ID: 957785652

View in Genome Browser
Species Human (GRCh38)
Location 3:84878686-84878708
Sequence CTCTCTCCCACCACTGAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957785650_957785652 8 Left 957785650 3:84878655-84878677 CCAGCACCTCGAAGTATACAGTC No data
Right 957785652 3:84878686-84878708 CTCTCTCCCACCACTGAGTATGG No data
957785651_957785652 2 Left 957785651 3:84878661-84878683 CCTCGAAGTATACAGTCTTCACA No data
Right 957785652 3:84878686-84878708 CTCTCTCCCACCACTGAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957785652 Original CRISPR CTCTCTCCCACCACTGAGTA TGG Intergenic
No off target data available for this crispr