ID: 957792031

View in Genome Browser
Species Human (GRCh38)
Location 3:84953720-84953742
Sequence CGCCATTGACTCTGGCCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957792024_957792031 11 Left 957792024 3:84953686-84953708 CCCGGGAGGCAGAGGTTGCGGTG 0: 2468
1: 51822
2: 129296
3: 189368
4: 158403
Right 957792031 3:84953720-84953742 CGCCATTGACTCTGGCCTGGGGG No data
957792023_957792031 12 Left 957792023 3:84953685-84953707 CCCCGGGAGGCAGAGGTTGCGGT No data
Right 957792031 3:84953720-84953742 CGCCATTGACTCTGGCCTGGGGG No data
957792025_957792031 10 Left 957792025 3:84953687-84953709 CCGGGAGGCAGAGGTTGCGGTGA 0: 2557
1: 56027
2: 107163
3: 141182
4: 101441
Right 957792031 3:84953720-84953742 CGCCATTGACTCTGGCCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957792031 Original CRISPR CGCCATTGACTCTGGCCTGG GGG Intergenic
No off target data available for this crispr