ID: 957803313

View in Genome Browser
Species Human (GRCh38)
Location 3:85114495-85114517
Sequence GGGCATGTTAATTACTGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 81}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957803313 Original CRISPR GGGCATGTTAATTACTGTTC AGG (reversed) Intronic
901372181 1:8808593-8808615 GGGCAGGTTATTTACCTTTCTGG - Intronic
901711236 1:11117100-11117122 GTGCATGTGAACTACGGTTCTGG + Intronic
919137403 1:193527710-193527732 TGGCATTTTTATTACTATTCTGG + Intergenic
919556831 1:199066523-199066545 TGACTTGTGAATTACTGTTCAGG - Intergenic
921747224 1:218752445-218752467 GGCCATGATAACTCCTGTTCTGG + Intergenic
923748092 1:236721931-236721953 GGGCATGTTAATAACAATTTTGG - Intronic
923896028 1:238271022-238271044 CTACATGTTAATCACTGTTCTGG + Intergenic
1066119650 10:32272841-32272863 GGGCATGTTAATTATTATTAAGG - Intronic
1071099768 10:82021531-82021553 GTGCATTTTGATTGCTGTTCTGG - Intronic
1072879023 10:99205181-99205203 GGGCATGTTACATACTGGTAGGG - Intronic
1073088460 10:100912065-100912087 GGGCATTTTACTCACTTTTCTGG - Intergenic
1080400669 11:31932524-31932546 ATGCTTGTTAATTAGTGTTCAGG + Intronic
1082921957 11:58505220-58505242 GGGCATGTTTATTTCTTTTATGG - Intergenic
1087618964 11:100520738-100520760 GGGTATGTTAACTACTGATGTGG + Intergenic
1087670434 11:101100057-101100079 GGGCATTTTGATTACTGATATGG + Intronic
1088501949 11:110491737-110491759 GGGCCTGTTGATTGCTGTGCTGG + Intergenic
1090803779 11:130190141-130190163 GGGCACGATACTTACTGTCCTGG - Exonic
1093448024 12:19282290-19282312 TGGAATATTAATTACTGTGCTGG + Intronic
1098866481 12:75769605-75769627 GGGAATGTGAATTTCTGATCAGG + Intergenic
1104076767 12:125396807-125396829 GGGCATATTAATGACAGTACTGG - Intronic
1104083453 12:125453915-125453937 TGCCTTGTTAATTACTGTTTGGG + Intronic
1106739529 13:32624864-32624886 GTGCATACTACTTACTGTTCAGG + Intronic
1107651274 13:42547610-42547632 GGCCATGCTAAATACTGTGCAGG - Intergenic
1108220490 13:48228944-48228966 GGCCATTTTAATAAGTGTTCAGG + Intergenic
1109593328 13:64515899-64515921 TGGCATATTGATCACTGTTCAGG + Intergenic
1110960615 13:81619486-81619508 GGACAAGTTACTTACTGATCTGG - Intergenic
1113592831 13:111512845-111512867 GGGCATGTTCATGACCCTTCCGG + Intergenic
1119707157 14:76790167-76790189 AGGCATGTGTATTACTGTTATGG - Intronic
1120387813 14:83867797-83867819 GGCCTTGTTAATTAAGGTTCAGG - Intergenic
1130191704 15:81743147-81743169 TGGTAGGTTAATTCCTGTTCAGG + Intergenic
1137698670 16:50479691-50479713 GTTCATGTTAATTAATGTGCAGG - Intergenic
1152900930 17:82940711-82940733 GGCCATCTTAACTACTGCTCTGG + Intronic
1159409099 18:68047089-68047111 GGGTATCTTAATTACTATTTTGG - Intergenic
927124480 2:20001177-20001199 GGTTATGTAAATTACTGTTTGGG - Intronic
928832979 2:35511181-35511203 GGGGATCTTAAATACAGTTCTGG - Intergenic
930967603 2:57350118-57350140 GGCCATGTTCATTACTACTCGGG - Intergenic
936059124 2:109283119-109283141 GGGCATTTTTATTACCTTTCAGG - Intronic
940097555 2:149994620-149994642 TGGCATTTTCATTACTGTTAGGG - Intergenic
943095611 2:183425350-183425372 AGGCATGTTGTTTACTGTCCAGG + Intergenic
943556135 2:189406063-189406085 GAGAAAATTAATTACTGTTCGGG - Intergenic
943617567 2:190111070-190111092 GGGCAGGTGATTTACTCTTCTGG + Intronic
