ID: 957785521

View in Genome Browser
Species Human (GRCh38)
Location 3:84877292-84877314
Sequence ACGCTCACCTCACAGGTATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957785521_957785524 7 Left 957785521 3:84877292-84877314 CCACATACCTGTGAGGTGAGCGT No data
Right 957785524 3:84877322-84877344 TAAGGTACAAAAGCTGTCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957785521 Original CRISPR ACGCTCACCTCACAGGTATG TGG (reversed) Intergenic
No off target data available for this crispr