ID: 957803883

View in Genome Browser
Species Human (GRCh38)
Location 3:85121332-85121354
Sequence TTGCTGTCTGTGGGAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 225}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957803883 Original CRISPR TTGCTGTCTGTGGGAAAAAC AGG Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
902463960 1:16603148-16603170 CTGCTGTCAGTGAGAACAACAGG - Intronic
904075725 1:27840692-27840714 TTGTTATCTGGGGGAACAACAGG + Intronic
904076220 1:27844652-27844674 TTGCTGGCTGTTGTACAAACAGG - Intronic
905341723 1:37282707-37282729 TTCCTTTCTGTGGGAGCAACTGG + Intergenic
906093721 1:43205361-43205383 GTTCTGTCTGTGGGAAAGTCAGG - Intronic
906776343 1:48533192-48533214 TTCCTGTCTGTGGAAACAGCAGG - Exonic
908514113 1:64874899-64874921 TTCCTGTCTCTGGGAGCAACCGG + Intronic
908681894 1:66671326-66671348 TTGCTGGGGGTGGGAAGAACAGG + Intronic
909017980 1:70400128-70400150 TGGCTGCCTTTGGGAAAAAGGGG + Intergenic
909131754 1:71745815-71745837 TGGTTGGCTTTGGGAAAAACAGG - Intronic
910390970 1:86743752-86743774 TTGATTTCTGTTGGAAAACCAGG - Intronic
910698587 1:90048321-90048343 TTGCTGCCTGGGGGAGAGACAGG + Intergenic
911705797 1:101011355-101011377 TGGCTATTTGTGTGAAAAACAGG - Intronic
911789951 1:102001639-102001661 TTTCTGTCTGTGTTAAAAACTGG + Intergenic
912627984 1:111222029-111222051 CTGCTGTGTGTGGGGGAAACTGG + Intronic
915211569 1:154313396-154313418 CTGATGTCTGGGGGAAAAGCAGG - Intergenic
916746605 1:167689642-167689664 TTGTTGTGTGTGTGACAAACAGG + Intronic
917186103 1:172357889-172357911 TTGATGTCTGTGGACAGAACTGG - Intronic
918479382 1:184961403-184961425 TTGCTATCTGTGTGAAGAACCGG - Intronic
922390596 1:225137838-225137860 TGGCTGGCTGTGGAAAATACAGG - Intronic
922695672 1:227729713-227729735 TTGCTGGCTGTGGCAAAACCAGG - Intronic
923761741 1:236852467-236852489 TTGCTGTTTTTGGCAAAAAAGGG + Intronic
924201962 1:241669596-241669618 TTCCCTTCTGTGGGAAAATCAGG - Intronic
1064284671 10:13982104-13982126 TGGCTGGCTTTGGGAAAAAAGGG - Intronic
1065829391 10:29600540-29600562 GTGCTGTCAGTGGCAAAATCAGG + Intronic
1066082698 10:31947800-31947822 TTGCCATCTGGTGGAAAAACAGG + Intergenic
1070730932 10:78827894-78827916 TTTTTCTCTGTTGGAAAAACTGG - Intergenic
1070951741 10:80436722-80436744 TGGCTGGCTTTGGGTAAAACCGG - Exonic
1073161951 10:101405702-101405724 TTGCCTTCAGTGGGAAATACAGG + Intronic
1073675961 10:105647418-105647440 TGGCTGGCTTTGGGGAAAACAGG - Intergenic
1074482548 10:113838434-113838456 TTGCTTTTTGTGGGACAAATTGG + Intronic
1074559858 10:114525716-114525738 AGGCTGTCTGAGAGAAAAACAGG + Intronic
1077515181 11:2997228-2997250 TTCCTGTCTGCAGGAAATACTGG - Intergenic
1079240753 11:18720870-18720892 CTTCTGTCTGTGGGGAAAAAAGG + Intronic
1079369077 11:19834707-19834729 TTGCTGCCTGTGCTAAAACCTGG - Intronic
1080041010 11:27759468-27759490 TGGGTGTCTGGGGGAAAAAAAGG + Intergenic
1081353381 11:42083191-42083213 TTTTTGTCTGTGGAAAAAATAGG + Intergenic