946876232 2:224132461-224132483 GGCTATGTTCATTACTGTTAGGG - Intergenic
948277348 2:236719286-236719308 GGGCTTGGTGCTTACTGTTCTGG + Intergenic
1170344986 20:15375701-15375723 TTGCATGTTAAGTACTGTGCTGG + Intronic
1170966645 20:21078649-21078671 GGCCATGTTAATTAGAGTTATGG + Intergenic
1175020421 20:55842013-55842035 GGGCATTCTAATAACTCTTCAGG - Intergenic
1175153303 20:56952349-56952371 GGGCAAGTTGATTACTTTTCTGG + Intergenic
1176668387 21:9708830-9708852 GGGAATTTTAATTACTGGTTGGG - Intergenic
1177190671 21:17847824-17847846 GGGCCTGTTTATTACTGGTTTGG - Intergenic
1177578774 21:22993216-22993238 GGGTATGTGAAGTACTGGTCTGG - Intergenic
1181998763 22:26903490-26903512 TGGCAAGTTAATTAGGGTTCAGG + Intergenic
1182338580 22:29601819-29601841 GGAAATGTGAATTACAGTTCCGG - Intergenic
1184639229 22:45860281-45860303 GGGCATGTTTACTACTGTCGTGG - Intergenic
950550182 3:13661571-13661593 GGGCATTTTAATGCCTGTTCTGG + Intergenic
955162015 3:56472715-56472737 GGACATGCTAATGACTGTTCTGG - Intergenic
957803313 3:85114495-85114517 GGGCATGTTAATTACTGTTCAGG - Intronic
962338599 3:134561985-134562007 GGGCTTGTTATTTACTGGGCTGG + Exonic
965432703 3:168609465-168609487 GGAAATTTTAATTTCTGTTCAGG + Intergenic
969218137 4:5739542-5739564 AGGCTTGTTAATCACTCTTCTGG - Intronic
983115240 4:163807361-163807383 GGGTATGTAAATTGCTGTTTTGG + Intronic
983167231 4:164492942-164492964 GGGCAAGTGAAATACTGTTTGGG + Intergenic
985406394 4:189642681-189642703 GGGAATTTTAATTACTGATTGGG + Intergenic
988799296 5:34681425-34681447 GCACATGTTAGTTAGTGTTCTGG + Intronic
994354970 5:98784550-98784572 GGGCATGTAAACCAGTGTTCTGG + Intronic
995473559 5:112526832-112526854 GGCCATGATAACTCCTGTTCTGG - Intergenic
1000697536 5:164406292-164406314 GGGCATGCTGATTACTTTTTCGG - Intergenic
1007189382 6:40000350-40000372 AGGGATGTTAATTCCTTTTCGGG - Intergenic
1019177631 6:170168317-170168339 GGGGTTGTTACTTTCTGTTCGGG + Intergenic
1022210194 7:28201110-28201132 GGGCACGATAATTATTTTTCTGG + Intergenic
1023696011 7:42847339-42847361 GGGCATGTAACTTTCTTTTCTGG - Intergenic
1030662557 7:112237664-112237686 GGAGATTTTTATTACTGTTCTGG - Intronic
1034782513 7:153893830-153893852 GGAAATGTTACTTACTGTTTTGG + Intronic
1038040083 8:23716978-23717000 GGGCATGTGAGTTACTGTGCAGG + Intergenic
1039363845 8:36909732-36909754 GGTCAAGTTACTTACTCTTCCGG - Intronic
1040001622 8:42581841-42581863 TGGCATGCTAATTAATATTCAGG - Intergenic
1041493434 8:58460477-58460499 GGGCATTTTAAATGCTGTCCAGG - Intergenic
1042879942 8:73476198-73476220 GGGCCTGATAAATTCTGTTCTGG - Intronic
1047335643 8:123933237-123933259 GGACATGTTACTTTCTGCTCTGG - Intronic
1047952617 8:129947568-129947590 GGGCACCTTATTTACTGCTCGGG - Intronic
1051381645 9:16465055-16465077 GGGCCTGTTGACTACTCTTCTGG - Intronic
1051911885 9:22162292-22162314 GGGCAAGTTAGCTACTGTTGGGG + Intergenic
1053726889 9:41013062-41013084 GTGCATGTTATTTATTATTCAGG + Intergenic
1055108140 9:72533566-72533588 TGTCATGTGAGTTACTGTTCTGG + Intronic
1060187930 9:121575193-121575215 GGGGGTGTTAAGTACAGTTCAGG - Intronic
1062725774 9:138072694-138072716 GGGCACTTGAATTACTGTACTGG - Intronic
1203657480 Un_KI270753v1:12125-12147 GGGAATTTTAATTACTGGTTGGG + Intergenic
1188642327 X:32521732-32521754 GGTGATGCTAATTACTGATCTGG - Intronic