ID: 957785524

View in Genome Browser
Species Human (GRCh38)
Location 3:84877322-84877344
Sequence TAAGGTACAAAAGCTGTCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957785521_957785524 7 Left 957785521 3:84877292-84877314 CCACATACCTGTGAGGTGAGCGT No data
Right 957785524 3:84877322-84877344 TAAGGTACAAAAGCTGTCGCTGG No data
957785519_957785524 16 Left 957785519 3:84877283-84877305 CCAGAAGTGCCACATACCTGTGA No data
Right 957785524 3:84877322-84877344 TAAGGTACAAAAGCTGTCGCTGG No data
957785518_957785524 22 Left 957785518 3:84877277-84877299 CCAGTGCCAGAAGTGCCACATAC No data
Right 957785524 3:84877322-84877344 TAAGGTACAAAAGCTGTCGCTGG No data
957785522_957785524 0 Left 957785522 3:84877299-84877321 CCTGTGAGGTGAGCGTATAGAAA No data
Right 957785524 3:84877322-84877344 TAAGGTACAAAAGCTGTCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957785524 Original CRISPR TAAGGTACAAAAGCTGTCGC TGG Intergenic
No off target data available for this crispr