ID: 957782672

View in Genome Browser
Species Human (GRCh38)
Location 3:84839747-84839769
Sequence TAGTTAGCTAACACTTTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957782672_957782677 10 Left 957782672 3:84839747-84839769 CCATTAAAAGTGTTAGCTAACTA No data
Right 957782677 3:84839780-84839802 TAGGGTTATGGCCCTGAAAATGG No data
957782672_957782676 -2 Left 957782672 3:84839747-84839769 CCATTAAAAGTGTTAGCTAACTA No data
Right 957782676 3:84839768-84839790 TAGGAATAGAATTAGGGTTATGG No data
957782672_957782675 -8 Left 957782672 3:84839747-84839769 CCATTAAAAGTGTTAGCTAACTA No data
Right 957782675 3:84839762-84839784 GCTAACTAGGAATAGAATTAGGG No data
957782672_957782674 -9 Left 957782672 3:84839747-84839769 CCATTAAAAGTGTTAGCTAACTA No data
Right 957782674 3:84839761-84839783 AGCTAACTAGGAATAGAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957782672 Original CRISPR TAGTTAGCTAACACTTTTAA TGG (reversed) Intergenic
No off target data available for this crispr