ID: 957798906

View in Genome Browser
Species Human (GRCh38)
Location 3:85049306-85049328
Sequence ACTAAACCTGCAACAAATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 756
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 717}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957798906_957798907 24 Left 957798906 3:85049306-85049328 CCTACATTTGTTGCAGGTTTAGT 0: 1
1: 0
2: 1
3: 37
4: 717
Right 957798907 3:85049353-85049375 TTATTTATTTATTTTTGAGATGG 0: 3069
1: 2215
2: 2783
3: 102414
4: 87328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957798906 Original CRISPR ACTAAACCTGCAACAAATGT AGG (reversed) Intronic
900084574 1:885382-885404 ACAAAACCTTCAAGAAATGTGGG - Intergenic
902778899 1:18692095-18692117 ACTAACTCTGCATCAAATGCTGG - Intronic
903598368 1:24514590-24514612 ATTTAACATGCTACAAATGTAGG - Intronic
904435870 1:30494865-30494887 ACAAAACCTCCAAGAAATATGGG + Intergenic
905843560 1:41206517-41206539 ACAAAACCTCCAATAAATATGGG + Intronic
906834896 1:49072912-49072934 ACAAAGCCTGCAAGAAATATGGG - Intronic
906980037 1:50620230-50620252 ACAAAACCTCCAAGAAATGTGGG - Intronic
907258731 1:53199606-53199628 ACTAAATCTTAAACATATGTAGG + Intronic
908099106 1:60772135-60772157 ACAAAGCCTCCAAGAAATGTGGG + Intergenic
908446716 1:64204797-64204819 ACTACACCTGAAGCAACTGTGGG - Intronic
908584474 1:65553385-65553407 ACTAAGCCTCCAAGAAATATGGG - Intronic
908818684 1:68059692-68059714 ACAAAACCTCCAAGAAATATGGG + Intergenic
908937533 1:69394108-69394130 ACAAAGCCTTCAAGAAATGTGGG - Intergenic
909384381 1:75038128-75038150 ACAAAACCTCCAAGAAATATGGG + Intergenic
909759882 1:79273212-79273234 ACAAAACCTCCAAGAAATATGGG + Intergenic
909862328 1:80623389-80623411 ACTTAACTAGCAACAAATGTTGG - Intergenic
910563739 1:88620176-88620198 ACAAAACCTCCAAGAAATATAGG + Intergenic
910812790 1:91254941-91254963 ACAAGACCTCCAAGAAATGTGGG + Intergenic
910821879 1:91359595-91359617 ACAAAACCTCCAAGAAATATGGG + Intronic
910827676 1:91427101-91427123 ACAAAGCCTCCAAGAAATGTGGG - Intergenic
911672390 1:100621536-100621558 GCTAAACCATCAACAAGTGTTGG + Intergenic
911892971 1:103396068-103396090 ACAAAACCTCCAAGAAATATGGG - Intergenic
912270881 1:108208097-108208119 ACAAAACCTCCAAAAAATATGGG - Intergenic
912646296 1:111395213-111395235 ACAAAACCTCCAAGAAATATTGG + Intergenic
913102604 1:115583196-115583218 ACAAAGCCTCCAAGAAATGTGGG - Intergenic
913389711 1:118296995-118297017 ACTAAGCCAACAACAAATATGGG - Intergenic
913418642 1:118639207-118639229 ACAAAACCTCCAAGAAATATGGG + Intergenic
913990066 1:143603138-143603160 ACAAAACCTCCAAGAAATATGGG + Intergenic
915752012 1:158220467-158220489 ACAAAACCTCCAAGAAATATGGG - Intergenic
915758022 1:158281843-158281865 ACAAAGCCTACAAGAAATGTTGG - Intergenic
915869199 1:159539668-159539690 ACAAAGCCTCCAAGAAATGTGGG + Intergenic
916625462 1:166551108-166551130 ACAAAACCTCCAAGAAATATGGG - Intergenic
917173155 1:172200573-172200595 ACAAAACCTCCAAGAAATATGGG - Intronic
917234517 1:172876406-172876428 AATAAAGCTGCAATCAATGTGGG + Intergenic
917275202 1:173323833-173323855 ACAAAGCCTGCAAGAAATATGGG + Intergenic
917464216 1:175260904-175260926 ACAAAACCTCCAAGAAATATGGG - Intergenic
917579193 1:176357335-176357357 ACAAAACCTCCAAGAAATATGGG + Intergenic
917714760 1:177722995-177723017 ACAAAACCTCCAAGAAATATGGG + Intergenic
917924294 1:179776084-179776106 ACTAGACCAGCACCAAGTGTAGG - Intronic
918562969 1:185891981-185892003 GCAAAACCTCCAAGAAATGTGGG - Intronic
918617869 1:186568318-186568340 AGTAAACAAGCAACAAATTTAGG - Intergenic
918799545 1:188954706-188954728 ACAAAACCTCCAAGAAGTGTAGG + Intergenic
919375177 1:196785474-196785496 ACAAAACCTCCAAGAAATATGGG - Intronic
919487336 1:198160282-198160304 ACAAAACCTGAAAGAAATTTTGG - Intronic
919555520 1:199047456-199047478 ACAAAACCTCCAAGAAATATGGG + Intergenic
920429890 1:205911752-205911774 ATTAACTCTTCAACAAATGTAGG - Intergenic
921243845 1:213215349-213215371 ACAAAGCCTCCAAGAAATGTGGG + Intronic
921258030 1:213360227-213360249 ACAAAGCCTCCAAAAAATGTGGG - Intergenic
921798650 1:219376818-219376840 ACAAAACATACAACAAATTTTGG + Intergenic
922046812 1:221953208-221953230 ACAAAGCCTCCAAGAAATGTGGG + Intergenic
923195370 1:231661411-231661433 ACAAAACCTCCAAGAAATATGGG - Intronic
923474704 1:234321527-234321549 ACTAAAGATGCAAAGAATGTAGG - Intronic
924179838 1:241429627-241429649 ACAAAACCTCCAAGAAATATGGG - Intergenic
924629713 1:245725165-245725187 ACAAAACCTCCGAGAAATGTGGG + Intergenic
1062876781 10:949036-949058 ACTAAACATGCAACCACTGTCGG - Intergenic
1064272292 10:13876490-13876512 ACCAAACCAGCAACAGATGCCGG - Intronic
1064777616 10:18796279-18796301 ACAAAACCTCCAAGAAATATGGG + Intergenic
1064958628 10:20938909-20938931 ACAAAACCTCCAAGAAATATGGG + Intronic
1065470818 10:26080190-26080212 ACAAAGCCTCCAAGAAATGTGGG - Intronic
1065621753 10:27588783-27588805 ACAAAACCTCCAAGAAATATGGG + Intergenic
1066140325 10:32499056-32499078 ACAAAACCTCCAAGAAATATGGG - Intronic
1066502976 10:36012786-36012808 ACGAACCCTCCAAGAAATGTGGG - Intergenic
1067199115 10:44151074-44151096 ACAAAGCCTCCAACAAATATGGG - Intergenic
1067207475 10:44232149-44232171 ACAAAACCTCCAAGAAATATGGG - Intergenic
1067899780 10:50227653-50227675 ACTTAACCTGAAAAAAATCTGGG - Intronic
1068440999 10:57054733-57054755 ACAAAACCTCCAAGAAATATAGG + Intergenic
1069072141 10:63999800-63999822 ACAAAACCTCCAAGAAATATGGG + Intergenic
1069199166 10:65591761-65591783 ACAAAACCTCCAAGAAATATGGG - Intergenic
1069212896 10:65783609-65783631 AATAAACCTGCAACAACCCTAGG + Intergenic
1069333946 10:67326891-67326913 ACAAAACCTCCAAGAAATATGGG - Intronic
1069340657 10:67404529-67404551 ACAAAACCTCCAAGAAATATGGG + Intronic
1069428505 10:68311800-68311822 GCTAAACCATCAACAAATGTTGG - Intronic
1070455446 10:76609968-76609990 ACTAAGCCTCCAAGAAATATGGG + Intergenic
1070940733 10:80344182-80344204 AATAAGTCTGCAACAAAAGTAGG + Intronic
1071328330 10:84538130-84538152 ACCAAAACTACCACAAATGTGGG - Intergenic
1071459446 10:85878091-85878113 ACAAAACCTCCAAGAAATATGGG + Intronic
1071736340 10:88304664-88304686 ACTAAACCTCCAAGAAATATGGG + Intronic
1071999802 10:91184228-91184250 ACAAAACCTCCAAGAAATATGGG - Intronic
1072024637 10:91442753-91442775 ACAAAGCCTCCAAGAAATGTGGG - Intronic
1072025060 10:91446842-91446864 ACAAAGCCTCCAAGAAATGTGGG + Intronic
1072480420 10:95806161-95806183 ACAAAGCCTCCAAGAAATGTGGG - Intronic
1072866768 10:99070951-99070973 AATAATGCTGCAACAAACGTGGG + Intronic
1073693227 10:105834910-105834932 ACTAAACCTGAAAAGAATGTTGG - Intergenic
1073863368 10:107772098-107772120 ACTAAACCTCCAAGAAATGTGGG + Intergenic
1073925086 10:108505850-108505872 ACAAAGCCTCCAAGAAATGTGGG + Intergenic
1073996252 10:109318373-109318395 GCTAAACCTGACACAAATTTTGG + Intergenic
1075500233 10:122966340-122966362 ACAAAACCTTCAAAAAATATGGG + Intronic
