ID: 957805062

View in Genome Browser
Species Human (GRCh38)
Location 3:85136275-85136297
Sequence AAATAAAAGCTACATTTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 526
Summary {0: 1, 1: 0, 2: 6, 3: 48, 4: 471}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957805062_957805065 5 Left 957805062 3:85136275-85136297 CCTCCTAAATGTAGCTTTTATTT 0: 1
1: 0
2: 6
3: 48
4: 471
Right 957805065 3:85136303-85136325 CTGATAATCTAGTAGCAATTAGG 0: 1
1: 0
2: 1
3: 7
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957805062 Original CRISPR AAATAAAAGCTACATTTAGG AGG (reversed) Intronic
901047084 1:6403503-6403525 AAAAAAAAGGTTCAGTTAGGAGG - Intergenic
901770155 1:11525968-11525990 AAATAAAAGATAAAATTAGCTGG - Intronic
902294565 1:15457617-15457639 AAAAAAAAGATACATTTCTGTGG + Intronic
905096603 1:35477365-35477387 AAATAAAAACTACAATGAGATGG + Intronic
905341068 1:37277933-37277955 AAATAAAAAATAAATTTAGTTGG - Intergenic
905437599 1:37968240-37968262 AAAGGAATGCTACCTTTAGGTGG - Intronic
906470287 1:46124149-46124171 AAATACAAGCTACACTTATTTGG + Intronic
907756565 1:57316410-57316432 AAATAAAATCTTCATTTGAGGGG - Intronic
908134056 1:61110620-61110642 TTATAAAAGCGAAATTTAGGTGG + Intronic
908176385 1:61559368-61559390 AACTAGAAGCTACTTTTATGTGG - Intergenic
909514348 1:76490333-76490355 AAAAAAAATCTGCATTTAGTAGG + Intronic
910229473 1:84971311-84971333 AAATAATATGTACATTTGGGAGG + Intronic
910442981 1:87271968-87271990 AACTTAGACCTACATTTAGGTGG + Intergenic
910456698 1:87405384-87405406 GAAAAAAATCTACATTTAAGTGG - Intergenic
910523069 1:88145535-88145557 AAAAAAAAAAAACATTTAGGAGG - Intergenic
910581314 1:88828399-88828421 AAATCAAAGCTATCTTTGGGAGG - Intronic
910795923 1:91097424-91097446 AAATAAACCTTACATTTATGGGG - Intergenic
911381097 1:97116102-97116124 AAAGAAGAAATACATTTAGGAGG + Intronic
911594549 1:99785458-99785480 CATCAAAAGCTACATTTATGAGG + Intergenic
911723187 1:101213439-101213461 AAATAAAAGCAAAATTTGGTGGG - Intergenic
911739423 1:101370764-101370786 AAATAGAAGTTACAATTAAGTGG - Intergenic
911795896 1:102075907-102075929 AAATAATAGATATATTTAGAAGG - Intergenic
912489210 1:110052421-110052443 ATAAAAAAGATACAATTAGGTGG - Intronic
912610731 1:111040563-111040585 AAAAAAAAGTTGCAGTTAGGCGG + Intergenic
914671605 1:149874810-149874832 AAATAAAATATAGATTAAGGGGG + Intronic
915410278 1:155696015-155696037 AAATAAAAGTCACATTAAGCAGG - Intronic
916018530 1:160772630-160772652 AACCAAAAGCAAAATTTAGGTGG - Intergenic
916680686 1:167102326-167102348 AAATAAAACCCTCTTTTAGGAGG + Intronic
917048238 1:170887669-170887691 AAGTATAACCAACATTTAGGTGG + Intergenic
917113827 1:171581038-171581060 AAATAAAAGCCACATTTATGAGG - Intronic
