ID: 957803968

View in Genome Browser
Species Human (GRCh38)
Location 3:85122723-85122745
Sequence CGGCAAGGATTGAGGAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 218}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957803968_957803976 16 Left 957803968 3:85122723-85122745 CCTCTTTTCCTCAATCCTTGCCG 0: 1
1: 0
2: 1
3: 14
4: 218
Right 957803976 3:85122762-85122784 TAGTATCACCTAGACCCTCAAGG 0: 1
1: 0
2: 0
3: 5
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957803968 Original CRISPR CGGCAAGGATTGAGGAAAAG AGG (reversed) Intronic
901582478 1:10256360-10256382 CGGCAAGGAAAGAGGAAAGGAGG - Intronic
902118557 1:14142087-14142109 AGGGAAGGAGGGAGGAAAAGAGG - Intergenic
902583850 1:17426138-17426160 CGGCAGGGAGTGAGGAGGAGGGG - Intronic
902801673 1:18834076-18834098 GGGCAAGGATAGAGGCAGAGAGG + Intergenic
904010387 1:27386366-27386388 CAGCTAGGATAGAGGAAGAGAGG - Intergenic
904848649 1:33440325-33440347 ACCCAAGGATTGAGGAAACGGGG - Intergenic
905718289 1:40172958-40172980 TGGCAAGGATTTAGTAAAACGGG - Intronic
905780369 1:40703593-40703615 TAGCAGGGATTGAGGAAAACTGG - Intronic
911401133 1:97376938-97376960 CAGCTAGGATGGAGTAAAAGTGG - Intronic
921342226 1:214145622-214145644 CTGCATGGATAGAGGCAAAGGGG - Intergenic
921568952 1:216755615-216755637 CAGCAAGGATTGAGTTAAAAAGG - Intronic
921884581 1:220292601-220292623 TGGCAAGGATGTGGGAAAAGTGG - Intergenic
1063665688 10:8058884-8058906 GGCCCTGGATTGAGGAAAAGGGG - Intronic
1064008117 10:11714137-11714159 CGGCAGGGATTGAAGCATAGAGG - Intergenic
1064279716 10:13940659-13940681 CTGAAAGGATTGAGGAATTGAGG + Intronic
1066197797 10:33117979-33118001 CGGAAAGGGTGGAGGAAAACAGG + Intergenic
1067151974 10:43743331-43743353 CGGGGAGAATTGAGGAAAAGAGG - Intergenic
1068289451 10:54983977-54983999 TTCCAAGGATTGAGGAAATGAGG + Intronic
1069062247 10:63906355-63906377 GGGGAAGAATTGTGGAAAAGAGG + Intergenic
1069603424 10:69724489-69724511 GGGCAAGGAGTGAGGAAGAGAGG - Intergenic
1069645966 10:69997893-69997915 TGGCAAGGACTCAGGAAAACGGG + Intergenic
1072847513 10:98848452-98848474 CAGCAAGGTTAGAGAAAAAGAGG + Intronic
1073029324 10:100512604-100512626 CATCAAAGATTGAGGATAAGGGG + Intronic
1074901491 10:117819730-117819752 CTGCAAGGAGTGGGGACAAGTGG + Intergenic
1077769566 11:5200565-5200587 TGGCATAGATTGAGGAGAAGGGG + Exonic
1079454274 11:20623585-20623607 CGGCAGGGACTCAGGAAGAGGGG - Intronic
1082763648 11:57149448-57149470 AGGGAGGGATGGAGGAAAAGAGG + Intergenic
1085449329 11:76622618-76622640 AGGCAAGGATGGAGGGACAGTGG - Intergenic
1086537434 11:87865107-87865129 AGGGAAGGATGGAGGAAATGGGG + Intergenic
1087977529 11:104568054-104568076 TGGCAAGGATTGAAGATAATTGG - Intergenic
1089137685 11:116262871-116262893 AGGCAAGGAGTGAGGAAATCAGG + Intergenic
1090835533 11:130450703-130450725 CAGCAAGGATACAGGAAAATTGG - Intronic