1077428152 11:2497335-2497357 ACAAAACCTCCAAGAAATATGGG - Intronic
1077654059 11:4001057-4001079 ACAAAGCCTCCAAGAAATGTGGG + Intronic
1078459333 11:11501687-11501709 AGAAGACCTGGAACAAATGTTGG + Intronic
1078501808 11:11886565-11886587 ACAAAACCTCCAAGAAATATGGG + Intronic
1078686041 11:13533331-13533353 ACAAAGCCTCCAAGAAATGTGGG - Intergenic
1079267207 11:18944720-18944742 ACAAAACCTCCAAGAAATATGGG + Intergenic
1079523856 11:21361651-21361673 ACAAAGCCTCCAAGAAATGTGGG - Intronic
1079595781 11:22244553-22244575 ACAAAACCTCCAAGAAATTTAGG - Intronic
1080033451 11:27687075-27687097 ACAAAGCCTCCAAGAAATGTGGG - Intronic
1080149144 11:29027446-29027468 AGTAGACCTGCAATAAATCTTGG + Intergenic
1080291390 11:30675059-30675081 ACAAAGCCTCCAAGAAATGTGGG + Intergenic
1080513630 11:33000129-33000151 ACAAAACCTCCAAGAAATATGGG - Intergenic
1080736780 11:35023440-35023462 ACAAAGCCTCCAAGAAATGTGGG + Intergenic
1081011593 11:37820009-37820031 AATAATGCTGCAACAAATATGGG - Intergenic
1081083382 11:38770135-38770157 ACAAAACCTCCAAGAAATATGGG + Intergenic
1081143692 11:39535465-39535487 ACAAAACCTCCAAGAAATATGGG - Intergenic
1081269526 11:41066388-41066410 ACAAAACCTCCAAGAAATATGGG + Intronic
1081291698 11:41334352-41334374 TTTAAACCTGAAACAAGTGTGGG - Intronic
1081343829 11:41958198-41958220 ACAAAACCTCCAAGAAATATGGG + Intergenic
1081379396 11:42395852-42395874 ACAAAACCTCCAAAAAATATGGG + Intergenic
1081958756 11:47117800-47117822 ACTAAGCCTCCAAGAAATATGGG - Intronic
1082136368 11:48554054-48554076 ACAAAACCTCCAAGAAATATGGG - Intergenic
1082314103 11:50695901-50695923 ACAAAACCTCCAAGAAATATGGG + Intergenic
1085066456 11:73499847-73499869 ACAAAGCCTCCAACAAATATGGG + Intronic
1085368721 11:75978538-75978560 ACAAAGCCTCCAACAAATATGGG - Intronic
1085909023 11:80799271-80799293 ACAAAACCTCCAAGAAATATGGG + Intergenic
1086257763 11:84899473-84899495 CCTCACCGTGCAACAAATGTTGG + Intronic
1086303720 11:85458103-85458125 ACAAAACCTCCAAGAAATATGGG - Intronic
1086312140 11:85547654-85547676 ACAAAACCTCCAAGAAATCTGGG - Intronic
1086529075 11:87763059-87763081 ACAAAGCCTCCAACAAATATGGG - Intergenic
1086868946 11:92014193-92014215 ACAAAACCTCCAAGAAATATGGG - Intergenic
1087316859 11:96613773-96613795 ACAAAACCTTCAAGAAATATGGG - Intergenic
1087364072 11:97197375-97197397 ACAAAACCTTCAAAAAATATGGG - Intergenic
1087405429 11:97723554-97723576 ACAAAGCCTGCAACTAATTTGGG + Intergenic
1087471608 11:98582889-98582911 ATTAGTGCTGCAACAAATGTAGG + Intergenic
1088380932 11:109192027-109192049 ACAAAACCTCCAAGAAATATGGG - Intergenic
1088628417 11:111750347-111750369 ACTCAACAATCAACAAATGTTGG + Intronic
1089816077 11:121176845-121176867 ACAAAGCCTCCAAGAAATGTGGG - Intronic
1090180826 11:124697870-124697892 ACCAAACATACAACAAATGATGG + Intergenic
1090737911 11:129627590-129627612 ACTAAACCTGCAATAATTCTGGG - Intergenic
1090869121 11:130727069-130727091 ACTTTACCTGGAACAAAGGTCGG - Intergenic
1091424483 12:375246-375268 ACAAAGCCTCCAAGAAATGTGGG - Intronic
1092332296 12:7595670-7595692 ACAAAACCTCCAAGAAATATGGG + Intergenic
1092637580 12:10468251-10468273 ACAAATCCTTCAAGAAATGTGGG - Intergenic
1093278331 12:17157130-17157152 ACTTAACCTGTAAGAAATGCAGG - Intergenic
1093383199 12:18520387-18520409 ACAAAACCTCCAAGAAATATGGG - Intronic
1093412903 12:18887807-18887829 AGTAAACCTCCAGCAAATCTTGG + Intergenic
1093531965 12:20176172-20176194 ACTAAAGTTAAAACAAATGTAGG - Intergenic
1093595382 12:20952577-20952599 ACAAATCCTCCAAGAAATGTGGG + Intergenic
1093649437 12:21626233-21626255 ACAAAGCCTCCAAGAAATGTGGG - Intergenic
1093690000 12:22100162-22100184 AATAAACCTCCAAGAAATGTGGG - Intronic
1093900302 12:24624283-24624305 ACTAAGCCTCCAAGAAATATGGG - Intergenic
1094340950 12:29410981-29411003 ACTAAGCCTCCAAGAAATATGGG - Intergenic
1094694838 12:32808193-32808215 ACAAAACCTCCAAGAAATGTGGG - Intronic
1094809174 12:34121321-34121343 ACTACATCTGCCACAAATGCAGG + Intergenic
1094811670 12:34144169-34144191 ACAAAACCTTCAAGAAATATGGG + Intergenic
1095599213 12:43996029-43996051 ATTTAACCTGAAACAAATATAGG + Intronic
1096075126 12:48799163-48799185 AATAAAGCTGCAATAAATATGGG + Intergenic
1097917352 12:65035124-65035146 ACAAAACCTCCAAGAAATATGGG - Intergenic
1098375510 12:69809570-69809592 ACAAAGCCTGCAAGAAATATGGG - Intronic
1098585986 12:72155064-72155086 ACAAAACCTCCAAGAAATATGGG - Intronic
1099008538 12:77263661-77263683 ACAAAACCTCCAAGAAATATGGG - Intergenic
1099044823 12:77704511-77704533 ATTAAATCTGCAACAATTGCTGG - Intergenic
1099235959 12:80082937-80082959 ACAAAGCCTCCAACAAATGTGGG - Intergenic
1099238792 12:80114784-80114806 ACAAAGCCTCCAACAAATATGGG - Intergenic
1100028263 12:90154646-90154668 ACAAAACCTCCAAAAAATATGGG + Intergenic
1100926734 12:99557327-99557349 ACAAAACCTTCAAGAAATATGGG - Intronic
1100941245 12:99724477-99724499 ACAAAACCTCCAAGAAATATAGG + Intronic
1101066688 12:101028649-101028671 ACAAAACCTCCAAGAAATATGGG + Intronic
1101111765 12:101493314-101493336 AATGATGCTGCAACAAATGTGGG + Intergenic
1101179401 12:102196838-102196860 ATTACACCTGCCAAAAATGTGGG - Exonic
1101361951 12:104035640-104035662 ACAAAACCTACAAGAAATATGGG + Intronic
1101832405 12:108269448-108269470 ACTACATCTGGAAGAAATGTAGG + Intergenic
1102215089 12:111155345-111155367 AGTAAACGTTCAGCAAATGTTGG + Intronic
1102326295 12:111987684-111987706 AAAAAAACAGCAACAAATGTTGG + Intronic
1105311406 13:19215397-19215419 ACAAAGCCTCCAACAAATATGGG - Intergenic
1105488410 13:20860870-20860892 ACTAAACCTGCAACACTAATAGG + Intronic
1105686177 13:22784506-22784528 ACTAATGCTGCAATAAATGATGG - Intergenic
1106335865 13:28782863-28782885 ACAAAACCTCCAAGAAATATGGG - Intergenic
1106646182 13:31637087-31637109 ACAAAACCTCCAAGAAATATGGG - Intergenic
1106983716 13:35320765-35320787 ACAAAGCCTCCAAGAAATGTGGG - Intronic
1107227341 13:38066848-38066870 ACAAAGCCTCCAACAAATATGGG + Intergenic
1107245487 13:38288848-38288870 ACAAAGCCTGCAAGAAATATGGG - Intergenic
1107507224 13:41046955-41046977 ACAAAGCCTCCAAGAAATGTGGG - Intronic
1107550813 13:41473337-41473359 AATAGAGCTGCAACAAATATGGG + Intergenic
1107594796 13:41951758-41951780 AGTAAGCATTCAACAAATGTTGG - Intronic
1108113624 13:47103972-47103994 ACAAAACCTCCAAGAAATATGGG + Intergenic
1108479840 13:50857384-50857406 ACAAAACCTCCAAGAAATATGGG + Intergenic
1108495725 13:51023234-51023256 AATAATACTGCTACAAATGTGGG - Intergenic
1109190808 13:59321575-59321597 AGTAAACATTCAATAAATGTTGG + Intergenic
1109333468 13:60961252-60961274 AATAGAGCTGCAATAAATGTGGG + Intergenic
1109719460 13:66258434-66258456 ACAAAACCTCCAAGAAATATGGG - Intergenic
1109937609 13:69312015-69312037 TCTATACCTGCAACCAATTTGGG + Intergenic
1110001627 13:70210176-70210198 ACAAAACCTCCAAGAAATATGGG + Intergenic
1110047033 13:70843723-70843745 ACAAAGCCTTCAAGAAATGTGGG + Intergenic
