ID: 957798230

View in Genome Browser
Species Human (GRCh38)
Location 3:85039952-85039974
Sequence GTCTTATGGAAATCAGCCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 100}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957798230_957798235 29 Left 957798230 3:85039952-85039974 CCTTAGGCTGATTTCCATAAGAC 0: 1
1: 0
2: 1
3: 2
4: 100
Right 957798235 3:85040004-85040026 TAACATTCTCAGTTCATTGAAGG 0: 1
1: 0
2: 0
3: 18
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957798230 Original CRISPR GTCTTATGGAAATCAGCCTA AGG (reversed) Intronic
903598442 1:24515268-24515290 GTTTTATGTAAATCAGCCCCAGG - Intronic
909935739 1:81548379-81548401 GCCATTTGGAAATCAGGCTAAGG + Intronic
910237668 1:85051775-85051797 TTCTTCTGGAAATCATCCTGAGG - Intronic
912137278 1:106676881-106676903 GTCTAATGGAAATTAGACAAGGG - Intergenic
913097321 1:115531178-115531200 GTTTTATGAAAATCAGGATAAGG - Intergenic
924363080 1:243261355-243261377 GTCTTATGGAAATGAGAGTAAGG + Intronic
924752086 1:246903302-246903324 CTCTTATAAAAATCACCCTATGG + Intronic
1068601852 10:58965073-58965095 GCCATGTGGAAATAAGCCTAGGG - Intergenic
1068809130 10:61236022-61236044 GTATTGTGAAAATCACCCTACGG + Intergenic
1069016818 10:63438953-63438975 CCCTTATGGAAATCAGTTTATGG - Intronic
1069190021 10:65475936-65475958 GTTTTATTAAAATCAGCATAAGG - Intergenic
1069609571 10:69763829-69763851 CTCTTCTGGAACTCACCCTACGG - Intergenic
1071700128 10:87922486-87922508 CTCATTTGGAAAACAGCCTAAGG - Intronic
1071739569 10:88341691-88341713 GTTTTGTGGAAAACAGCCTGAGG + Intronic
1071933718 10:90502468-90502490 GTCAAATTGATATCAGCCTATGG - Intergenic
1072143960 10:92616505-92616527 GTCTAAAGGAAATTATCCTAAGG + Intronic
1074873380 10:117595345-117595367 GTCTAATGCAAAACAGCCTGGGG - Intergenic
1080429906 11:32188797-32188819 GTCATATGGAAAGTAGCCCAAGG + Intergenic
1080433681 11:32220783-32220805 GTCCTATGGAAAACAGGATATGG + Intergenic
1081842688 11:46214746-46214768 GTCTTATGGAAAGCTGCTTCTGG - Intergenic
1099118508 12:78658630-78658652 GTTTCATGGAATTCAGTCTAAGG + Intergenic
1102731158 12:115111425-115111447 TTCTTTGGGAACTCAGCCTAAGG + Intergenic
1105888316 13:24661864-24661886 GTCTTTTTGAAAGCAGCCTGGGG + Intergenic
1107630532 13:42338229-42338251 TGCTTTTGGAAAACAGCCTAGGG - Intergenic
1108628119 13:52252679-52252701 TTATTATGGAAAACAGCATAGGG + Intergenic
1108657940 13:52553770-52553792 TTATTATGGAAAACAGCATAGGG - Intergenic
1110507967 13:76311783-76311805 GTATAATGGAACTCAGCCAAAGG - Intergenic
1112336021 13:98516743-98516765 GTCTGAAGGAAAACAGCCCACGG + Intronic
1113354200 13:109562446-109562468 GTTTGATGGAAATCAACCTTTGG - Intergenic
1115472161 14:33779202-33779224 GTCTTTTGGAGTTCAGCCTGTGG - Intronic
1127707341 15:61560335-61560357 CTCTAAAAGAAATCAGCCTATGG - Intergenic
1129381500 15:75170551-75170573 GTATTATGTGAATCTGCCTAAGG - Intergenic
1146833737 17:36092798-36092820 CTATTATGGAAATCAGCACATGG - Intergenic
1146848327 17:36199637-36199659 ATATTATGGAAATCAGCACATGG - Intronic
1147835671 17:43329779-43329801 GGCTTAGGGAAATCAGCACAAGG - Intergenic
1153887847 18:9482911-9482933 GTCTTGTGGAACTAAGCCTGTGG + Intronic
1155316000 18:24570672-24570694 TTCTCATGGAAATGAACCTAAGG + Intergenic
1158935063 18:62356891-62356913 GTCATATGGAAGTCAAGCTATGG + Intronic
1159250519 18:65869896-65869918 GTCTAATGGAGATAATCCTATGG - Intronic
926028329 2:9564100-9564122 TGCTTATGGAACACAGCCTAAGG + Intergenic
926417378 2:12663234-12663256 GTCTTCTTGAAATAAGGCTATGG + Intergenic
928500887 2:31894139-31894161 GTGTTATGGAAATCAACTAAAGG + Intronic
930157092 2:48116842-48116864 CTCATATGGAACTCAGCCTTGGG - Intergenic
930609846 2:53529885-53529907 GTCTCATGGGCATCACCCTATGG - Intergenic
932843383 2:75107459-75107481 TTCTTATGCAAAACAGACTATGG - Intronic
932970414 2:76534255-76534277 TTTTTTTGGAATTCAGCCTAAGG + Intergenic
933311587 2:80667888-80667910 GTCTTATGGGTAACAGCCCAGGG - Intergenic
933893951 2:86793808-86793830 GTCTCACGGAAATCAGCTTGGGG + Intronic
