ID: 957787612

View in Genome Browser
Species Human (GRCh38)
Location 3:84902149-84902171
Sequence CTTTATAAGCAGAATGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957787607_957787612 23 Left 957787607 3:84902103-84902125 CCAATTAAACCTCTTTCTTTTGT 0: 558
1: 591
2: 826
3: 3182
4: 6148
Right 957787612 3:84902149-84902171 CTTTATAAGCAGAATGAAAATGG No data
957787610_957787612 -6 Left 957787610 3:84902132-84902154 CCCAGTCTCAGGTATGTCTTTAT 0: 2779
1: 6067
2: 10377
3: 11010
4: 9585
Right 957787612 3:84902149-84902171 CTTTATAAGCAGAATGAAAATGG No data
957787611_957787612 -7 Left 957787611 3:84902133-84902155 CCAGTCTCAGGTATGTCTTTATA 0: 196
1: 4602
2: 9449
3: 12637
4: 11376
Right 957787612 3:84902149-84902171 CTTTATAAGCAGAATGAAAATGG No data
957787608_957787612 14 Left 957787608 3:84902112-84902134 CCTCTTTCTTTTGTAAATTTCCC 0: 125
1: 1787
2: 2250
3: 5759
4: 10045
Right 957787612 3:84902149-84902171 CTTTATAAGCAGAATGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957787612 Original CRISPR CTTTATAAGCAGAATGAAAA TGG Intergenic
No off target data available for this crispr