1093001488 12:14001692-14001714 GGGCATGGATTGAGGAGCAGAGG - Intergenic
1093441348 12:19200546-19200568 CTACTAGGAATGAGGAAAAGAGG - Intronic
1093940161 12:25044336-25044358 AGGCAAGCAGAGAGGAAAAGAGG + Intronic
1096361213 12:50989055-50989077 TGGGGAGGACTGAGGAAAAGTGG - Intronic
1096994662 12:55831057-55831079 CTGCCAGGATTGAGGAGAGGAGG - Intergenic
1099042802 12:77676798-77676820 AGGCATGGATTGAGGAGAAAAGG + Intergenic
1100021903 12:90079074-90079096 GGACTAGGATTGAGGAAAATGGG + Intergenic
1100194420 12:92228050-92228072 GGGAAAGGAATGAGGAAAAGAGG + Intergenic
1100418385 12:94403050-94403072 CTGCAATGACTGAGTAAAAGGGG + Intronic
1100598735 12:96093913-96093935 TGGCAAGGAGTGAGGTACAGAGG + Intergenic
1100750178 12:97690314-97690336 AGGCAGGGAGAGAGGAAAAGGGG + Intergenic
1101531743 12:105579961-105579983 AGGGAAGGATGGAGGAAGAGAGG + Intergenic
1105274013 13:18904363-18904385 GGGGCAGGAATGAGGAAAAGAGG - Intergenic
1106592911 13:31112373-31112395 TGGCAAGGATGCAGGAAAAAAGG + Intergenic
1107003988 13:35585963-35585985 AGGCAAGAATAAAGGAAAAGAGG - Intronic
1108315378 13:49231817-49231839 CAGGAAAGAATGAGGAAAAGTGG + Intergenic
1108698814 13:52926439-52926461 AGGGAAGGATGGAGGAAACGAGG - Intergenic
1110146313 13:72194894-72194916 CTGCAAGGTTTGAGGAAGACGGG + Intergenic
1110418614 13:75279358-75279380 CTGCAGGGATTGGGGAAAAGGGG + Intergenic
1112665785 13:101571586-101571608 GTGCAAGGTTTGAGGAAGAGAGG - Intronic
1113053738 13:106243661-106243683 TGGGAAGGGTGGAGGAAAAGAGG + Intergenic
1113703878 13:112412086-112412108 TGGCAAGGATGGGGAAAAAGGGG - Intronic
1113955253 13:114096942-114096964 CGGGAAGGATTGAGACACAGAGG - Intronic
1117397943 14:55329804-55329826 TGGCACGGAATTAGGAAAAGAGG - Intronic
1126630885 15:50734000-50734022 TGGCAAGGATGTGGGAAAAGGGG + Intronic
1126715921 15:51517526-51517548 GGGCAAGGGTTGAGAAGAAGTGG + Intronic
1127717773 15:61666567-61666589 TGGCAAGGAGTCAGGAAATGAGG - Intergenic
1128454914 15:67826999-67827021 CCGTAAGGATGGGGGAAAAGTGG - Exonic
1128675091 15:69602681-69602703 GGGTGAGGATGGAGGAAAAGGGG - Intergenic
1128755617 15:70181738-70181760 AGGGAAGGACTGAAGAAAAGAGG - Intergenic
1129619288 15:77129144-77129166 TGGCAAGGAGTGAGGGAGAGAGG - Intronic
1129665054 15:77575016-77575038 CTACAAGGATTGAGGGAAGGGGG + Intergenic
1131306867 15:91252723-91252745 AGGGAAGGAAGGAGGAAAAGAGG - Intronic
1133229702 16:4360725-4360747 GGGCTAGCATTGAGGAGAAGGGG - Intronic
1133698411 16:8286854-8286876 TGGGAATTATTGAGGAAAAGTGG + Intergenic
1135205187 16:20477610-20477632 AGGGAAGGAAGGAGGAAAAGGGG + Intronic
1135357195 16:21779308-21779330 CGGGAAGGGTTGAGAAAATGGGG + Intergenic
1135455699 16:22595424-22595446 CGGGAAGGGTTGAGAAAATGGGG + Intergenic
1138035149 16:53596812-53596834 AGGTAAGGATTGAGCATAAGGGG - Intergenic
1139695851 16:68674166-68674188 TGGCAAGGATAGAGGGAAATTGG - Intronic