934867733 2:97828385-97828407 ATCTTATGGAAATCAGACATAGG + Intronic
935120292 2:100178263-100178285 GTCTTATGTTAATGAGCGTAAGG - Intergenic
936911808 2:117601511-117601533 TGCTTATGGAAATCATCCAAGGG + Intergenic
938151604 2:128889910-128889932 GTATTATGGAAATCACTCCAGGG - Intergenic
940344517 2:152615602-152615624 GTCATATTCAAATCAGTCTATGG - Intronic
940940573 2:159555968-159555990 GTCATATTGAAATTAACCTACGG + Intronic
941314721 2:163978402-163978424 CTCTCATAGAAATCAGCCTTGGG + Intergenic
941578918 2:167270032-167270054 TTCTTCTAGAAATCAGCCCAAGG - Intergenic
942439594 2:176019153-176019175 GTCTTCTGAAAAACAGCCTGGGG - Intergenic
944495367 2:200302457-200302479 GTTTTATGGAAAGCAGCCATAGG - Intergenic
948223648 2:236292231-236292253 GTTTTGTGCAAATCATCCTATGG - Intergenic
1168798020 20:624738-624760 TTCTTATGGAAAGAAGCCCATGG - Intergenic
1169312079 20:4551710-4551732 TTTTTATGGAAAGCAACCTAAGG + Intergenic
1178901062 21:36599040-36599062 GTTTCATGGAGATCTGCCTAAGG - Intergenic
1178972699 21:37195075-37195097 GTGTTTTGGAAACCAGCCTCAGG - Intronic
1179470828 21:41609123-41609145 GTCTGATGGAAATGTGCCTTCGG + Intergenic
1180790879 22:18574885-18574907 GTTTTCTGGAGCTCAGCCTAGGG - Intergenic
1181230858 22:21420429-21420451 GTTTTCTGGAGCTCAGCCTAGGG + Intronic
1181247790 22:21514440-21514462 GTTTTCTGGAGCTCAGCCTAGGG - Intergenic
949420222 3:3857407-3857429 GACTTAATGAAATTAGCCTAAGG - Intronic
950106638 3:10392876-10392898 GTCTAAGGGAGACCAGCCTAGGG + Intronic
957798230 3:85039952-85039974 GTCTTATGGAAATCAGCCTAAGG - Intronic
960556868 3:119039590-119039612 GTCTTGTGGTAATCAGAATAAGG - Intronic
963652792 3:148004644-148004666 TTCTTAAGGAAATCATCCTCTGG + Intergenic
966311258 3:178596536-178596558 GTCTTATGGAAAGTAGCAAAGGG - Intronic
976735316 4:88302892-88302914 GTCTTGTGGGAAACAGCCTGTGG + Intergenic
978772418 4:112470488-112470510 TTCTTCTAGACATCAGCCTAGGG + Intergenic
981246306 4:142543681-142543703 GTCTTATGGAATTCAAACTTTGG - Intronic
983159953 4:164400328-164400350 GGCTTATGGACATCTGACTATGG - Intergenic
987421946 5:17730522-17730544 GTCTTATAAAAATGAGCTTAAGG - Intergenic
987597708 5:20022260-20022282 GTCTTACTGAAATCATCCAATGG + Intronic
994166249 5:96611529-96611551 GTCTTCTGGATATGGGCCTAGGG + Intronic
997804794 5:136906339-136906361 GTCTTATAGAAATCAGACATAGG + Intergenic
998907969 5:146927178-146927200 GTGCTCTGGAAATCAGCCAAAGG - Intronic
1004681990 6:17904915-17904937 GCCTCCTGGAAATTAGCCTAAGG + Intronic
1009698362 6:67141071-67141093 GTCTCATGCAAATTAGACTAAGG + Intergenic
1011166980 6:84459494-84459516 GTCTAATGGAAAGCAGCCTAAGG - Intergenic
1012175929 6:96084617-96084639 GTCTCATAGAAATTAGACTAAGG + Intronic
1015070992 6:129092827-129092849 CTTTTGTGGAGATCAGCCTAAGG + Intronic
1016309742 6:142721520-142721542 CTCTTGTGGAAATCTGCTTATGG - Intergenic
1024844142 7:53621857-53621879 AGCATATGGAAATAAGCCTAGGG + Intergenic
1033339712 7:140482381-140482403 GGCTTATGAAAAACTGCCTATGG - Intergenic
1034538682 7:151742214-151742236 GTCCTATGGGATTCAGGCTAGGG - Intronic
1036168862 8:6463861-6463883 ATCTAATGGAAAACAGCCAAAGG - Intronic
1039634676 8:39151401-39151423 TTCTTATGGAATTGAGCCTCTGG + Exonic
1041119436 8:54571251-54571273 GTCCTGGGGAAATCAGTCTATGG - Intergenic
1047181431 8:122592466-122592488 TTCCTATGGAAATAAACCTATGG + Intergenic
1047316223 8:123735935-123735957 GTCTTTTGAAAGTCAACCTAGGG - Intronic
1048935299 8:139350222-139350244 TTTTTATGGAAATCAGGCTAAGG + Intergenic
1056336964 9:85581193-85581215 GTCTTTTGGAAAATAACCTAGGG + Intronic
1060973690 9:127753194-127753216 CACTTATGGAGAGCAGCCTAGGG + Intronic
1187052271 X:15706879-15706901 GTCTTGTGGAAAGCAGCTTTGGG - Intronic
1188863861 X:35290226-35290248 ATCTTATGCAAAACAGCCCATGG - Intergenic
1194816828 X:98452389-98452411 GCCTTGTGGAAATATGCCTAGGG - Intergenic
1196396911 X:115274347-115274369 ATCTTATGGATATTAGCCTTTGG - Intergenic
1200301931 X:154985132-154985154 AGCTTATGAAAATCATCCTAGGG + Intronic