1110674627 13:78226308-78226330 AGTAAGCATTCAACAAATGTTGG - Intergenic
1110729104 13:78859577-78859599 ACAAAACCTCCAAGAAATATGGG - Intergenic
1110870037 13:80440685-80440707 AATAGTGCTGCAACAAATGTGGG + Intergenic
1111332674 13:86781095-86781117 ACAAAACCTTCAAGAAATATGGG - Intergenic
1111450601 13:88409942-88409964 TCCAAGGCTGCAACAAATGTTGG + Intergenic
1111782525 13:92746408-92746430 ACTAAAAATGAAACAGATGTAGG - Intronic
1111932750 13:94528110-94528132 ACAAAACCTCCAAGAAATATGGG + Intergenic
1112130963 13:96523535-96523557 ACAAAAACTCCAACAAATATGGG - Intronic
1112173796 13:97000903-97000925 GATACACCTTCAACAAATGTAGG + Intergenic
1113540347 13:111102403-111102425 ACAAAACCTTCAAGAAATATGGG + Intergenic
1114573081 14:23688990-23689012 ACAAAGCCTGCAAGAAATATGGG - Intergenic
1114694183 14:24611375-24611397 ACAAAGCCTCCAAGAAATGTGGG - Intergenic
1114747774 14:25168535-25168557 ACAAAACCTCCAAGAAATATGGG + Intergenic
1114749289 14:25184871-25184893 ACAAAACCTCCAAGAAATATAGG + Intergenic
1114918399 14:27295907-27295929 AGTATACCTGCAACACAGGTAGG - Intergenic
1114948047 14:27711786-27711808 ACTAGCCATGCAACAAATATAGG + Intergenic
1115184071 14:30664867-30664889 ACAAAGCCTCCAAGAAATGTGGG + Intronic
1115511425 14:34141111-34141133 ACAAAGCCTCCAACAAATATGGG + Intronic
1115967945 14:38913053-38913075 ACAAAACCTCCAAGAAATATGGG + Intergenic
1115971914 14:38954243-38954265 ACTAAACCGCCAAGTAATGTGGG + Intergenic
1116026419 14:39520977-39520999 AATAATGCTGCAACAAATATGGG + Intergenic
1116212604 14:41967481-41967503 ACAAAACCTCCAAGAAATATGGG - Intergenic
1116401649 14:44514854-44514876 ACAAAACCTCCAAGAAATATGGG - Intergenic
1116489053 14:45485302-45485324 ACAAAGCCTCCAACAAATATGGG - Intergenic
1116792861 14:49358049-49358071 ACAAAGCCTCCAAGAAATGTGGG + Intergenic
1117452387 14:55864350-55864372 ACAAAACCTCCAAGAAATATGGG - Intergenic
1117638896 14:57776120-57776142 ACAAAACCTCCAAGAAATATGGG + Intronic
1118450189 14:65893515-65893537 ACAAAGCCTCCAAGAAATGTGGG + Intergenic
1118465899 14:66031123-66031145 ACAAAGCCTCCAAGAAATGTGGG - Intergenic
1118530831 14:66703114-66703136 ACAAAACCTCCAAGAAATATGGG + Intronic
1119006972 14:70940797-70940819 ACAAAACCTCCAAGAAATATGGG - Intronic
1119727588 14:76931174-76931196 ACTAAAAATACAAAAAATGTAGG + Intergenic
1119866250 14:77977633-77977655 ACTAAGCCTTCAATACATGTGGG + Intergenic
1120212599 14:81648702-81648724 AACAATGCTGCAACAAATGTGGG - Intergenic
1120338428 14:83188970-83188992 ACAAAACCTCCAAGAAATATGGG - Intergenic
1120586097 14:86313686-86313708 ACAAAGCCTCCAAGAAATGTGGG + Intergenic
1120657292 14:87207466-87207488 AGTAAATCTGCAACTGATGTGGG - Intergenic
1123822492 15:24044647-24044669 ACAAAGCCTCCAAGAAATGTGGG + Intergenic
1124046390 15:26154666-26154688 ACAAAACCTCCAAGAAATATGGG - Intergenic
1124257747 15:28159407-28159429 ACAAAACCTCCAAGAAATATGGG - Intronic
1125235035 15:37503119-37503141 ACAAAACCTCCAAGAAATATGGG + Intergenic
1126500386 15:49338796-49338818 ACAAAGCCTCCAACAAATATGGG - Intronic
1126945518 15:53814837-53814859 ACTAACACTGCAATAAATGTAGG + Intergenic
1126956389 15:53937356-53937378 ACAAAACCTCCAAGAAATATGGG + Intergenic
1127017043 15:54700276-54700298 ACAAAGCCTCCAAGAAATGTGGG + Intergenic
1127042497 15:54992055-54992077 ACGAAACCTCCAAGAAATATGGG + Intergenic
1127193851 15:56562871-56562893 ACAAAGCCTCCAAGAAATGTGGG + Intergenic
1127570743 15:60238631-60238653 ACAAAACCTCCAAGAAATATGGG + Intergenic
1128849814 15:70942964-70942986 ACTAAAGATGACACAAATGTTGG - Intronic
1129631116 15:77261580-77261602 ACAAAGCCTCCAACAAATATAGG + Intronic
1129971542 15:79781813-79781835 ACAAAACCTTCAAGAAATATGGG + Intergenic
1130452745 15:84073542-84073564 ACAAAGCCTCCAAGAAATGTGGG + Intergenic
1130572154 15:85056479-85056501 ACAAAGCCTCCAAGAAATGTGGG - Intronic
1130779324 15:87018093-87018115 ACAAAACCTCCAAGAAATATGGG + Intronic
1131599638 15:93832979-93833001 ACAAAACCTGCAACAAAATGAGG + Intergenic
1131711570 15:95061421-95061443 ACAAAACCTCCAAGAAATATGGG - Intergenic
1131930367 15:97434162-97434184 ACAAAGCCTCCAAGAAATGTGGG + Intergenic
1132281377 15:100618849-100618871 ACTAAACCCTCAATAAATGTTGG - Intronic
1134797287 16:17053072-17053094 ACAAAACCTCCAAGAAATATGGG - Intergenic
1135807706 16:25557617-25557639 ACAAAACCTCCAAGAAATATGGG + Intergenic
1136992034 16:35158837-35158859 ACAAAGCCTCCAAGAAATGTGGG + Intergenic
1137051779 16:35720495-35720517 ACAAAGCCTGCAGGAAATGTGGG - Intergenic
1138799878 16:60014259-60014281 ACAAAACCTCCAAGAAATATGGG + Intergenic
1138887072 16:61092234-61092256 ACAAAGCCTCCAAGAAATGTGGG + Intergenic
1139077414 16:63469150-63469172 AATAGACCTGCAACAAACATAGG - Intergenic
1140018003 16:71206898-71206920 ACAAAACCTCCAAGAAATATGGG + Intronic
1140148113 16:72332174-72332196 ACAAAACCTCCAAGAAATATGGG - Intergenic
1140984041 16:80140985-80141007 ACAAAACCTCCAAGAAATATGGG - Intergenic
1141071206 16:80956139-80956161 ACAAAACCTCCAAGAAATGTGGG + Intergenic
1142916300 17:3142007-3142029 ACAAAACGTCCAAGAAATGTGGG - Intergenic
1144294159 17:13856952-13856974 ACTAAGCCTCCAAGAAATATGGG + Intergenic
1144491551 17:15716533-15716555 CCTATACCTGCAATGAATGTGGG + Exonic
1144908933 17:18662672-18662694 CCTATACCTGCAATGAATGTGGG - Exonic
1145396644 17:22501619-22501641 ACAAAACCTCCAAGAAATATGGG - Intergenic
1146141551 17:30372443-30372465 ACTAAACTTAAAACAGATGTAGG - Intergenic
1146298400 17:31669590-31669612 ACAAAACCTCCAAGAAATATGGG - Intergenic
1146973962 17:37095343-37095365 CCTTAACCTGAACCAAATGTCGG + Intronic
1148993916 17:51691019-51691041 AATAATGCTGCAACAAATATGGG + Intronic
1149149866 17:53548731-53548753 ACTAATGCTGCAATGAATGTGGG + Intergenic
1153298056 18:3566761-3566783 ACTAAATATACAGCAAATGTTGG - Intronic
1153857984 18:9170383-9170405 ACAAAACCTCCAAGAAATATGGG - Intronic
1154060882 18:11058746-11058768 ACAAAACCTCCAAGAAATATGGG + Intronic
1154414062 18:14164118-14164140 ACAAAGCCTCCAAGAAATGTGGG + Intergenic
1154984594 18:21536979-21537001 CATAAACCTCCAAGAAATGTGGG - Intronic
1155113114 18:22736110-22736132 AATAATGCTGCAATAAATGTGGG - Intergenic
1155464751 18:26121916-26121938 ACAAAACCTCCAAGAAATATGGG + Intergenic
1155863656 18:30936418-30936440 AATAAAGTTGCAACAAATATGGG + Intergenic
1156227778 18:35126056-35126078 ACTAAATATGCAAGAAATGCTGG - Intronic
1156467862 18:37359329-37359351 ACTAAAAAGGCAACAAATGATGG - Intronic
1158790576 18:60775530-60775552 ACAAAGCCTGCAAGAAATATAGG + Intergenic
1159486214 18:69060937-69060959 AATAAACATTCAACAAATATCGG + Intergenic
1159646298 18:70922145-70922167 ACCAAACCTCCAAGAAATATGGG + Intergenic
1159811005 18:73017860-73017882 ACAAAGCCTGCAAGAAATATGGG + Intergenic
1161589284 19:5121756-5121778 ACTGAACCTGCAGAGAATGTGGG - Intronic
1166585865 19:43948319-43948341 ACAAAACCTCCAAGAAATATGGG - Intergenic