917332577 1:173897365-173897387 AAAGAAAAGCTGCATTAAGTGGG - Exonic
917378115 1:174373077-174373099 ACATATGAGGTACATTTAGGTGG - Intronic
917388134 1:174500427-174500449 AAATGAATGATACATTGAGGGGG - Intronic
917751020 1:178053457-178053479 AAAAAAAAGCTACAGTCACGGGG + Intergenic
917813542 1:178684465-178684487 AAAAAAAAGCAAAATTTATGTGG + Intergenic
918572046 1:186007764-186007786 AAATAAGAGCTACATATATTTGG - Intronic
918858586 1:189791801-189791823 CAATAAAAGCTACATGAATGTGG - Intergenic
920843143 1:209571639-209571661 AAATATAAGAAATATTTAGGAGG + Intergenic
921669430 1:217909839-217909861 AAAGAAAACCTACATTTTAGAGG + Intergenic
922518481 1:226225469-226225491 AAATAAAAGCTGCTTTTGGTTGG - Exonic
922686615 1:227643815-227643837 AAATAAAAGCTAAATATAGATGG - Intronic
923026737 1:230210272-230210294 AAATGAAATCAACCTTTAGGGGG + Intronic
923675679 1:236078934-236078956 AAAAAAAAGTTATATTTAGCTGG + Intergenic
923804351 1:237242349-237242371 AAGTAAATGCTGTATTTAGGGGG + Intronic
923878573 1:238077164-238077186 ACATACAAGCTTTATTTAGGTGG - Intergenic
924023268 1:239807153-239807175 AAATAAAAGTCCTATTTAGGTGG + Intronic
924276459 1:242392406-242392428 AAATAAAAGTTAAAATTATGGGG + Intronic
924715796 1:246572645-246572667 AAATAAAACATACATTTGGCTGG - Intronic
1064061912 10:12145051-12145073 AAAAAAAAGGAACATTGAGGAGG + Intronic
1064233775 10:13554545-13554567 AAATAAATGCTACAGTTATGTGG + Intergenic
1065009111 10:21405778-21405800 CAAAAAAAGCAACATTTGGGTGG - Intergenic
1065384823 10:25124508-25124530 AAAAAAAAATTACATTCAGGAGG - Intergenic
1066441771 10:35446406-35446428 AAAGAAAATCTATATTTAGTGGG - Intronic
1068193552 10:53686200-53686222 AAATAACAGTTGCATTTAAGAGG + Intergenic
1068248841 10:54409515-54409537 AAAAAAAAGCTACAGGTAGCTGG + Intronic
1068534218 10:58222621-58222643 GAAATAAAGCTACATTTAAGAGG + Intronic
1070085467 10:73232835-73232857 GACTAGAAACTACATTTAGGGGG - Intronic
1070536401 10:77381319-77381341 AAATGAAAGATACAATTAGTAGG + Intronic
1070585287 10:77760885-77760907 AAAAAAAAGCTACATTTTCTAGG + Intergenic
1071219325 10:83445330-83445352 GAGTAGAAGCTAAATTTAGGAGG + Intergenic
1071414612 10:85429434-85429456 AAATGAAACCTACAATAAGGAGG + Intergenic
1071683767 10:87733965-87733987 AACTGAAAGCTACATTTGGCAGG - Intronic
1072184019 10:93017288-93017310 AGATAAAAACTACATATTGGGGG + Intronic
1073079028 10:100845524-100845546 AAATAAAAGTTAAATATAGTTGG - Intergenic
1074028983 10:109665236-109665258 AGATAAAGGCTGCATTGAGGAGG - Intergenic
1074106317 10:110392248-110392270 AAATAATAGCAACATTTATTGGG - Intergenic
1074592999 10:114831545-114831567 ATATAAAGGCTACAATTATGGGG + Intronic
1074727459 10:116326238-116326260 AAATAAAAGGTAGTTTTAGGAGG + Intronic
