ID: 957779338

View in Genome Browser
Species Human (GRCh38)
Location 3:84798305-84798327
Sequence CAGGTAAAATCTCAGAAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957779335_957779338 19 Left 957779335 3:84798263-84798285 CCTGGGAAACAAGACAAAGACCA No data
Right 957779338 3:84798305-84798327 CAGGTAAAATCTCAGAAGATTGG No data
957779336_957779338 -1 Left 957779336 3:84798283-84798305 CCAAATTTCAAAAGTGACTCAGC No data
Right 957779338 3:84798305-84798327 CAGGTAAAATCTCAGAAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957779338 Original CRISPR CAGGTAAAATCTCAGAAGAT TGG Intergenic
No off target data available for this crispr