1166836890 19:45672844-45672866 ACGAAACCTGCAGCCACTGTGGG - Exonic
1167370117 19:49075721-49075743 ACTAAAAATACAACAATTGTAGG - Intergenic
1167772026 19:51527016-51527038 ACAAAACCTCCAAAAACTGTGGG + Intronic
1168437743 19:56335272-56335294 ACCAAACCTCCAAGAAATATGGG + Intronic
926987188 2:18637919-18637941 ACAAAACCTCCAAGAAATATGGG - Intergenic
927006841 2:18860170-18860192 ACAAAACCTCCAAGAAATATGGG - Intergenic
927058301 2:19388634-19388656 ACAAAGCCTCCAAGAAATGTGGG - Intergenic
927476124 2:23415501-23415523 ACTAAACCTCCAAAACTTGTGGG - Intronic
928492338 2:31796781-31796803 ACAAAGCCTCCAACAAATATGGG + Intergenic
928609183 2:32975551-32975573 ATGAAACCTCCAACAAATATGGG - Intronic
928653778 2:33428209-33428231 CCCAAATCTGCAACAAATTTTGG + Intergenic
928850179 2:35735626-35735648 ACAAAACCTGCAAGAAATATGGG + Intergenic
928881202 2:36098469-36098491 ACAAAACCTCCAAGAAATATGGG + Intergenic
929068897 2:38009380-38009402 ACAAAGCCTCCAAGAAATGTGGG - Intronic
929832794 2:45361501-45361523 ACTAAAACTAAAACAAATGTAGG - Intergenic
929932478 2:46269607-46269629 TCTAAACCCGAAACAAATTTAGG + Intergenic
930571585 2:53092961-53092983 AATAAATCTGCAACCAATGTGGG - Intergenic
930699100 2:54441219-54441241 AGTAAATCTGGAACAAATCTAGG - Intergenic
930860202 2:56064219-56064241 ACTAAGCCTCCAAGAAATATGGG - Intergenic
930893831 2:56422508-56422530 ACAAAACCTCCAACAAATATGGG + Intergenic
931204537 2:60134867-60134889 ACAAAACCTCCAAGAAATATGGG - Intergenic
931556132 2:63507906-63507928 ACAAAGCCTGCAAGAAATATGGG + Intronic
931557419 2:63520209-63520231 ACAAAACCTCCAAGAAATATGGG + Intronic
931921327 2:67019299-67019321 ACAAAACCTCCAAGAAATATAGG + Intergenic
932198405 2:69804190-69804212 ACTAAACATTTAATAAATGTTGG - Intronic
933012050 2:77078310-77078332 TCTAAACCAACAACAAATCTAGG + Intronic
933366591 2:81361630-81361652 ACAAATCCTCCAAGAAATGTGGG - Intergenic
934149162 2:89128928-89128950 ACTAGACCTGCAAGAGATGGAGG + Intergenic
934531733 2:95094205-95094227 ACAAAACCTCCAAGAAATATGGG + Intronic
934796474 2:97104687-97104709 ACAAAGCCTCCAAGAAATGTGGG + Intergenic
935467806 2:103420044-103420066 ACTAAACCTGTATGAAATGATGG - Intergenic
935473640 2:103490625-103490647 ACTGAACCTAAAACAAATGGTGG + Intergenic
935566083 2:104608789-104608811 ACAAAACCTCCAAGAAATATGGG + Intergenic
935603917 2:104950553-104950575 ACTAAGGCTGGAACATATGTGGG + Intergenic
935604606 2:104958278-104958300 ACAAAACCTCCAAGAAATATGGG - Intergenic
935848184 2:107188999-107189021 ACAAAACCTCCAAGAAATATGGG + Intergenic
936674059 2:114693748-114693770 ACGAAACCTCCAAGAAATATGGG - Intronic
936845604 2:116827607-116827629 AATAATGCTGCAATAAATGTGGG + Intergenic
936995652 2:118411055-118411077 ACAAAGCCTCCAAGAAATGTGGG + Intergenic
938559305 2:132457149-132457171 ACAAAACCTCCAAGAAATATGGG - Intronic
938662126 2:133498140-133498162 ACAAAAACAGCCACAAATGTCGG - Intronic
938854502 2:135296248-135296270 ACAAAGCCTCCAACAAATATGGG - Intronic
939000288 2:136726920-136726942 ACAAAACCTCCAAGAAATATGGG - Intergenic
939074759 2:137587006-137587028 ACAAAACCTCCAAGAAATATGGG - Intronic
939089190 2:137758720-137758742 ACAAAACCTTCAAGAAATATAGG + Intergenic
939193261 2:138941621-138941643 ACAAAACCTCCAAGAAATATGGG - Intergenic
939789270 2:146551046-146551068 ACTAAGCCTGTGACACATGTAGG - Intergenic
941054173 2:160767942-160767964 ACAAAGCCTCCAAGAAATGTGGG + Intergenic
941527722 2:166627404-166627426 ACAAAACCTCCAAGAAATATGGG - Intergenic
941681089 2:168400466-168400488 ACAAAACCTCCAAGAAATATGGG - Intergenic
942762733 2:179418885-179418907 ACTAATCCTGCAATAAACATGGG - Intergenic
942809251 2:179977276-179977298 AATAATGCTGCAATAAATGTGGG - Intronic
942854662 2:180531258-180531280 ACAAAGCCTCCAAGAAATGTGGG - Intergenic
942898912 2:181090693-181090715 ACAAAGCCTCCAACAAATATGGG + Intergenic
942989347 2:182180755-182180777 ACAAAACCTCCGAGAAATGTGGG - Intronic
943020296 2:182564723-182564745 ACAAAGCCTCCAAGAAATGTGGG - Intergenic
943038335 2:182773497-182773519 ACAAAACCTCCAAGAAATATGGG - Intronic
943047497 2:182875943-182875965 ACAAAACCTTCAAGAAATATGGG + Intergenic
943109501 2:183587653-183587675 ACAAAGCCTGCAAGAAATATGGG + Intergenic
943297451 2:186156377-186156399 ACAAAACCTCCAAGAAATATGGG + Intergenic
943514190 2:188863721-188863743 ACAAAATCTTCAAGAAATGTGGG + Intergenic
943548830 2:189313184-189313206 ACAAAACCTCCAAGAAATGTGGG + Intergenic
943630154 2:190242130-190242152 ACAAAGCCTCCAAGAAATGTAGG - Intronic
944411417 2:199446997-199447019 ACTAAAACTGCAGATAATGTCGG - Intronic
944447043 2:199802432-199802454 ACTAAAATTGCATAAAATGTAGG + Intronic
944457406 2:199910185-199910207 AGTAAACCCTCAACAAATGTTGG + Intergenic
945269022 2:207920224-207920246 ACTAAACCTGACAAACATGTAGG + Intronic
945294419 2:208156691-208156713 ACTGAACCTGCAGCAAACTTTGG + Intergenic
945750376 2:213774810-213774832 ACTAAAGCTTCAACAAAATTAGG - Intronic
946510443 2:220349944-220349966 ACTTCAGCTGAAACAAATGTGGG + Intergenic
946703116 2:222432246-222432268 ATTCAAGCAGCAACAAATGTAGG + Intronic
1168882402 20:1218197-1218219 ACAAAGCCTCCAAGAAATGTGGG + Intergenic
1169161413 20:3382276-3382298 ATTAAAACAGCAACAAATTTCGG + Intronic
1169606022 20:7320130-7320152 ACAAAGCCTCCAAGAAATGTGGG + Intergenic
1169846175 20:9994112-9994134 ACAAAAAATGGAACAAATGTGGG - Intronic
1170492290 20:16890115-16890137 ACAAAACCTCCAAGAAATATGGG + Intergenic
1170707652 20:18759905-18759927 ACAAAACCTCCAAGAAATATGGG - Intronic
1171080439 20:22177051-22177073 ACAAAGCCTGCAAGAAATTTGGG - Intergenic
1171153814 20:22852863-22852885 ACAAAACCTCCAAGAAATATGGG + Intergenic
1171247060 20:23620000-23620022 ACAAAACCTCCAAGAAATATGGG - Intergenic
1171774895 20:29356139-29356161 ACAAAACCTTCAAGAAATATGGG + Intergenic
1171895339 20:30753146-30753168 ACTGAACCTAAAATAAATGTTGG + Intergenic
1171901441 20:30862225-30862247 ACAAAACCTTCAAGAAATATGGG - Intergenic
1173127401 20:40352002-40352024 ACTAATGTTGCAACAAATATGGG - Intergenic
1174338162 20:49879081-49879103 ATCAAACCTGAAACAAGTGTAGG + Intronic
1176350127 21:5786593-5786615 ACAAAACCTCCAAGAAATATGGG + Intergenic
1176356941 21:5907177-5907199 ACAAAACCTCCAAGAAATATGGG + Intergenic
1176544448 21:8184663-8184685 ACAAAACCTCCAAGAAATATGGG + Intergenic
1176563399 21:8367708-8367730 ACAAAACCTCCAAGAAATATGGG + Intergenic
1177028209 21:15949217-15949239 ACTAAACCTGTAACCAACATAGG - Intergenic
1177042540 21:16131868-16131890 ACAAAACCTCCAAGAAATATGGG - Intergenic
1177856848 21:26409066-26409088 ACTAAACCTGGAAGGAATCTGGG - Intergenic
1177943247 21:27436639-27436661 ACAAAGCCTCCAAGAAATGTGGG - Intergenic
1178060587 21:28849840-28849862 ATAAAACCTCCAACAAATATGGG + Intergenic
1179517783 21:41920871-41920893 CCAAAACATGCATCAAATGTTGG + Intronic
1180334809 22:11568170-11568192 ACAAAACCTTCAAGAAATATGGG - Intergenic