1075815001 10:125258161-125258183 AAATAAAAGATATATTTAAAGGG - Intergenic
1078020652 11:7653731-7653753 TAATAAAAGCAATATTTATGCGG + Exonic
1078439791 11:11354968-11354990 AAATTCAAGCTATATTTAGGAGG - Intronic
1078635884 11:13049651-13049673 AAATGAAAGCTAAATCTAGAGGG - Intergenic
1079484793 11:20924407-20924429 AAATAAAAACCACATTCAGAAGG + Intronic
1079515667 11:21265289-21265311 AAATAAAAACTATATTCAGAAGG + Intronic
1080239612 11:30111562-30111584 GAATAAAAGCTAAATATAGATGG + Intergenic
1080955946 11:37095531-37095553 AAAAAAAATCTACATATAAGTGG - Intergenic
1080961502 11:37166210-37166232 AAATAATAACAACATTTAGGTGG - Intergenic
1083754544 11:64783924-64783946 AAATAAAAAATACATTGAGGTGG + Intergenic
1085790099 11:79489938-79489960 AATTAAATACTACATTTATGTGG - Intergenic
1085864997 11:80280678-80280700 AAATAAAAGCTAAAATTATTTGG - Intergenic
1087093823 11:94301294-94301316 AAATAAAAACCACATTTAAAAGG + Intergenic
1087271158 11:96113456-96113478 AAATAAAAGTTAAATTGAGGGGG - Intronic
1087553715 11:99687647-99687669 AAATGAATACTACATTTAGGTGG + Intronic
1087816917 11:102668705-102668727 AATTAAAAAATATATTTAGGGGG + Intergenic
1088341069 11:108767794-108767816 AAACAAAATCCACATTTAAGTGG - Intronic
1088823917 11:113477740-113477762 AAATAAATGAAAGATTTAGGAGG - Intergenic
1088861243 11:113801683-113801705 AGATAAAAGGTAGAATTAGGTGG + Intronic
1089913259 11:122125299-122125321 AAAAAAAAGCTACATATTGCTGG + Intergenic
1090143146 11:124287730-124287752 AAATAAAAGATACATTCATTGGG - Intergenic
1090191332 11:124771309-124771331 AAATAATGGCTACAATTTGGGGG + Intronic
1091369121 11:135044238-135044260 AAATAAAAACAACATCCAGGGGG - Intergenic
1091973549 12:4808459-4808481 AAATAATAGCTACATTTACTGGG - Intronic
1092578883 12:9818707-9818729 AAATAAAAGCAAAATTTAGGGGG - Intergenic
1092979995 12:13785009-13785031 ACATAAAAGCAACATTTTGTGGG - Intronic
1093720252 12:22433689-22433711 AAATTAAAAATATATTTAGGAGG - Intronic
1094109130 12:26842507-26842529 AATTAGAAGTTACATTTAAGGGG + Intergenic
1094674953 12:32611042-32611064 AACTAAAATCTAAATTTAGAAGG - Intronic
1095192727 12:39276444-39276466 AAATACATGCTAGATTTAGAAGG + Intergenic
1095209547 12:39476507-39476529 AAAAAAAAGCTATATTTGGCTGG - Intergenic
1095716983 12:45356781-45356803 AAAAAAAATCCACATTTAAGTGG + Intronic
1095937079 12:47696496-47696518 GAAAAAAATCTACATTTAAGTGG - Intronic
1096074972 12:48797732-48797754 AAATAAATGTTAAAATTAGGGGG - Intergenic
1096165700 12:49421730-49421752 AAAGAAAAGTTACTCTTAGGTGG + Intronic
1096850613 12:54433298-54433320 TAACAAATGCTACATTTAAGAGG - Intergenic
1097415615 12:59312787-59312809 ACATAAAAGTTAAATTTAGGTGG + Intergenic
1097921835 12:65084186-65084208 AAATAAATGCTGGATTCAGGTGG - Intronic