1140316753 16:73905712-73905734 AGGGAAGGTTTTAGGAAAAGGGG - Intergenic
1140828595 16:78730280-78730302 AGGCAAGGAAGGAGGAAAAAAGG - Intronic
1140958259 16:79887957-79887979 CGGCAAGCTTTGAAGAACAGAGG - Intergenic
1142663522 17:1447925-1447947 GAGCAAGAATTGAGGAAAAAAGG - Intronic
1143694367 17:8600621-8600643 TGGCAAGGCTTGAGGCAGAGAGG + Intronic
1145833372 17:27935614-27935636 GACCAAGGATTGAGGAATAGAGG + Intergenic
1148603475 17:48910762-48910784 GGGGAAGGAGTGAGGAAGAGGGG - Intronic
1151109934 17:71664267-71664289 CAGCAGGGATTGAAGGAAAGGGG - Intergenic
1153186149 18:2488895-2488917 GGGTAAGGATTTAAGAAAAGGGG - Intergenic
1153229638 18:2923635-2923657 AGGAAAGGAGTGAGGAAGAGCGG + Intronic
1155072902 18:22331792-22331814 GGGCAAGGATTGAAGCCAAGAGG + Intergenic
1155080508 18:22405660-22405682 CAGCAAATATTGAGGTAAAGTGG + Intergenic
1155687816 18:28577229-28577251 AGGAAAGGATTGAGAAAAATAGG - Intergenic
1156451698 18:37270122-37270144 CGGCTAAGTTTGAGGAAAAAAGG + Intronic
1156544600 18:37951281-37951303 CTAAAAGGATTCAGGAAAAGTGG + Intergenic
1156742536 18:40349731-40349753 AGGAAAGGAATGAGAAAAAGTGG - Intergenic
1157502670 18:48202369-48202391 GGGCAAGGATTGAGGGAGGGAGG + Intronic
1159482119 18:69002897-69002919 CGTTATGTATTGAGGAAAAGGGG - Intronic
1161116730 19:2501150-2501172 AGGCAAGGATTCTGGAAGAGGGG + Intergenic
1163166182 19:15499710-15499732 GGGAAAGGATTGGGGAGAAGGGG - Intergenic
1164286525 19:23822189-23822211 CTGCAATGATTGAGGGAAGGTGG - Intronic
1166162282 19:40963515-40963537 TGGCAAGCATTCAGGAACAGTGG + Intergenic
1166177453 19:41084877-41084899 TGGCAAGCATTGAGAAACAGTGG + Intergenic
1166895592 19:46020061-46020083 CTGCAAGGATTCAGTAAAACAGG - Intronic
926460669 2:13125934-13125956 AGGCAAGGACTGAGGGAAAGCGG - Intergenic
927693717 2:25226147-25226169 GGGGAACGTTTGAGGAAAAGGGG - Intergenic
930847308 2:55919574-55919596 AAGGAAGGATTGAGCAAAAGTGG + Intronic
931128235 2:59301779-59301801 TGGAGTGGATTGAGGAAAAGAGG + Intergenic
932751261 2:74373168-74373190 CTGCAAGGATTGGACAAAAGTGG - Intronic
933480359 2:82849152-82849174 CTGCAAGTATTGAAGAAAAGGGG - Intergenic
933529848 2:83494366-83494388 CAGCAAGGTTTGAGGATAAAAGG + Intergenic
934136182 2:88998533-88998555 CGGTAGGGATAGAGGAAATGGGG - Intergenic
935417180 2:102831321-102831343 TGGCAAGGATTGTGGAGAAAAGG - Intronic
941530430 2:166663264-166663286 TGGCAAGGATGCAGGAAAATTGG + Intergenic
941911913 2:170771585-170771607 GGGCAAGGACTGAGGGAAGGGGG - Intergenic
941949229 2:171135908-171135930 TGTCAAGGATTGTGGAAAAATGG + Intronic
943261519 2:185669745-185669767 TTGCAAGAGTTGAGGAAAAGGGG - Intergenic
945126893 2:206521874-206521896 TGGCAAGGATGTAGGAAAACTGG - Intronic
945928299 2:215828830-215828852 GGGCAAGGATGGGAGAAAAGAGG - Intergenic
946165095 2:217858904-217858926 CGGCCGGGAGTCAGGAAAAGTGG + Intronic
946194670 2:218025940-218025962 AGGGAAGGAGAGAGGAAAAGAGG - Intergenic