1183021336 22:35029610-35029632 ACAAAACCTCCAAGAAATATGGG - Intergenic
1183109564 22:35638988-35639010 ACTAAATGTTCAGCAAATGTCGG - Intergenic
1203249317 22_KI270733v1_random:100901-100923 ACAAAACCTCCAAGAAATATGGG + Intergenic
949173722 3:1033798-1033820 ACAAAACCTTCAAGAAATGTGGG - Intergenic
949696397 3:6700707-6700729 ACAAAACCTCCAAGAAATGTGGG + Intergenic
950302741 3:11895640-11895662 ACAAAGCCTCCAAGAAATGTGGG + Intergenic
950615813 3:14157341-14157363 AATAAACCTGCGACAAATCTGGG + Intronic
951150597 3:19285438-19285460 TATAAACCTATAACAAATGTAGG - Intronic
951277219 3:20702959-20702981 ACTAAACCTGAAGAAAATGGAGG - Intergenic
951628962 3:24698136-24698158 ACAAAGCCTCCAACAAATATGGG - Intergenic
951777108 3:26322735-26322757 ACAAAACCTCCAAGAAATATGGG - Intergenic
953074205 3:39552674-39552696 ACAAAGCCTCCAAGAAATGTGGG + Intergenic
953112366 3:39954996-39955018 ACAAAGCCTCCAAGAAATGTGGG + Intronic
953817979 3:46177412-46177434 ACAAAACCTCCAAGAAATATGGG - Intronic
954502153 3:51028588-51028610 ACAAAACCTTCAAGAAATATGGG - Intronic
955435811 3:58898048-58898070 ACAAAACCTCCAAGAAATATGGG - Intronic
955586294 3:60481146-60481168 ACAAAACCTCCAAGAAATATGGG + Intronic
955669899 3:61392558-61392580 ACAAAGCCTCCAAGAAATGTGGG + Intergenic
956268912 3:67428922-67428944 ACAAAACCTCCAAGAAATATGGG + Intronic
957667221 3:83248296-83248318 ACAAAGCCTCCAAGAAATGTGGG - Intergenic
957762703 3:84579426-84579448 ACTAATGCTGCACCAAATGTGGG - Intergenic
957798906 3:85049306-85049328 ACTAAACCTGCAACAAATGTAGG - Intronic
957840901 3:85668019-85668041 AGTAGACCTTCAACAAACGTTGG + Intronic
958191632 3:90192267-90192289 ACAAAACCTCCAAGAAATATGGG - Intergenic
958413848 3:93851427-93851449 ACAAAGCCTCCAACAAATATGGG - Intergenic
958702969 3:97616753-97616775 ACAAAACCTCCAAGAAATATAGG + Intronic
959173866 3:102879469-102879491 ACTAAACCTGCAATAATTAAAGG + Intergenic
959291157 3:104475949-104475971 ACAAAACCTCCAAGAAATATGGG + Intergenic
960578203 3:119247801-119247823 ACAAAGCCTGCAAGAAATATGGG + Intergenic
960680007 3:120237984-120238006 ACAAAACCTCCAAGAAATATGGG - Intronic
960688225 3:120315027-120315049 ACAAAACCTCCAAGAAATGAGGG + Intergenic
960759955 3:121062677-121062699 ACAAAACCTCCAAGAAATATGGG - Intronic
961958906 3:130833275-130833297 ACAAAGCCTCCAAGAAATGTGGG + Intergenic
962180948 3:133205967-133205989 ACAAAGCCTCCAACAAATATGGG - Intronic
962707150 3:138055031-138055053 GCTATTCCTGCAAAAAATGTTGG - Intergenic
962970369 3:140395373-140395395 ACTAAACGTGGAAGAGATGTGGG - Intronic
963342868 3:144058107-144058129 ACTAAACCACCACCAAGTGTTGG - Intergenic
963549476 3:146702189-146702211 ACAAAACCTTCAAGAAATATGGG + Intergenic
963595092 3:147316297-147316319 ACAAAACCTCCAAGAAATGTGGG - Intergenic
964377881 3:156067830-156067852 ACAAAGCCTCCAACAAATATGGG - Intronic
964440635 3:156705172-156705194 TCAAAACCTGCTACAAATGCTGG - Exonic
964715390 3:159715722-159715744 ACTAAGCCTCCAAGAAATATGGG + Intronic
964953028 3:162320846-162320868 AAGAAAGCTGCAATAAATGTGGG + Intergenic
965015429 3:163151394-163151416 ACAAAGCCTCCAAGAAATGTGGG + Intergenic
965317936 3:167213517-167213539 ACAAAACCTCCAACAATTATGGG + Intergenic
965445487 3:168769118-168769140 ACAAAGCCTCCAAGAAATGTGGG - Intergenic
966000403 3:174942702-174942724 ACAAAACCTCCAAGAAATATGGG - Intronic
966152489 3:176879284-176879306 ACAAAACCTCCAAGAAATATGGG + Intergenic
966251226 3:177867190-177867212 ACAAAGCCTGCAAGAAATATGGG + Intergenic
966269883 3:178091778-178091800 ACAAAACCTCCAAGAAATATGGG + Intergenic
967691172 3:192475402-192475424 ACAAAACATACAACTAATGTAGG + Intronic
968198270 3:196728949-196728971 ACAAAATCTGCAACAAAACTAGG - Intronic
968358872 3:198132588-198132610 ACAAAACCTTCAAGAAATATGGG - Intergenic
969909040 4:10426778-10426800 ACAAAACCTCCAAGAAATATGGG - Intergenic
970037110 4:11749744-11749766 AATAATGCTGCAATAAATGTGGG + Intergenic
970055199 4:11964042-11964064 ACAAAGCCTCCAACAAATATGGG - Intergenic
970129938 4:12857415-12857437 AATAATGCTGCAATAAATGTGGG - Intergenic
970496388 4:16629909-16629931 ACAAAACCTCCAAGAAATATGGG + Intronic
971411565 4:26378528-26378550 ACTAAACCTGGAAACAATATTGG + Intronic
971560927 4:28078753-28078775 ACAAAGCCTCCAACAAATATGGG + Intergenic
972124214 4:35742600-35742622 ACAAAACCTTCAAGAAATATGGG + Intergenic
972178648 4:36438768-36438790 ACAAAGCCTCCAAGAAATGTGGG - Intergenic
972962896 4:44475186-44475208 ACTAAGCCTCCAAGAAATATGGG + Intergenic
973009443 4:45053013-45053035 ACAAAGCCTCCAAGAAATGTGGG + Intergenic
973133966 4:46683098-46683120 ACTAAATCTATACCAAATGTAGG + Intergenic
973976833 4:56271306-56271328 AAAATACCTCCAACAAATGTTGG + Intronic
975041228 4:69746372-69746394 ACAAAACCTCCAAGAAATATGGG - Intronic
975092162 4:70416773-70416795 ACTAAACCTGCTAAAAATTTAGG + Intergenic
975150286 4:71013230-71013252 ACAAAACCTCCAAGAAATATGGG + Intronic
975178057 4:71310155-71310177 ACAAAACCTCCAAGAAATATGGG + Intronic
975551280 4:75615597-75615619 ACTAAATCTTATACAAATGTGGG + Intronic
976018662 4:80592102-80592124 ACTAAAATTGCTACAAATTTTGG + Intronic
976368609 4:84260222-84260244 ACAAAACCTTCAAGAAATATAGG + Intergenic
976698427 4:87942941-87942963 ACAAAACCTCCAAGAAATATGGG + Intergenic
976942019 4:90713811-90713833 ACAAAACCTCCAAGAAATATGGG - Intronic
977029379 4:91862996-91863018 ACAAAACCTCCAAGAAATATGGG - Intergenic
977897286 4:102379422-102379444 ACAAAACCTCCAAGAAATATGGG - Intronic
978206318 4:106084409-106084431 ACAAAACCTCCAAGAAATATGGG + Intronic
978523821 4:109643884-109643906 ACTAAAGCTGTAAAACATGTTGG + Intronic
978597143 4:110390397-110390419 ACAAAACCTCCAAGAAATATGGG - Intronic
979019909 4:115483270-115483292 GCTAAACTTGCAACAAATGATGG + Intergenic
979142568 4:117196197-117196219 AATAATGCTGCAATAAATGTGGG - Intergenic
979462560 4:121000675-121000697 ACAAAACCTCCAAGAAATATGGG - Intergenic
979510569 4:121549344-121549366 ACAAAGCCTGCAAGAAATATGGG - Intergenic
979541722 4:121891434-121891456 ACTAAAACTAAACCAAATGTAGG + Intronic
979712558 4:123797302-123797324 ACAAAGCCTCCAAGAAATGTGGG - Intergenic
979817712 4:125130405-125130427 ACTAAATCTGCAATGAATTTAGG - Intergenic
980148032 4:129013976-129013998 ACAAAACCTCCAAGAAATATGGG - Intronic
980157484 4:129125193-129125215 ACAAACCCTCCAAGAAATGTGGG - Intergenic
981441928 4:144793048-144793070 ACAAAACCTCCAAGAAATATGGG + Intergenic
983665135 4:170173077-170173099 AATAATGCTGCAATAAATGTGGG + Intergenic
983717827 4:170807194-170807216 ACAAAACCTCCAAGAAATATGGG - Intergenic
983877224 4:172891805-172891827 ACAAAACCAGCAATAAATATGGG - Intronic
983879198 4:172913713-172913735 ACAAAGCCTCCAAGAAATGTGGG + Intronic
983952425 4:173658301-173658323 AATAAAACTGCCACAAATTTAGG + Intergenic
984067283 4:175063579-175063601 ACAAAGCCTGCAAGAAATATGGG + Intergenic