1098075987 12:66732092-66732114 AAAAAAAATCTACATATAAGTGG - Intronic
1099255799 12:80309800-80309822 AAATGACAGATATATTTAGGTGG + Intronic
1099362004 12:81714863-81714885 AAATAAAAGCTCTATTTATGAGG + Intronic
1100106155 12:91175156-91175178 AAATAAATGCTATAATTAAGAGG + Intronic
1101036455 12:100711855-100711877 AAATAAAAGGAAGATTTAGAAGG + Intergenic
1101582429 12:106053697-106053719 AAATAAAAGCTAACTTTGGCAGG + Intergenic
1101787621 12:107899077-107899099 AAAGAAAAATTACATTTAGTGGG - Intergenic
1103110213 12:118270655-118270677 AAAAAAAAGTGACATTTAGCTGG - Intronic
1103593959 12:122011816-122011838 AAATAAAAACAAAATTTAGCTGG + Intergenic
1105212091 13:18262905-18262927 AAAAAAAAGCCACATGTAGTGGG - Intergenic
1106746615 13:32715395-32715417 AAACAAAATCTAGATTTAGAGGG - Intronic
1106855835 13:33851645-33851667 AAATAAAACCTACATATAAATGG + Intronic
1106889733 13:34231913-34231935 AAATCAAAGCTACAATGAGATGG - Intergenic
1107176786 13:37408226-37408248 AAATCTAAGCTTCATTTATGAGG + Intergenic
1107194682 13:37635611-37635633 AAATAAATGCTAATTTTATGTGG + Intergenic
1107543938 13:41419274-41419296 AAATTAAAGCCACAGTAAGGAGG + Intergenic
1107753067 13:43589822-43589844 AAATAAAAGCTGCCCTTAGTTGG + Intronic
1107799465 13:44090772-44090794 AAACAAAAGCTACATTTTGTTGG + Intergenic
1110164026 13:72415748-72415770 CAATGAAAGGTAGATTTAGGTGG - Intergenic
1110167244 13:72458149-72458171 AAATATAAGTTACATTAAGGAGG + Intergenic
1110257890 13:73452143-73452165 AAATAATAGACACATTTAAGAGG - Intergenic
1110675850 13:78243269-78243291 AAAGAAAAGATACATTTTTGAGG - Intergenic
1110968223 13:81728220-81728242 AAATAACAGCTACATTTTGACGG + Intergenic
1111308987 13:86456533-86456555 AAATAAAATAAACAATTAGGAGG + Intergenic
1111491786 13:88986922-88986944 AAGGAAAAGCTAGATGTAGGAGG + Intergenic
1111919970 13:94400117-94400139 AAATAAAATCAACAATTAAGAGG + Intronic
1111953065 13:94725771-94725793 AATGAAAAGCTTCATTTTGGAGG - Intergenic
1112748764 13:102558450-102558472 CCATCAAAGCTATATTTAGGAGG - Intergenic
1112976234 13:105321789-105321811 AAATAAAACCTACATTAGGAAGG - Intergenic
1113061549 13:106327855-106327877 AACTAAAAGCTATAATTAGTTGG + Intergenic
1114802019 14:25786714-25786736 AATTAAAAAATATATTTAGGAGG + Intergenic
1114910187 14:27183752-27183774 CAATAAGATCTACATTAAGGTGG - Intergenic
1115091416 14:29581418-29581440 AAATAATAACTACTTTCAGGGGG - Intronic
1115182835 14:30649343-30649365 AACTAAAAAATATATTTAGGGGG - Intronic
1116644013 14:47503314-47503336 AAAAAAAAGGCATATTTAGGTGG + Intronic
1116743130 14:48781981-48782003 ATGTAAAGGCTACATTTAGAGGG + Intergenic
1117238120 14:53799677-53799699 AAATAAAACCTACATTTGATTGG + Intergenic