946875309 2:224123813-224123835 TGGCATGGATTCAGGAAAGGTGG + Intergenic
947398031 2:229705801-229705823 TGTCAATGATTGAGGAAACGGGG + Intronic
948890231 2:240903777-240903799 CTGCAGTGACTGAGGAAAAGGGG + Intergenic
1169947994 20:11010049-11010071 AGGCAAGGATAAAGGAGAAGAGG + Intergenic
1169989184 20:11481484-11481506 CGGGCAGGATGGAGGAGAAGGGG + Intergenic
1174291180 20:49509840-49509862 CTGCAGGGATTGAGGGAAAAGGG - Intronic
1174909121 20:54587446-54587468 AGGCAAAGATTGATGGAAAGTGG + Intronic
1175768890 20:61610632-61610654 CGGCAAGGAGGCAGGGAAAGGGG - Intronic
1175772947 20:61635272-61635294 TGGCAAGGATTGGGAGAAAGGGG - Intronic
1178379307 21:32094537-32094559 AGGGAAGAATTGAGGAGAAGAGG - Intergenic
1179076642 21:38128487-38128509 GGGCAAGGATGGAAGAAAGGTGG - Intronic
1180137647 21:45871591-45871613 CAGCAAGGATTGAAGATAAGGGG - Intronic
1180960476 22:19760324-19760346 AGGCGAGGATGGAGGAAAAGGGG + Intronic
1183158304 22:36092664-36092686 CAGCAGGGACTGAGGAGAAGGGG - Intergenic
1185078536 22:48696373-48696395 AGGGAAGGAGTGAGGAGAAGAGG - Intronic
1185303361 22:50096607-50096629 TGGCAAGGATACAGAAAAAGTGG - Intronic
950677817 3:14565184-14565206 AGGCAAGAATTAAGGGAAAGGGG + Intergenic
951568624 3:24038575-24038597 TGGAATGGAATGAGGAAAAGTGG - Intergenic
951941125 3:28079892-28079914 GGACAAGGAGTGAGGAAAATGGG + Intergenic
953273886 3:41475949-41475971 AGGAAAGGATGGAGGGAAAGAGG + Intronic
953342638 3:42148528-42148550 GGGGAAGGAGTGAGGAAATGAGG - Intronic
953458316 3:43061557-43061579 CAGCAAGCACTGAGGCAAAGAGG - Intergenic
953672899 3:44977312-44977334 AGGAAAGGCATGAGGAAAAGAGG - Intronic
954372448 3:50175978-50176000 GGGCAAGGAGAGAGGAACAGAGG - Intronic
955612827 3:60775764-60775786 CGGCATGGAGTGAGGAGCAGTGG - Intronic
955641427 3:61089660-61089682 GGGCAAGGAGAGATGAAAAGGGG + Intronic
956914121 3:73852785-73852807 TGGCAAGGACTCAGGAAAGGAGG - Intergenic
957314724 3:78562495-78562517 TGGCAAGGATGTAGAAAAAGAGG - Intergenic
957803968 3:85122723-85122745 CGGCAAGGATTGAGGAAAAGAGG - Intronic
959595858 3:108127637-108127659 CAGCAAGTGTTCAGGAAAAGGGG + Intergenic
960966800 3:123111146-123111168 AGGCAAAGATGAAGGAAAAGAGG - Intronic
961174623 3:124823735-124823757 AGCCATGGATTGTGGAAAAGAGG + Intronic
961175629 3:124832813-124832835 AGGCAAGCACTGAGGAAGAGGGG + Intronic
962890408 3:139667240-139667262 TGGCAAGGATGAAGAAAAAGAGG - Intronic
964518675 3:157540964-157540986 CGGCAAAGATTGGGGAGGAGAGG - Intergenic
965775881 3:172230820-172230842 TGGCAAGGTTGTAGGAAAAGTGG + Intronic
967642949 3:191889038-191889060 TGGGAAGGTGTGAGGAAAAGAGG - Intergenic
969884550 4:10203814-10203836 CAGGAAAGACTGAGGAAAAGAGG + Intergenic
972361385 4:38328637-38328659 AGGCCAGGATGGAGAAAAAGAGG - Intergenic
972479280 4:39482670-39482692 CAGCAAGGAAAAAGGAAAAGAGG - Intergenic