1083988363 11:66231714-66231736 CTGCTGTCTGAGGGAACAAAAGG - Intronic
1084440688 11:69171076-69171098 CTGCACTTTGTGGGAAAAACAGG + Intergenic
1084700302 11:70782477-70782499 CTGCTGTCTGTGGGAGGCACTGG + Intronic
1085629704 11:78104430-78104452 CTTTTGTCTGTGGGAAAAGCAGG - Exonic
1087020300 11:93595916-93595938 TGGCTGGCTGTGAGAAAAAGAGG - Intergenic
1087647259 11:100822742-100822764 TTCCACTCTGTGGGAAAAAAGGG - Intronic
1088784730 11:113170997-113171019 TTGCTTTCTGTGGGAAGTGCAGG + Intronic
1090266205 11:125354444-125354466 TTGTTGCCTGTGGAAGAAACTGG - Intronic
1091103655 11:132898626-132898648 ATCCTGACTATGGGAAAAACAGG - Intronic
1095197162 12:39333616-39333638 TTGCTGTTTGAGGTACAAACAGG + Intronic
1098199598 12:68040691-68040713 GTCCTGTCTGATGGAAAAACGGG + Intergenic
1098556816 12:71828182-71828204 ATGCTATCACTGGGAAAAACTGG - Intergenic
1099290181 12:80767198-80767220 ATCCTGTCTGTAGGAACAACGGG - Intergenic
1100307948 12:93368456-93368478 TTGCTATCTTTTGGGAAAACAGG - Intergenic
1103211495 12:119170389-119170411 TTCCAGTCTGTGGGAACAGCAGG + Intergenic
1104340329 12:127943258-127943280 ATCCTGTCTGTAGGAACAACAGG + Intergenic
1104880319 12:132066437-132066459 AAGCCTTCTGTGGGAAAAACGGG + Intronic
1105190315 13:17891095-17891117 TTGATGTCTTTGGGGAAAAAGGG + Intergenic
1106449845 13:29870485-29870507 TTGCTGTGTGTGGGAGAAAATGG + Intergenic
1106987966 13:35378091-35378113 TTACTGTCTTGGGGAGAAACAGG + Intronic
1107284662 13:38777812-38777834 ATGTAGGCTGTGGGAAAAACTGG - Intronic
1107457025 13:40564458-40564480 CCGCTGGCTGTGTGAAAAACAGG - Intronic
1107682717 13:42867815-42867837 GTGCTGTCAGTGGAAAACACCGG + Intergenic
1107912132 13:45115177-45115199 TTGGTGTCTGTGGGAGAGAGAGG - Intergenic
1110623905 13:77630041-77630063 TGGCTGGCTTTGGGGAAAACAGG + Intronic
1111438001 13:88237573-88237595 TTGCTGTCTGTGATAAATAGTGG - Intergenic
1111782746 13:92750035-92750057 TTTCTGTCTGTGGGTAGAACTGG - Intronic
1112207372 13:97338028-97338050 TTGTTGTCTGTGGGATATAATGG - Intronic
1114228021 14:20756330-20756352 ATGCTGTCTGTGTGAAAACAAGG + Intergenic
1115250287 14:31338717-31338739 TTGGCATATGTGGGAAAAACAGG + Intronic
1115314668 14:32013410-32013432 ATCCTGTCTGTGGGAACAATGGG + Intronic
1117610149 14:57474817-57474839 CAGCTGTCAGTGGGAAAAATAGG + Intronic
1118729557 14:68656745-68656767 TTGCTGTGTCTGTGAAAAATTGG - Intronic
1120319461 14:82941101-82941123 TTTCATTTTGTGGGAAAAACAGG - Intergenic
1122699984 14:103581877-103581899 TTTCTGTCTGTGGGAATAAAGGG + Intronic
1122836162 14:104432110-104432132 CTGCTGTCTGTGGGAGGAGCCGG + Intergenic
1122836175 14:104432163-104432185 CTGCTGTCTGTGGGAGGAGCCGG + Intergenic
1122936823 14:104962746-104962768 TTGCTTTCTGTTGGAATAACTGG - Intronic
1123800184 15:23811083-23811105 TTGCTGTCTGTGATGAAAACTGG + Intergenic
1126257165 15:46641617-46641639 GTGCTGGCTGTGGGACAATCAGG - Intergenic
1127833896 15:62774410-62774432 TTGCTGTCGGTGGTTTAAACAGG + Intronic
