ID: 957785523

View in Genome Browser
Species Human (GRCh38)
Location 3:84877304-84877326
Sequence GAGGTGAGCGTATAGAAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957785519_957785523 -2 Left 957785519 3:84877283-84877305 CCAGAAGTGCCACATACCTGTGA No data
Right 957785523 3:84877304-84877326 GAGGTGAGCGTATAGAAATAAGG No data
957785517_957785523 23 Left 957785517 3:84877258-84877280 CCAGTGGAATCTGAAAAATCCAG No data
Right 957785523 3:84877304-84877326 GAGGTGAGCGTATAGAAATAAGG No data
957785518_957785523 4 Left 957785518 3:84877277-84877299 CCAGTGCCAGAAGTGCCACATAC No data
Right 957785523 3:84877304-84877326 GAGGTGAGCGTATAGAAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957785523 Original CRISPR GAGGTGAGCGTATAGAAATA AGG Intergenic
No off target data available for this crispr