ID: 957785519

View in Genome Browser
Species Human (GRCh38)
Location 3:84877283-84877305
Sequence TCACAGGTATGTGGCACTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957785519_957785523 -2 Left 957785519 3:84877283-84877305 CCAGAAGTGCCACATACCTGTGA No data
Right 957785523 3:84877304-84877326 GAGGTGAGCGTATAGAAATAAGG No data
957785519_957785524 16 Left 957785519 3:84877283-84877305 CCAGAAGTGCCACATACCTGTGA No data
Right 957785524 3:84877322-84877344 TAAGGTACAAAAGCTGTCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957785519 Original CRISPR TCACAGGTATGTGGCACTTC TGG (reversed) Intergenic
No off target data available for this crispr