1128712627 15:69883781-69883803 TTGCAGGTTGTGGAAAAAACGGG + Intergenic
1131008430 15:88997539-88997561 TGGCTGGCTGTGGGGAAAAGGGG - Intergenic
1131272045 15:90953443-90953465 GTGTGGTCTGTGAGAAAAACAGG - Exonic
1131821105 15:96274525-96274547 ATGCTGTCTTTGGGGAAAGCCGG + Intergenic
1135412690 16:22247113-22247135 TGGCTGGCTTTGGGAAAAAGGGG - Intronic
1136142062 16:28294012-28294034 TTGCTGTCCCTGGGACAAATGGG - Intronic
1137244705 16:46693101-46693123 TTGCTGTGTCTGGGGAAGACTGG - Exonic
1138402987 16:56763684-56763706 TTGGAGGCTGTGGGGAAAACAGG - Intronic
1138621109 16:58211974-58211996 TTGGTGTCTGTGCGCAAAATTGG + Intergenic
1138684975 16:58717198-58717220 ATGCTGTCTCTGTGAAAAATAGG + Intronic
1138787439 16:59864178-59864200 ATCCTGTCTGTGGGAACAATGGG - Intergenic
1140747653 16:77995302-77995324 TTGTTGTCTGGGGTAAAAACCGG + Intergenic
1142609720 17:1102142-1102164 GTCCTGGCTGTGGGAAAGACTGG - Intronic
1142780963 17:2180826-2180848 TTCCTCTTTGTAGGAAAAACAGG + Intronic
1144439222 17:15266350-15266372 ATGCTGGCTGTGGGCAGAACAGG - Intergenic
1147389112 17:40098679-40098701 TTCCTTTCTGTGAGAAAAAAAGG + Intronic
1147671425 17:42179020-42179042 TTGCTGTCTGTGGGAAGAAGAGG + Exonic
1150776447 17:68085518-68085540 GTGTTGTCGGTGGGAAAAAATGG - Intergenic
1151172944 17:72263351-72263373 TAGGTATCAGTGGGAAAAACAGG + Intergenic
1151840914 17:76616760-76616782 TTGCTCTCTGTGGTAGAAAGGGG + Intergenic
1152068292 17:78123243-78123265 TTGCTGTCTCTGGGAGAAGATGG - Intronic
1152613238 17:81325868-81325890 TTTCTGGCGGTGGGAAAAAGTGG + Intronic
1152677913 17:81651144-81651166 GTGATGTCTGTGGGAGAAACGGG + Exonic
1153196438 18:2603081-2603103 TTGCTGTCTGTAGGATATCCAGG + Intronic
1153412264 18:4807095-4807117 TTGTTGTATGGGGGAAAAACAGG + Intergenic
1153443999 18:5152219-5152241 ATCCTGTCTGTAGGAACAACAGG - Intronic
1154505547 18:15037174-15037196 ATGCTGGCTGTAGGAGAAACAGG - Intergenic
1155000715 18:21683538-21683560 TTCCTGACTCTGGGAAGAACTGG - Intronic
1156001650 18:32391557-32391579 TTTCTGTCTTTGTGGAAAACTGG - Intronic
1157922543 18:51728081-51728103 TTGCTTTCTGTGGCAGAGACAGG - Intergenic
1158705896 18:59791514-59791536 TTGCTGTCTTTGTGATAAATAGG + Intergenic
1160054341 18:75465133-75465155 CTGCTGTCTGAGGGAAAATGGGG - Intergenic
1160537894 18:79604689-79604711 CTGCTGTCTGTTGCAGAAACTGG - Intergenic
1160585418 18:79911124-79911146 TTGCTGTCTGGAGGGAAATCGGG + Intronic
1162880372 19:13654434-13654456 TGGCTGGCTTTGGGAAAAAAGGG - Intergenic
1163190547 19:15673673-15673695 TTGGGGGCTGTGGGAAACACTGG - Exonic
1163939600 19:20479659-20479681 TTGCTGACTGCTGGAAAAATGGG - Intergenic
1165729681 19:38136905-38136927 CTTCTGTTTGTGGGAAAAGCAGG + Intronic
1202679618 1_KI270711v1_random:40588-40610 CTGCTGTCAGTGAGAACAACAGG - Intergenic
925292601 2:2757605-2757627 TTCCTCTCTGTGGACAAAACAGG + Intergenic
928994969 2:37279386-37279408 AAGCTGCCTGTGTGAAAAACAGG + Intronic
929552617 2:42904038-42904060 TTGCTGTCTGTGAACAAAGCAGG + Intergenic
