ID: 957785518

View in Genome Browser
Species Human (GRCh38)
Location 3:84877277-84877299
Sequence GTATGTGGCACTTCTGGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957785518_957785523 4 Left 957785518 3:84877277-84877299 CCAGTGCCAGAAGTGCCACATAC No data
Right 957785523 3:84877304-84877326 GAGGTGAGCGTATAGAAATAAGG No data
957785518_957785524 22 Left 957785518 3:84877277-84877299 CCAGTGCCAGAAGTGCCACATAC No data
Right 957785524 3:84877322-84877344 TAAGGTACAAAAGCTGTCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957785518 Original CRISPR GTATGTGGCACTTCTGGCAC TGG (reversed) Intergenic
No off target data available for this crispr