
Sequence ACTAAACAGGCCCTCTGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957777480_957777484 17 Left 957777480 3:84772530-84772552 CCAAATCAGAGGGCCTGTTTAGT No data
Right 957777484 3:84772570-84772592 AGCATATTCCACAGTTCCCCTGG No data
957777480_957777485 18 Left 957777480 3:84772530-84772552 CCAAATCAGAGGGCCTGTTTAGT No data
Right 957777485 3:84772571-84772593 GCATATTCCACAGTTCCCCTGGG No data
957777480_957777482 -7 Left 957777480 3:84772530-84772552 CCAAATCAGAGGGCCTGTTTAGT No data
Right 957777482 3:84772546-84772568 GTTTAGTAGAACCATACTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957777480 Original CRISPR ACTAAACAGGCCCTCTGATT TGG (reversed) Intergenic
No off target data available for this crispr