932358037 2:71082718-71082740 TTCCTGTTTCTGGGCAAAACTGG - Intergenic
932689092 2:73897235-73897257 TTTCTGTGTGTGGGAAACACCGG + Exonic
934677634 2:96260908-96260930 TTGGTGTCTGTGGGATAACCTGG - Intronic
935580842 2:104754901-104754923 TTGCTCTCTGCGGGAGAACCTGG + Intergenic
939663993 2:144927347-144927369 TCTCTGTCTGTGGAAAAAATTGG + Intergenic
942545702 2:177061469-177061491 TTGATGTCTGAGGGACAATCTGG - Intergenic
944575536 2:201087813-201087835 TTTGTGTTTGTGGTAAAAACTGG + Intergenic
944626490 2:201574784-201574806 TTGCTGCCAGTGGCCAAAACAGG - Intronic
946076117 2:217075125-217075147 TGGGTGTGTGTGGGAAACACTGG - Intergenic
947342458 2:229154327-229154349 TTGGTGTGTTTGGGAACAACAGG - Intronic
947470591 2:230397909-230397931 CAGATGTCTGTGGGAAAAAGAGG + Intronic
947937043 2:234016054-234016076 GTGCTGACTGTGAGTAAAACGGG + Intronic
948973440 2:241447578-241447600 TGGCTGACTGTGGAAAAAACAGG - Intronic
1171218595 20:23372889-23372911 TTGCTGTCGTTTGGAAAAAATGG + Exonic
1172116457 20:32576202-32576224 TGGCTGTTTGTGGGAAGAAGGGG + Intronic
1173878511 20:46392660-46392682 ATGCTGTGTTTGGGAAAAGCAGG - Intronic
1174711102 20:52706235-52706257 TGGCTGCCTGAGGGAGAAACAGG + Intergenic
1174845387 20:53938325-53938347 TTCATGTCTGTGGGAGAGACAGG - Intronic
1175578145 20:60078208-60078230 TTGCTGACTGTGGAGGAAACTGG - Intergenic
1176792313 21:13331944-13331966 ATGCTGGCTGTAGGAGAAACAGG + Intergenic
1177438229 21:21083805-21083827 ATGCTGTCATTGGGAGAAACTGG - Intronic
1177991710 21:28042810-28042832 ATGCTGGCTGTAGGAGAAACAGG + Intergenic
1180071763 21:45440337-45440359 TTGCTGTCTGTGAGGAAAGCGGG + Intronic
1181181040 22:21068708-21068730 TTTCTGTCTGAGGCAAACACAGG - Intergenic
1182735173 22:32528297-32528319 TTACTTTCTGTGGGGAAATCTGG + Intronic
1183719315 22:39553112-39553134 GTGCTGACTGTGGGTAAAACAGG - Intergenic
1185353986 22:50355198-50355220 TTGCTGTATGTGGATATAACAGG - Intronic
949216332 3:1573322-1573344 TTGGTATCTGTGGGAAATCCTGG - Intergenic
950222082 3:11204274-11204296 TTACTGTCTGTGGGAGAGAGAGG + Intronic
950267668 3:11586977-11586999 TTGTTGTCTGTGTGAGAAGCAGG - Intronic
951659292 3:25044852-25044874 CTGCTGTCTGGGGGAAAGAATGG - Intergenic
952545148 3:34411062-34411084 TTACTCTCTGTGGTGAAAACTGG - Intergenic
953694666 3:45147923-45147945 TTACTGTATGTGGGAAACAATGG - Intergenic
955800720 3:62683516-62683538 TTGCTGGGTGTGGGATAGACAGG - Intronic
956247327 3:67198373-67198395 TTGCTGCCTGTGTCAAACACTGG - Intergenic
957803883 3:85121332-85121354 TTGCTGTCTGTGGGAAAAACAGG + Intronic
957878135 3:86175443-86175465 CTGCTGTCTGTAGGATAAAATGG - Intergenic
959575701 3:107930970-107930992 ATGCTGTGAGTGGGTAAAACAGG + Intergenic
961567980 3:127777042-127777064 TTGCTTTCTCTGGGGAAGACGGG + Intronic
964621010 3:158720144-158720166 GTGCGGTATTTGGGAAAAACGGG - Intronic
965014754 3:163142643-163142665 ATGCTGTTTCTGGGAAAAAAAGG - Intergenic