984071619 4:175121027-175121049 ACAAAACCTCCAAAAAATATGGG + Intergenic
985186231 4:187318848-187318870 ACAAAACCTTCAAGAAATATGGG + Intergenic
985345452 4:189000245-189000267 ACAAAACCTCCAAGAAATATGGG - Intergenic
985365874 4:189232133-189232155 ACAAAACCTCCAAGAAATATAGG - Intergenic
987369178 5:17177410-17177432 ACTATACCTCCATTAAATGTAGG - Intronic
987759543 5:22142692-22142714 ATTACACCTGCCAAAAATGTGGG + Intronic
988128621 5:27074792-27074814 ACAAAACCTCCAACAAGTATGGG + Intronic
988238510 5:28576850-28576872 ACAAAACCTCCGAGAAATGTGGG + Intergenic
988936148 5:36084716-36084738 ACAAAACCTCCAAAAAGTGTGGG + Intergenic
988967164 5:36431130-36431152 ACAAAACCTCCAAGAAATTTGGG - Intergenic
988970945 5:36466775-36466797 ACAAAGCCTCCAAGAAATGTGGG + Intergenic
989029741 5:37106245-37106267 AATAGAGCTGCAATAAATGTAGG - Exonic
989753660 5:44925186-44925208 ATGAGACATGCAACAAATGTAGG + Intergenic
990143933 5:52737175-52737197 AGTAAAGTTGAAACAAATGTAGG - Intergenic
990167995 5:53016755-53016777 ACAAAACCTCCAAGAAATATGGG - Intronic
990619958 5:57549084-57549106 ACAAAACCTCCAAGAAATATGGG - Intergenic
991244143 5:64490960-64490982 ACAAAACCTCCAAGAAATATGGG + Intergenic
991397618 5:66221564-66221586 ACAAAACCTCCAAGAAATATGGG - Intergenic
991421661 5:66448942-66448964 ACTAAGCCTCCAAGAAATATGGG - Intergenic
991894263 5:71376125-71376147 ATTACACCTGCCAAAAATGTGGG + Intergenic
991938068 5:71822350-71822372 AACAATGCTGCAACAAATGTAGG + Intergenic
992038727 5:72807705-72807727 ACAAAGCCTCCAAGAAATGTGGG - Intergenic
992160796 5:73999269-73999291 AACAAATCTGGAACAAATGTAGG - Intergenic
992576599 5:78119661-78119683 ACAAAGCCTCCAAGAAATGTGGG + Intronic
993008692 5:82456211-82456233 ACAAAGCCTCCAAGAAATGTGGG - Intergenic
993225376 5:85163251-85163273 TCTAAACCTCCAAGAAATATGGG - Intergenic
993280840 5:85922399-85922421 ACAAAACCTCCAAGAAATATGGG + Intergenic
993341510 5:86730503-86730525 ACAAAGCCTGCAAGAAATATGGG - Intergenic
993433956 5:87867784-87867806 ACAAAATCAGCAACATATGTCGG + Intergenic
993497300 5:88622115-88622137 ACAAAACCTCCAAGAAATATGGG - Intergenic
993582831 5:89684207-89684229 AATACAGCTGCAACAAATATAGG - Intergenic
993793522 5:92236805-92236827 ACAAAAACTGCAAGAAATATGGG - Intergenic
993891833 5:93483922-93483944 ACAAAACCTCCAAGAAATATGGG + Intergenic
994233384 5:97335069-97335091 ACAAAGCCTGCAAGAAATATGGG - Intergenic
994346665 5:98695784-98695806 ACAAAACCTCCAAGAACTGTGGG - Intergenic
994586413 5:101714926-101714948 ACAAAGCCTCCAACAAATATGGG - Intergenic
994609670 5:102020041-102020063 ACAAAGCCTCCAAGAAATGTGGG + Intergenic
994845246 5:104980547-104980569 AATAGTACTGCAACAAATGTAGG + Intergenic
994861307 5:105199336-105199358 ACAAAGCCTCCAACAAATATGGG + Intergenic
994970643 5:106732100-106732122 ACAAAACCTCCAAGAAATATGGG + Intergenic
994973697 5:106775650-106775672 ACAAAGCCTGCAAGAAATATGGG - Intergenic
995578899 5:113573635-113573657 ACAAAACCTCCAAGAAATATGGG - Intronic
996165945 5:120223929-120223951 ACAAAACCTCCAAGAAATATGGG + Intergenic
996249874 5:121316586-121316608 ACAAAACCTCCAAGAAATATGGG - Intergenic
996829006 5:127719340-127719362 ACTAGTGCTGCAATAAATGTGGG + Intergenic
996964297 5:129289899-129289921 ACAAAGCCTCCAAGAAATGTGGG - Intergenic
997182090 5:131840514-131840536 ACAAAACCTCCAAGAAATATGGG - Intronic
998541835 5:142990124-142990146 ACAAATCCTCCAAGAAATGTGGG - Intronic
998717868 5:144906553-144906575 ACAAAACCTCCAAGAAATATGGG + Intergenic
999415688 5:151394073-151394095 ACAAAACCTCCAAGAAATATGGG - Intergenic
1000720028 5:164694401-164694423 ACAAAACCTCCAAGAATTGTGGG + Intergenic
1000995911 5:167959150-167959172 ACTAAGCCTCCAAGAAATATGGG - Intronic
1002920764 6:1570948-1570970 ACAAAACCTCAAAGAAATGTGGG - Intergenic
1002982949 6:2160009-2160031 ACGAAACCTACAAAAAATCTTGG + Intronic
1003570482 6:7253291-7253313 ACTAAAACTGCAAAAAAATTTGG + Intergenic
1005558268 6:27009884-27009906 ACAAAACCTCCAAGAAATATGGG + Intergenic
1005687184 6:28265906-28265928 ACTGAACCTAAAACAAAAGTTGG - Intergenic
1007469786 6:42081667-42081689 ACTAAACCTACAAAAAAATTAGG - Exonic
1008193487 6:48489096-48489118 AATAATGCTGCAATAAATGTGGG - Intergenic
1008677420 6:53834807-53834829 ACTAAACATACAAAAAATGGTGG + Intronic
1009191426 6:60634459-60634481 ACAAAACCTCCAAGAAATATGGG - Intergenic
1009240935 6:61184923-61184945 ACAAAACCTACAAGAAATATGGG + Intergenic
1009598985 6:65773105-65773127 ACAAAACCTCCAAGAAATGTGGG + Intergenic
1009628791 6:66167971-66167993 ACAAAGCCTCCAACAAATATGGG + Intergenic
1009652211 6:66490520-66490542 ACAAAACCTCCAAGAAATATAGG + Intergenic
1009873909 6:69481665-69481687 ACAAAACCTCCAAGAAATATGGG + Intergenic
1009959349 6:70500148-70500170 ACAAAGCCTCCAAAAAATGTGGG - Intronic
1010031173 6:71271970-71271992 ACAAAACCTCCAAGAAATATGGG + Intergenic
1010085655 6:71914840-71914862 ACAAAACATGCTACAAATTTAGG + Intronic
1010282110 6:74034345-74034367 ACAAAACCTCCAAGAAATATGGG - Intergenic
1010331451 6:74627795-74627817 ACAAAACCTCCAGGAAATGTGGG + Intergenic
1010476792 6:76298206-76298228 ACAAAGCCTGCAAGAAATCTGGG - Intergenic
1010484410 6:76391973-76391995 ACAAAGCCTGCAAGAAATATGGG + Intergenic
1011062868 6:83291789-83291811 ACAAAACCTCCAAGAAATATGGG - Intronic
1011358405 6:86496777-86496799 ACAAAGCCTGCAAGAAATATGGG - Intergenic
1011376593 6:86694051-86694073 ACAAAACCTCCAAGAAATATGGG - Intergenic
1011589083 6:88953447-88953469 ACAAAGCCTCCAAGAAATGTGGG + Intronic
1011650971 6:89505787-89505809 AGTAATGCTGCAACAAACGTGGG - Intronic
1011953465 6:92996626-92996648 ACAAAACCTCCAAGAAATATGGG + Intergenic
1012420844 6:99063597-99063619 GCTAAATCTCCAACAAAGGTAGG - Intergenic
1012484309 6:99703592-99703614 ACAAAACCTCCAAGAAATATGGG + Intergenic
1012549088 6:100451407-100451429 GCTAAACCTGCAATAGATTTTGG + Intronic
1012590117 6:100970173-100970195 ACAAAGCCTACAACAAATATGGG + Intergenic
1012668999 6:102016597-102016619 ACAAAACCTCCAAAAAATATGGG + Intronic
1012741027 6:103017191-103017213 ACAAAACCTCCAAGAAATATGGG - Intergenic
1012869610 6:104657868-104657890 ACAAAACCTCCAAGAAATATGGG + Intergenic
1013200567 6:107891235-107891257 ACAAAGCCTGCAAGAAGTGTGGG - Intronic
1013898516 6:115122710-115122732 ACAAAACCTCCAAGAAATATGGG + Intergenic
1014064806 6:117112016-117112038 ACAAAACCTCCAAGAAATATGGG + Intergenic
1014070530 6:117176349-117176371 ACTAAGCCTCCAAGAAATATGGG + Intergenic
1014595679 6:123334660-123334682 ACTGAACCAGCAACAAAAGTTGG + Intronic
1014841311 6:126223824-126223846 ACAAAACCTCCAAGAAATATGGG - Intergenic
1015488494 6:133799149-133799171 ACAAAACCTCCAAAAAATATGGG - Intergenic
1015902047 6:138077461-138077483 ACAAAACCTCCAAGAAATATGGG + Intergenic
1016017672 6:139203160-139203182 AATAATGCTGCAATAAATGTGGG + Intergenic
1016418235 6:143856103-143856125 ACAAAGCCTCCAACAAATATGGG - Intronic
