ID: 957777482

View in Genome Browser
Species Human (GRCh38)
Location 3:84772546-84772568
Sequence GTTTAGTAGAACCATACTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957777480_957777482 -7 Left 957777480 3:84772530-84772552 CCAAATCAGAGGGCCTGTTTAGT No data
Right 957777482 3:84772546-84772568 GTTTAGTAGAACCATACTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957777482 Original CRISPR GTTTAGTAGAACCATACTGT TGG Intergenic
No off target data available for this crispr