966044140 3:175529486-175529508 ATCCTGGCTGTGGGAGAAACAGG + Intronic
966462771 3:180196045-180196067 TTGTTGTCTGTGAGTAAAGCAGG + Intergenic
968054406 3:195680526-195680548 TTGCTTCCTGTGGGACACACAGG - Intergenic
968101485 3:195968632-195968654 TTGCTTCCTGTGGGACACACAGG + Intergenic
968404487 4:327980-328002 TTGCTGTCAGTTGGAGAAAAGGG - Intergenic
969318563 4:6396492-6396514 TTGGTGTCTCCAGGAAAAACTGG - Intronic
970453237 4:16193430-16193452 TTTCTCTCTGTGGGAGAAAGAGG - Intronic
970866483 4:20764825-20764847 ACCCTGTCTGTGTGAAAAACAGG - Intronic
971607513 4:28676897-28676919 TTGCTGGCTTTGGGGAAAAGAGG + Intergenic
972113861 4:35602846-35602868 TTGCTGTCAGTGCCAAGAACTGG + Intergenic
972746763 4:41941038-41941060 TTTCTGTATGTGGGTAAACCTGG + Intronic
974219086 4:58942506-58942528 TTTCTTTCTGTGGCAATAACTGG + Intergenic
975585261 4:75941971-75941993 CAGTTGTCTGTGGGTAAAACAGG + Intronic
976671057 4:87654240-87654262 TTGCTGGCTTTGGGGAAAAGAGG + Intronic
977867546 4:102047803-102047825 TTGCTCTCTGTGGGACAGCCAGG - Intronic
978192510 4:105931145-105931167 TTTCTGGCTGGGGGAAAAAGAGG - Intronic
978725917 4:111969136-111969158 TGGTTGTCTGTGGGATGAACTGG + Intergenic
979509755 4:121538902-121538924 TGGGTTTCTGTTGGAAAAACAGG - Intergenic
981583996 4:146280723-146280745 TTGCTGTATGGGGGAAATAGCGG + Intronic
981945510 4:150338628-150338650 TGGCTGTCTGTGAGTAAGACTGG - Intronic
981949201 4:150385729-150385751 CTGGTGTCTGTGGAAAAAAGAGG + Intronic
985650047 5:1103212-1103234 CTGCCTTCTGAGGGAAAAACAGG + Intronic
985735409 5:1577310-1577332 TTGCTTCCTGTGGGACAGACAGG + Intergenic
987107533 5:14655164-14655186 TTGCTGTTTGTGAAAAACACAGG - Intergenic
987548453 5:19345695-19345717 TTGCTTTCTGGGAGAAACACAGG - Intergenic
988722894 5:33896172-33896194 TTCCTGTCTATGGGAAAAAATGG - Intergenic
994035691 5:95197801-95197823 TTGGTATCTGTGGGAGGAACTGG - Intronic
996912710 5:128673687-128673709 TTCATGTCTGTGGGCATAACTGG - Intronic
997957653 5:138292427-138292449 TTGCTTTCTGTTAGAAGAACTGG - Intronic
999032875 5:148314054-148314076 TTGGGGTCTGGGAGAAAAACAGG + Intronic
1001137760 5:169116708-169116730 TTGAGGTCTGAGGGAGAAACAGG + Intronic
1002086975 5:176782001-176782023 TTCCTGTCAGAGGTAAAAACAGG - Intergenic
1003774243 6:9341441-9341463 TTGCTGTCTGTGAGAAAAAAAGG + Intergenic
1003947526 6:11089209-11089231 TTGGTGCCTTTAGGAAAAACTGG - Intergenic
1004561210 6:16752741-16752763 TTACTGTACGTGGGAAAATCAGG + Intronic
1004811260 6:19266289-19266311 TTGTAGACTGTTGGAAAAACTGG + Intergenic
1007718281 6:43869920-43869942 CAGCTGGCTCTGGGAAAAACTGG + Intergenic
1008219367 6:48837128-48837150 TTTCTGTTTGTGGGGAATACAGG + Intergenic
1012036278 6:94144797-94144819 TTTCTTTGTGTGTGAAAAACTGG + Intergenic
1016319167 6:142823175-142823197 CTGCTGTCTGTGGGGGCAACTGG - Intronic
1016764654 6:147778474-147778496 GTGCAGTCTGTGGGAGAACCAGG - Intergenic
1017959262 6:159207512-159207534 TGGATGTCTGTGAGAAAAAGAGG + Intronic
