ID: 957785517

View in Genome Browser
Species Human (GRCh38)
Location 3:84877258-84877280
Sequence CTGGATTTTTCAGATTCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957785517_957785520 4 Left 957785517 3:84877258-84877280 CCAGTGGAATCTGAAAAATCCAG No data
Right 957785520 3:84877285-84877307 AGAAGTGCCACATACCTGTGAGG No data
957785517_957785523 23 Left 957785517 3:84877258-84877280 CCAGTGGAATCTGAAAAATCCAG No data
Right 957785523 3:84877304-84877326 GAGGTGAGCGTATAGAAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957785517 Original CRISPR CTGGATTTTTCAGATTCCAC TGG (reversed) Intergenic
No off target data available for this crispr