975474543 4:74808162-74808184 GGGCAAGGAGGGAGGGAAAGTGG + Intergenic
976160945 4:82198401-82198423 CGGTAACAATTGAGGAAAATTGG - Intergenic
976350172 4:84051855-84051877 CTGCAAAGAGTGAGGAAGAGGGG + Intergenic
976495425 4:85724071-85724093 CAGCAAGGATTGCAGAAATGTGG + Intronic
979314161 4:119240406-119240428 CAACAAGGATTGAGGCAAAATGG - Intronic
986888480 5:12270268-12270290 CTGAAAGTATTGAGGAAAAAGGG + Intergenic
988184984 5:27848355-27848377 TGGCAAGGATTGGGAGAAAGGGG - Intergenic
989257303 5:39379600-39379622 GGGCAAGGAATAAGGAAAAAGGG + Intronic
991518654 5:67469062-67469084 CAGAAAGGATAGAGGAAGAGAGG - Intergenic
995279257 5:110314910-110314932 TGGCAAGGATTCAGAGAAAGGGG + Intronic
999126868 5:149252368-149252390 AGGGCAGGATTCAGGAAAAGTGG - Intronic
999552034 5:152699759-152699781 TGGCAAGGATTCAGGACAACAGG - Intergenic
999921734 5:156328985-156329007 CGTCAAGCATTGAGCAGAAGAGG + Intronic
1000827112 5:166058692-166058714 TGAGAAGGATGGAGGAAAAGGGG - Intergenic
1002720319 5:181256115-181256137 TGGCAAAGATTGAAGAAAACTGG - Exonic
1003291194 6:4779658-4779680 CTGCTAGGATTGAGGAAAAACGG + Intronic
1004217501 6:13716477-13716499 AGGCAGGGAATGAAGAAAAGAGG + Intergenic
1004593901 6:17080533-17080555 CAGCAAGGATGGATGCAAAGTGG + Intergenic
1004903240 6:20212549-20212571 AGGGAAGGAGGGAGGAAAAGTGG + Intergenic
1008057175 6:46956969-46956991 TGGAAAGGAAAGAGGAAAAGAGG + Intergenic
1008933219 6:56961755-56961777 GGGGAAGGATTTAGGAAGAGTGG - Intronic
1012958568 6:105597518-105597540 TGGCAAGGGTTGTGGGAAAGGGG - Intergenic
1012990759 6:105923361-105923383 AGGCAAGGATTGAGAAGAAAAGG + Intergenic
1014259280 6:119197544-119197566 GGGAAAGAATAGAGGAAAAGTGG + Intronic
1014966486 6:127759803-127759825 AGGGAAGGAATGAGGAAAGGAGG - Intronic
1015283860 6:131462801-131462823 GGACAAGGAATGAGGAAAACTGG + Intergenic
1016086940 6:139926128-139926150 AGGGAAGGACTGAGGAGAAGCGG - Intergenic
1016361238 6:143269323-143269345 TGGCAAGGATTCAGAATAAGTGG + Intronic
1016696293 6:147000107-147000129 AGGCAAGGACTTAGGGAAAGAGG - Intergenic
1017161204 6:151367561-151367583 AGGAAAGGATTGAGGATTAGAGG + Intronic
1017867651 6:158457883-158457905 CTGCAAGGACTGAAAAAAAGGGG - Intronic
1018552157 6:165010032-165010054 AAGCAAGGAGAGAGGAAAAGGGG - Intergenic
1019090324 6:169525600-169525622 GGGCAAGGATGTAGAAAAAGAGG + Intronic
1020188885 7:5979463-5979485 AGGAAAGGATTCAGAAAAAGTGG - Intronic
1020294030 7:6745293-6745315 AGGAAAGGATTCAGAAAAAGTGG + Intergenic
1020629056 7:10618643-10618665 GGGCAAAAATTAAGGAAAAGAGG - Intergenic
1021276861 7:18662708-18662730 CAGCAGGGAGTGAGGAAAAGGGG + Intronic
1022852010 7:34273409-34273431 CTTCAAGGCTTGAGGAGAAGAGG + Intergenic
1024471113 7:49769608-49769630 AGAGAAGAATTGAGGAAAAGAGG - Intergenic
1025172031 7:56767673-56767695 CGGCAAGGATGTGGAAAAAGGGG + Intergenic
1025699836 7:63807882-63807904 CGGCAAGGATGTGGAAAAAGGGG - Intergenic