1117595633 14:57324561-57324583 AAAAAAAAGCCACACTTAAGTGG + Intergenic
1118420596 14:65598009-65598031 AAATAAAAAATACAATTAGCTGG + Intronic
1121637689 14:95464921-95464943 AAATATAAGCTATATCTGGGAGG + Intronic
1121883054 14:97517558-97517580 AAATAAAAGCTACATCAAATGGG - Intergenic
1121981914 14:98461786-98461808 AAAGAAAAGCCTCATTTAGAAGG - Intergenic
1122515072 14:102302049-102302071 ATATAAAATTTACATTTATGGGG - Intronic
1202841042 14_GL000009v2_random:121657-121679 AAATAATAGTCAAATTTAGGGGG - Intergenic
1202910428 14_GL000194v1_random:111885-111907 AAATAATAGTCAAATTTAGGGGG - Intergenic
1202881347 14_KI270722v1_random:63582-63604 AAAAAAAAACTAGATTTAGAAGG - Intergenic
1125974715 15:43940717-43940739 AAATTAAATCAATATTTAGGTGG + Intronic
1127100838 15:55563296-55563318 AAATAAAAGATACATTTGGAGGG - Intronic
1128010104 15:64285791-64285813 ACAGAAAAACTACATTTTGGAGG + Intronic
1128281092 15:66395344-66395366 AAAGCAAAACTACATTTAAGTGG + Intronic
1128436808 15:67660269-67660291 AAAAAAACACTACATTTTGGAGG - Intronic
1128594985 15:68936680-68936702 AAATAAAAGGTAAATTATGGAGG + Intronic
1129490071 15:75915907-75915929 AAAAAAAAGCTAAAATTAGCTGG + Intronic
1129628483 15:77231312-77231334 AAATAAATGCTACATATAAGTGG + Intronic
1129804169 15:78440334-78440356 AAATAAAATATACATTTAATTGG - Intronic
1129941941 15:79505632-79505654 CAATGAATGCTAAATTTAGGGGG - Intergenic
1130148094 15:81290694-81290716 AAATATAAGCTAAATTTAGCTGG - Intronic
1130512709 15:84602528-84602550 TAATAATGGCTACCTTTAGGTGG - Intronic
1131330246 15:91491311-91491333 AAATAAAAGCCACATTCTGCAGG + Intergenic
1131911159 15:97204192-97204214 GAATAAAATCTGCATATAGGTGG - Intergenic
1132944491 16:2525352-2525374 AAAAAAAAGCAACATTTGGCTGG - Intronic
1133147228 16:3797575-3797597 TAATAAAAGCTACATGAATGTGG + Intronic
1138761642 16:59551166-59551188 AAATAAATGCCAACTTTAGGTGG + Intergenic
1138914180 16:61442586-61442608 AAAAAAAAAAAACATTTAGGTGG + Intergenic
1139032847 16:62906313-62906335 AAATAAAATCTATATTTAATAGG + Intergenic
1140388315 16:74562444-74562466 AAAGAAAAGCTTCCTTTAGCTGG - Intronic
1141352055 16:83307056-83307078 ACATATAAGCTACAGTTGGGTGG + Intronic
1142748628 17:1974053-1974075 AAAAAAAAGCTATCCTTAGGAGG + Intronic
1143230576 17:5350766-5350788 ACATAACAGCTACATTTGAGGGG + Intronic
1146087505 17:29843593-29843615 AAAGGAAAACTACACTTAGGAGG - Intronic
1146261729 17:31426470-31426492 AAATAACAGCATCATTTATGTGG - Intronic
1146386103 17:32374907-32374929 AAATAAAAGCAAATTTTAGTTGG - Exonic
1147887630 17:43695327-43695349 AAATAAAAGCTTCCTTTGGGAGG - Intergenic
1147950820 17:44106858-44106880 ACATAAAAGCTACTTTTGGCCGG - Intronic
1147981409 17:44276574-44276596 GAATAAAAGCTACATTTCCTAGG - Intergenic
