ID: 957790710

View in Genome Browser
Species Human (GRCh38)
Location 3:84937358-84937380
Sequence CTGCTTCCAAAATGCAATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957790710_957790713 14 Left 957790710 3:84937358-84937380 CCACCATTGCATTTTGGAAGCAG No data
Right 957790713 3:84937395-84937417 TAGACTAGCAAATGAGAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957790710 Original CRISPR CTGCTTCCAAAATGCAATGG TGG (reversed) Intergenic
No off target data available for this crispr