1018000966 6:159578103-159578125 TGGCTGTAAGTGGGAAAGACAGG - Intergenic
1022581257 7:31557325-31557347 ATGCTTTCTGTGGGAAGCACTGG - Intronic
1023032077 7:36098644-36098666 TTGCATTTTGTGGGAGAAACAGG - Intergenic
1023062822 7:36344836-36344858 TTGATATCTGTGGGCAAATCTGG - Intronic
1023563682 7:41502025-41502047 TTGCTCTCTATGGGATATACAGG - Intergenic
1026310616 7:69180675-69180697 TTGCTCTTTGTGGGAAAAAATGG + Intergenic
1026647751 7:72187160-72187182 CTGTTTTTTGTGGGAAAAACAGG + Intronic
1028510012 7:91614174-91614196 TTGCCTTCTTTGGGAAAAAAGGG - Intergenic
1030026304 7:105327970-105327992 TTTCTATCTGTAGTAAAAACGGG + Intronic
1031176550 7:118359611-118359633 TGGCTGGCTTTGGGAAAAAGGGG + Intergenic
1033732525 7:144194108-144194130 GTGGTGTCTGTGGGATAGACAGG - Intronic
1033743375 7:144292688-144292710 GTGGTGTCTGTGGGATAGACAGG - Intergenic
1033750526 7:144356909-144356931 GTGGTGTCTGTGGGATAGACAGG + Intronic
1034018894 7:147618976-147618998 TTCCTGTCTCTGGCAATAACGGG - Intronic
1034224141 7:149469919-149469941 CAGGGGTCTGTGGGAAAAACAGG + Intergenic
1035010282 7:155709698-155709720 GTGCTGTCTGTGGGATACAATGG + Intronic
1036740891 8:11360801-11360823 TTGCTGTAAGTGGGGAAAATTGG + Intergenic
1037374191 8:18210640-18210662 TTGCTGCCTGTAGGATTAACTGG - Intronic
1038179763 8:25215189-25215211 TTTGTGTCTGTTTGAAAAACAGG + Intronic
1038190728 8:25317963-25317985 TTATTGTCTCTGGGAAACACAGG + Intronic
1039450314 8:37668525-37668547 TTGGTGTCTGTGGGAAGTCCTGG - Intergenic
1042206877 8:66338431-66338453 TTTCTGACAGTGGGAAGAACAGG - Intergenic
1044603901 8:94032576-94032598 AGGCGTTCTGTGGGAAAAACAGG - Intergenic
1046414812 8:113898848-113898870 TTGCTGCCTGTGTGGAGAACTGG - Intergenic
1047108967 8:121767361-121767383 TTTCTGACTATGAGAAAAACAGG + Intergenic
1047227582 8:122969971-122969993 TTTCTGTCTTGGGGAAAACCTGG - Intronic
1048458443 8:134599683-134599705 TTGCTGTCTGTAGCATAAAAAGG + Intronic
1051406250 9:16740862-16740884 TTGGTTTCTGAGGGAAAAAAAGG - Intronic
1052095436 9:24378605-24378627 TTTCTGTCTGTGGGGCACACAGG - Intergenic
1054790086 9:69248383-69248405 TTGCAGTCTGTGGGAAAGTGGGG + Intronic
1055719049 9:79150916-79150938 TTGCTATCTTTGGGAGAAAGGGG + Intergenic
1056901990 9:90608486-90608508 GTCCTGTCTATGGGAACAACAGG - Intergenic
1057366577 9:94427694-94427716 TTTCTTTCAGTGGGAAATACAGG - Intronic
1057656757 9:96960370-96960392 TTTCTTTCAGTGGGAAATACAGG + Intronic
1190533776 X:51406990-51407012 TTGCTCTCTGGGGGAGAACCTGG + Exonic
1192292869 X:69815756-69815778 TTGCTGGCTGTGGAGAATACAGG + Intronic
1192321006 X:70090830-70090852 GAGTTGTCTGTGGGTAAAACAGG + Intergenic
1198526693 X:137508596-137508618 TTGCAGTGGGGGGGAAAAACAGG + Intergenic
1199453946 X:148006703-148006725 TTGCAATCTGAGGGAAAATCAGG + Exonic
1200114376 X:153763716-153763738 TTCCAGTCGGTGGGAAACACTGG + Intergenic
1200853305 Y:7909317-7909339 TTTCTCTCTGTGAGAACAACAGG - Intergenic
1201243224 Y:11978803-11978825 TTGCTGTCTGGGTGATAAAGTGG + Intergenic