1017040154 6:150301768-150301790 CTTAAACCTGCAACACAAGTCGG + Intergenic
1018124837 6:160671828-160671850 ACAAAACCTACAAGAAATATGGG + Intergenic
1018353142 6:162983973-162983995 ACAAAACCTCCAATAAATTTGGG - Intronic
1018679860 6:166254806-166254828 ACTAAACCAACCAAAAATGTTGG - Intergenic
1020549796 7:9588980-9589002 ACAAAACCTCCAAGAAATATAGG + Intergenic
1020576365 7:9934589-9934611 TCTAAACCTCTAAGAAATGTAGG - Intergenic
1020716197 7:11676740-11676762 ACAAAGCCTCCAAGAAATGTTGG + Intronic
1020800793 7:12729600-12729622 AATAAAACTGCAACCAATTTTGG + Intergenic
1021099883 7:16575367-16575389 ACTAAACTAGAAACAAGTGTGGG + Intronic
1021224424 7:18011605-18011627 ACAAAGCCTCCAAGAAATGTGGG - Intergenic
1021282570 7:18738930-18738952 ACAAAGCCTGCAAGAAATATGGG - Intronic
1021351020 7:19594657-19594679 ACGAAACCTTCAAGAAATATGGG - Intergenic
1021843198 7:24739678-24739700 ACTAGTGCTGCAATAAATGTAGG - Intronic
1022061743 7:26803668-26803690 AATAATGCTGCAACAAACGTAGG - Intronic
1022961593 7:35431435-35431457 ACAAAGCCTCCAACAAATATGGG + Intergenic
1023572446 7:41586191-41586213 ACTCAACCTGCATCAAGTTTGGG - Intergenic
1023651072 7:42370092-42370114 ACAAGACCTCCAAGAAATGTGGG - Intergenic
1023691865 7:42797594-42797616 ACAAAGCCTCCAAGAAATGTGGG + Intergenic
1023785543 7:43704484-43704506 ACAAAACCTCCAAAAAATATGGG - Intronic
1024099661 7:46016887-46016909 ACAAAACCTTCAAGAAATATGGG + Intergenic
1024385500 7:48747438-48747460 ACAAAACCTACAAGAAATATGGG - Intergenic
1024950369 7:54854686-54854708 ACAAAGCCTCCAAGAAATGTGGG - Intergenic
1027493532 7:78859909-78859931 ACAAAACCTCCAAGAAATATGGG - Intronic
1027656809 7:80940632-80940654 ACTAAACCTACAACAAAGGGAGG - Intergenic
1027929780 7:84517835-84517857 ACAAAACCTCCAAGAAATATGGG + Intergenic
1029041601 7:97581565-97581587 ACAAAACCTCCAAGAAATATAGG + Intergenic
1029785140 7:102782121-102782143 ACAAAACCTCCAAGAAATATGGG + Intronic
1029807483 7:103011820-103011842 ACAAAACCTCCAAGAAATATGGG + Intronic
1029850426 7:103456187-103456209 ACAAAGCCTCCAAGAAATGTGGG - Intergenic
1030422026 7:109319137-109319159 AGTAATGCTGCAATAAATGTGGG - Intergenic
1030438352 7:109553396-109553418 ACAAAACCTCCAAGAAATATGGG + Intergenic
1031033533 7:116762043-116762065 ACTAAACCAGCAACACATAGTGG - Intronic
1031613622 7:123855868-123855890 ACAAAGCCTCCAACAAATATGGG - Intronic
1031891195 7:127294943-127294965 ACAAAACCTCCAAGAAATATGGG + Intergenic
1031905165 7:127452419-127452441 ACAAAACCTCCAAGAAATATGGG + Intergenic
1032764474 7:134977460-134977482 ACAAAACCTCCAAGAAATATGGG + Intergenic
1032776969 7:135123366-135123388 ACAAAGCCTCCAAGAAATGTGGG + Intronic
1033371517 7:140713281-140713303 ACTAAGCCTCCAAGAAATATGGG - Intronic
1034314640 7:150118556-150118578 ACAAAACCTCCAAGAAATATGGG + Intergenic
1034792260 7:153982213-153982235 ACAAAACCTCCAAGAAATATGGG - Intronic
1034847038 7:154455989-154456011 ACTAAACTAGCAACTAATATAGG - Intronic
1035599338 8:888045-888067 ACAAAGCCTCCAAGAAATGTGGG - Intergenic
1037050014 8:14361353-14361375 ACAAAACCTTCAAGAAATATGGG - Intronic
1038873182 8:31518802-31518824 ACAAAGCCTCCAAGAAATGTGGG - Intergenic
1039025242 8:33251712-33251734 ACTAAACCTCCAAGAACTATGGG - Intergenic
1039098374 8:33912343-33912365 ACTAAACATGCAAAAAATGCAGG - Intergenic
1039145324 8:34439991-34440013 ACAAAGCCTCCAACAAATATGGG + Intergenic
1039651915 8:39351105-39351127 ACTAAATCAGGAACAAATGAAGG + Intergenic
1039820648 8:41131250-41131272 ACAAAACCTCCAAGAAATATGGG + Intergenic
1040450689 8:47543205-47543227 ACTAAACATGCAACAACAATAGG - Intronic
1040944266 8:52866384-52866406 AATAAAGCTGCTACAAACGTTGG + Intergenic
1041412508 8:57572266-57572288 ACCCAAACTGCAACAAATGGTGG - Intergenic
1041459584 8:58097212-58097234 ACAAAGCCTCCAACAAATATGGG - Intronic
1041613487 8:59878941-59878963 AATAGTCCTGCAATAAATGTAGG - Intergenic
1041666454 8:60449535-60449557 ACAAAACCTCCAAGAAATATGGG + Intergenic
1041788479 8:61663223-61663245 ACTCAAACTTCATCAAATGTAGG - Intronic
1042348858 8:67755705-67755727 ACAAAACCTCCAAGAAATATGGG - Intergenic
1042634220 8:70855448-70855470 ACAAAGCCTCCAACAAATATGGG + Intergenic
1042731327 8:71938517-71938539 ACAAAACCTCCAAGAAATATGGG - Intronic
1042853380 8:73239507-73239529 ACAAAACCTCCAAGAAATATGGG - Intergenic
1043089069 8:75875048-75875070 ACAAAACCTCCAAGAAATATGGG - Intergenic
1043396637 8:79843761-79843783 ACAAAACCTCCAAGAAATATGGG + Intergenic
1044127476 8:88475669-88475691 ACAAAACCTTCAAGAAATCTGGG + Intergenic
1044169280 8:89028367-89028389 ACAAAACCTCTAACAAATATGGG + Intergenic
1044222001 8:89679836-89679858 ACAAAACCTCCAAGAAATATGGG + Intergenic
1044835316 8:96289616-96289638 AATTAACCTGTACCAAATGTTGG - Intronic
1045934355 8:107662147-107662169 ACAACACCTGAATCAAATGTGGG + Intergenic
1045951019 8:107851780-107851802 GCTACACATGCAATAAATGTTGG + Intergenic
1046301946 8:112306153-112306175 CCTAAAGCTCCAACAAATGGAGG - Exonic
1046812736 8:118549999-118550021 ACAAAACCTCCAAGAAATATGGG + Intronic
1046987002 8:120398972-120398994 ACAAAACCTCCAAGAAATATGGG + Intronic
1047168701 8:122468208-122468230 ACAAAACCTCCAAGAAATATGGG + Intergenic
1048137925 8:131764299-131764321 AAGTAACCTCCAACAAATGTTGG + Intergenic
1050240060 9:3625482-3625504 ACAAAACCTGCAAGAAATATGGG - Intergenic
1050294407 9:4190503-4190525 ACAAAACCTCCAAGAAATATGGG + Intronic
1050509101 9:6375646-6375668 ACAAAACCTCCAAGAAATATGGG + Intergenic
1050637560 9:7627957-7627979 ACAAAGCCTCCAAGAAATGTGGG + Intergenic
1050690032 9:8216551-8216573 AATAATGCTGCAAAAAATGTGGG + Intergenic
1050917526 9:11156946-11156968 AATAAACCTCCAAGAAATATGGG - Intergenic
1051220512 9:14843642-14843664 AGTAAGCCTACAATAAATGTTGG + Intronic
1051716976 9:19995159-19995181 CATAAACTTGCAACAAATATTGG + Intergenic
1051837560 9:21358454-21358476 ATTAGGCCTGCAATAAATGTTGG - Intergenic
1051847153 9:21464798-21464820 ACAAAACCTCCAAGAAATATGGG - Intergenic
1051885822 9:21891597-21891619 ACAAAACCTCCAAGAAATGTGGG + Intronic
1052052563 9:23865276-23865298 ACAAAACCTCCAAGAAATATGGG - Intergenic
1052696697 9:31887828-31887850 ACAAAGCCTGCAAGAAATATGGG - Intergenic
1053041773 9:34879671-34879693 ACAAAACCTCCAAGAAATATGGG + Intergenic
1053487203 9:38468854-38468876 ACAACATCTGCAACAAATCTAGG - Intergenic
1055509654 9:76983733-76983755 ACAAAACCTCCAAGAAATATGGG - Intergenic
1055638919 9:78304268-78304290 GCTAATCCTGCAACCAATGGTGG - Intronic
1055716936 9:79128196-79128218 TCTAAAGCTGCAGAAAATGTGGG + Intergenic
1055983988 9:82036906-82036928 ACCAAACCTGAAGCAACTGTAGG - Intergenic
1055996924 9:82169987-82170009 ACCAAACTTGGAAGAAATGTAGG + Intergenic
1056913163 9:90721625-90721647 AGTAAAACTGCAATAAATGAGGG + Intergenic
1057009039 9:91585296-91585318 ATTAATCATGCAACAGATGTTGG + Intronic
1057253897 9:93527500-93527522 CAAAAACCTACAACAAATGTGGG - Intronic