1027271153 7:76519679-76519701 CGGCAAGGCCCCAGGAAAAGGGG + Intergenic
1027320917 7:77009614-77009636 CGGCAAGGCCCCAGGAAAAGGGG + Intergenic
1031513785 7:122678506-122678528 GGGCAAGGGTTTAGGAAATGGGG + Intronic
1032776045 7:135114329-135114351 TGGCAAGGATTTAGAAAAATTGG - Intronic
1034760995 7:153671700-153671722 GGGTAATGATTGAAGAAAAGAGG - Intergenic
1036668149 8:10761629-10761651 TGGCAAGGATGGAGGAAAAGGGG + Intronic
1038063143 8:23934532-23934554 GGGCAAGGATTGCAGCAAAGAGG + Intergenic
1039302949 8:36229718-36229740 TGTCAGGGATTGAGGTAAAGGGG + Intergenic
1041864260 8:62551243-62551265 CGGGAAGGAAAGAGTAAAAGTGG + Intronic
1042220333 8:66467070-66467092 GGGCAAGAATGGAGCAAAAGTGG + Intronic
1043292921 8:78626377-78626399 TGGCAAGGATGCAGGGAAAGGGG - Intergenic
1043767976 8:84161863-84161885 AGGGAAGGATAGGGGAAAAGGGG - Intergenic
1045039839 8:98212914-98212936 AGGCAGGGAGTGAGGGAAAGGGG - Intronic
1047515775 8:125553618-125553640 TGGCAAGGATGCAGGAAAAAGGG - Intergenic
1047521565 8:125599038-125599060 CGGCCAGGATGGTGGAAAAGAGG - Intergenic
1049064790 8:140304556-140304578 GAGCAAGGATTTAGGAAGAGGGG + Intronic
1050368214 9:4892877-4892899 CAGCAAGAATGGAGGAAAAGAGG + Intergenic
1051029509 9:12657918-12657940 CTGCAAAGAGTGAGTAAAAGTGG - Intergenic
1051874077 9:21772069-21772091 CTGGAAGGACTGAGGTAAAGGGG + Intergenic
1055268245 9:74524234-74524256 TGGAAAGGCTTGAAGAAAAGTGG + Intronic
1055423502 9:76168858-76168880 TGGGGAGGAGTGAGGAAAAGAGG - Intronic
1059018239 9:110545400-110545422 TGGCAAGGATGGAGAGAAAGAGG - Intronic
1059700374 9:116770131-116770153 CCGCAAGGATAGAGAAAAGGAGG + Intronic
1059859667 9:118445247-118445269 CAGCAATAATTGAGAAAAAGGGG - Intergenic
1061362039 9:130149773-130149795 GGGCAAGGAGGGAAGAAAAGGGG - Intergenic
1186822891 X:13309548-13309570 CAGGAAAGATTGGGGAAAAGTGG + Intergenic
1187079430 X:15971384-15971406 CAGCAGGGATTGAAGAAGAGGGG + Intergenic
1189202254 X:39206576-39206598 CAGCAAGGTTAGAGGAGAAGAGG + Intergenic
1189585498 X:42457003-42457025 AGGGAAGGAGAGAGGAAAAGAGG - Intergenic
1189846382 X:45142497-45142519 AGGCAAAAATTCAGGAAAAGAGG - Intergenic
1190114652 X:47618864-47618886 GGGCAAGGGTTGAGGAGAACAGG + Intronic
1193147912 X:78096494-78096516 CGGCAAGGGTTTAAGAAGAGGGG + Intronic
1194017214 X:88637889-88637911 AGGCAAGGGATGAGGAAAAGAGG + Intergenic
1194165811 X:90513868-90513890 TGGCATGGATGCAGGAAAAGAGG + Intergenic
1196770090 X:119284794-119284816 TGGCAAGGAGAGAGGGAAAGTGG - Intergenic
1197918849 X:131567103-131567125 GGGAAAGGTTTGAGGAAGAGAGG - Intergenic
1198058676 X:133021321-133021343 CGGGAAGGACTCAGGAACAGAGG + Intergenic
1199086132 X:143633239-143633261 CACCAAGGAGAGAGGAAAAGAGG + Intronic
1200512082 Y:4091660-4091682 TGGCATGGATGCAGGAAAAGAGG + Intergenic
1200902824 Y:8450249-8450271 TGGCAAGGATTAAGAAAGAGAGG - Intergenic