1057299248 9:93867561-93867583 AATAATGCTGCAATAAATGTGGG + Intergenic
1058072723 9:100618289-100618311 ACAAAGCCTCCAAGAAATGTGGG - Intergenic
1058614448 9:106810637-106810659 ACAAAACCTCCAAGAAATATGGG + Intergenic
1059616907 9:115961496-115961518 ACAAAACCTCCAAGAAATATGGG - Intergenic
1059895283 9:118857066-118857088 ACAAAACCTCCAAGAAATGTGGG + Intergenic
1060326140 9:122617659-122617681 ACAAAGCCTCCAAGAAATGTGGG - Intergenic
1061209598 9:129183114-129183136 ACTGAACCTGCCTCAAAGGTTGG - Intergenic
1203465714 Un_GL000220v1:84161-84183 ACAAAACCTCCAAGAAATATGGG + Intergenic
1186354366 X:8774413-8774435 ACAAAGCCTGCAAGAAATATAGG + Intergenic
1186915765 X:14218566-14218588 AATAGTGCTGCAACAAATGTGGG + Intergenic
1186964292 X:14771302-14771324 ACAAAACCTCCTAGAAATGTGGG - Intergenic
1187115430 X:16345335-16345357 ACAAAACCTCCAAGAAATATGGG - Intergenic
1187646274 X:21350080-21350102 ACAAAACCTTCAAGAAATATGGG + Intergenic
1188679335 X:32982552-32982574 ACTAAAACAGCAACAAATGCTGG + Intronic
1188739410 X:33759786-33759808 ACTAGTGCTGCAATAAATGTGGG + Intergenic
1188792516 X:34421369-34421391 ACAAAACCTCCAAGAAATATGGG + Intergenic
1188828542 X:34867648-34867670 ACAAAACCTCCAAGAAATATGGG + Intergenic
1188978502 X:36704856-36704878 ACAAAACCTCCAAGAAATATGGG - Intergenic
1189598101 X:42591118-42591140 ACAAAGCCTCCAAGAAATGTGGG + Intergenic
1189615811 X:42782307-42782329 CCTATACCTGTAAGAAATGTGGG + Intergenic
1189678458 X:43488146-43488168 ACAAAACCTCCAAGAAATATGGG + Intergenic
1190606151 X:52145134-52145156 AATAATGCTGCAATAAATGTGGG + Intergenic
1190649166 X:52552198-52552220 ACAAAGCCTGCAAGAAATATGGG + Intergenic
1191003668 X:55687775-55687797 ACAAAGCCTCCAACAAATATGGG - Intergenic
1191050059 X:56182131-56182153 ACAAAGCCTCCAACAAATATAGG - Intergenic
1191065140 X:56340315-56340337 ACAAAACCTCCAAGAAATATGGG - Intergenic
1191070259 X:56393408-56393430 ACAAAGCCTGCAAGAAATATGGG - Intergenic
1191084410 X:56548685-56548707 ACTAATCCTCCAAGAAATATGGG + Intergenic
1191094502 X:56660043-56660065 ACAAAACCTCCAAGAAATATGGG - Intergenic
1191138222 X:57089669-57089691 ACAAAACCTCCAAGAAATATGGG - Intergenic
1191597945 X:62968356-62968378 ACAAAACCTCCAAGAAATATTGG + Intergenic
1191606395 X:63067123-63067145 ACAAAGCCTCCAAGAAATGTGGG + Intergenic
1191643613 X:63454394-63454416 ACAAAACCTACAAGAAATATGGG + Intergenic
1191815479 X:65240243-65240265 ACTAAACCTCCAAAAAATATGGG - Intergenic
1191832236 X:65428424-65428446 ACAAAACCTCCAAGAAATATGGG - Intronic
1191998046 X:67117503-67117525 ATTCAAGCAGCAACAAATGTGGG - Intergenic
1192159934 X:68777136-68777158 ACAAAACCTCCAAGAAATATGGG + Intergenic
1192950195 X:76008584-76008606 ACAAAACCTGCAGGAAATATGGG - Intergenic
1192987546 X:76416208-76416230 ACAAAACCTCCAAGAAATATAGG + Intergenic
1192993444 X:76487215-76487237 ACAAAACCTCCAAGAAATATGGG - Intergenic
1193017952 X:76757031-76757053 ACAAAGCCTCCAAGAAATGTGGG + Intergenic
1193035996 X:76951824-76951846 ACAAAGCCTCCAAGAAATGTGGG + Intergenic
1193061366 X:77211564-77211586 ACAAAACCTCCAAGAAGTGTGGG - Intergenic
1193146429 X:78081032-78081054 ACAAAACCTCCAAGAAATATGGG - Intronic
1193156216 X:78176917-78176939 ACAAAGCCTCCAAGAAATGTGGG + Intergenic
1193165753 X:78278245-78278267 ACAAAACCTCCAAGAAATATGGG + Intronic
1193425348 X:81335822-81335844 ACAAAACCTCCAAGAAATATGGG - Intergenic
1193813509 X:86079749-86079771 AATACTGCTGCAACAAATGTGGG - Intergenic
1193893615 X:87082927-87082949 ACAAAACCTCCAAGAAATATGGG + Intergenic
1193960252 X:87915858-87915880 AGTAAACCTCCAAGAAATATGGG + Intergenic
1194058057 X:89162656-89162678 ACAAAGCCTCCAAGAAATGTGGG - Intergenic
1194113739 X:89871207-89871229 ACAAAACCTTCAAGAAATATGGG - Intergenic
1194118843 X:89936486-89936508 ACAAAACCTCCAAGAAATATGGG - Intergenic
1194263854 X:91732457-91732479 ACAAAACCTCCAAGAAATATGGG - Intergenic
1194537031 X:95118355-95118377 ACAAAATCTCCAAGAAATGTAGG - Intergenic
1194629940 X:96270834-96270856 ACAAAGCCTGCAAGAAATATGGG + Intergenic
1194664020 X:96657170-96657192 ACAAAACCTCCAAGAAATATGGG + Intergenic
1194771951 X:97916718-97916740 ACAAAACCTCCAAGAAATATGGG + Intergenic
1194888318 X:99347061-99347083 ACGAAACCTTCAAGAAATATGGG - Intergenic
1194901349 X:99515400-99515422 ACAAAACCTCCAAGAAATATGGG + Intergenic
1195435771 X:104842058-104842080 ACAAAGCCTCCAACAAATATGGG - Intronic
1195469188 X:105213449-105213471 ACAAAGCCTCCAACAAATATGGG + Intronic
1195473365 X:105258600-105258622 ACAAAACATGCAAGAAATATGGG - Intronic
1195729119 X:107948118-107948140 ACAAAGCCTGCAAGAAATATGGG - Intergenic
1195730119 X:107958553-107958575 ACAAAACCTCCAAGAAATATGGG - Intergenic
1196853695 X:119962933-119962955 ACAAAGCCTGCAAGAAATATGGG + Intergenic
1197107502 X:122733204-122733226 ACAAAACCTCCAACAAATATAGG + Intergenic
1197114862 X:122819609-122819631 ACAAAACCTCCAAGAAATATGGG + Intergenic
1197402523 X:126008379-126008401 ACAAAACCTTCAAGAAATATGGG + Intergenic
1197909306 X:131463049-131463071 ACAAAGCCTCCAAGAAATGTGGG + Intergenic
1197913495 X:131511265-131511287 ACGAAACCTCCAAGAAATATGGG - Intergenic
1198042210 X:132864579-132864601 ACAAAACCTCCAAGAAATATGGG + Intronic
1198757080 X:139993678-139993700 ACAAAGCCTCCAAGAAATGTGGG - Intergenic
1198868122 X:141147300-141147322 ACAAAACCTCCAAGAAATATGGG - Intergenic
1199098198 X:143766917-143766939 ACAAAACCTCCAAGAAATATGGG - Intergenic
1199478857 X:148275194-148275216 ACAAAACCTCCAAGAAATATGGG + Intergenic
1200383255 X:155861980-155862002 ACTAAACCTAAAATAAAAGTTGG - Intergenic
1200466417 Y:3526245-3526267 ACAAAACCTTCAAGAAATATGGG - Intergenic
1201070107 Y:10140176-10140198 ACAAAACCTTCAAGAAATATGGG - Intergenic
1201171654 Y:11272670-11272692 ACAAAACCTCCAAGAAATATGGG - Intergenic
1201278201 Y:12317875-12317897 ACTAACTCTGCCACAAATGCAGG - Intergenic
1201302621 Y:12523064-12523086 ACAAAACCTCCAAGAAATATGGG - Intergenic
1201314314 Y:12628742-12628764 ACAAAGCCTCCAACAAATATGGG - Intergenic
1201435437 Y:13953282-13953304 ACAAAACCTACAAGAAATATGGG + Intergenic
1201491025 Y:14541276-14541298 ACAAAGCCTCCAAGAAATGTGGG + Intronic
1201522118 Y:14887202-14887224 ACAAAACCTCCAAGAAATATGGG - Intergenic
1201628730 Y:16044840-16044862 ACTCAACCTTCAACAATAGTGGG - Intergenic
1201702867 Y:16903107-16903129 ACAAAACCTCCAAGAAATATGGG + Intergenic
1201705193 Y:16928862-16928884 AGTAGACCTGCAGCAAATGCCGG + Intergenic
1201787960 Y:17806370-17806392 ACAAAACCTCCAAGAAATATGGG - Intergenic
1201795906 Y:17896079-17896101 ACAAAACCTCCAAGAAATATGGG + Intergenic
1201805649 Y:18009906-18009928 ACAAAACCTCCAAGAAATATGGG - Intergenic
1201813593 Y:18099618-18099640 ACAAAACCTCCAAGAAATATGGG + Intergenic
1202082148 Y:21094276-21094298 ACAAAGCCTGCAAGAAATATGGG + Intergenic
1202094962 Y:21240194-21240216 ACAAAACCTCCAAGAAATATGGG - Intergenic