1149504242 17:57180399-57180421 AAATAACATTTACATTTGGGAGG - Intergenic
1149962318 17:61124333-61124355 AAGTAAAAGCTATATCTTGGTGG - Intronic
1149963540 17:61138585-61138607 AAATAAATTATCCATTTAGGGGG + Intronic
1150371465 17:64642440-64642462 AAATAACTACTACATTTAGTAGG - Intronic
1150440252 17:65185565-65185587 AAATACAAGCTAAATTCATGTGG + Intronic
1153081357 18:1229601-1229623 AAATAAAAGCAATATTTAAAAGG - Intergenic
1154401770 18:14045065-14045087 AAATAATAGCTACAGTAATGTGG + Intergenic
1155673504 18:28401019-28401041 AAATGAAATAGACATTTAGGAGG + Intergenic
1155905919 18:31451020-31451042 AAATAAAAGCTATATTTGGGAGG + Intronic
1156150717 18:34239321-34239343 GAATAAAAGGTACATTTGGAGGG - Intergenic
1156196409 18:34778780-34778802 AAATAAAAGCTATATATATAGGG + Intronic
1156507140 18:37604784-37604806 AAATAAATAATACAGTTAGGAGG + Intergenic
1156747364 18:40408333-40408355 AAATAAAAACCACATCTAGTCGG + Intergenic
1156803071 18:41142223-41142245 AAATAATATTTACATTTATGAGG - Intergenic
1156872970 18:41968970-41968992 AAAAAAAAACTAAAATTAGGTGG - Intronic
1158204970 18:54983100-54983122 AAAAAAAAGCTCCAGTTAGTGGG - Intergenic
1158654439 18:59317474-59317496 AAATATAAGCAACATTTAATTGG - Intronic
1158870506 18:61682879-61682901 AAATAAAAGTTGCATTTAAAGGG + Intergenic
1163452865 19:17389444-17389466 AAATAAAAGCTACAACTAAAAGG - Intergenic
1163542829 19:17921545-17921567 AAAAAAAAGAAACATTTAGCTGG + Intergenic
1163708256 19:18830095-18830117 AAATAAAAATAACATTTCGGGGG + Intergenic
1165156981 19:33795250-33795272 AAATAAAACCTTCCCTTAGGAGG + Intergenic
1168033601 19:53701296-53701318 TAAGAAAAGCAACGTTTAGGTGG + Intergenic
1168035527 19:53716341-53716363 AAATATAAGCTACGTGTAGTAGG + Intergenic
1168649072 19:58081518-58081540 AAATGAAAGCCAAATTTAGGGGG + Intronic
1168683006 19:58329657-58329679 TAATAAAAGCTATATTAATGTGG - Intronic
1202656957 1_KI270708v1_random:32687-32709 AAAAAAAAACTAGATTTAGAAGG - Intergenic
925250226 2:2427866-2427888 AATTAATAGATACATTTTGGGGG - Intergenic
926998352 2:18764305-18764327 AAAGAAAAGCCACATGTAAGTGG - Intergenic
927841716 2:26449254-26449276 GAATAAAAGCTGCATTGAGCTGG + Intronic
928112848 2:28524626-28524648 AAATAAATTCTAGATTTTGGAGG + Intronic
928778991 2:34797841-34797863 AAATGAAAGCTGCATTTGAGTGG - Intergenic
928886939 2:36160104-36160126 AAATTGAAGCAACATTTATGAGG + Intergenic
928935429 2:36671568-36671590 AAATACATGGTACATTTAGGTGG - Intergenic
929009721 2:37429062-37429084 AAATAAAAAATAAATTTAAGTGG - Intergenic
929048770 2:37816383-37816405 GAATAAAAGCTGCATTTTGCTGG - Intergenic
929156263 2:38791270-38791292 AAATAAAAACTACATTGAGCTGG + Intergenic
930194100 2:48491614-48491636 CAATTATAGCTACATTTGGGTGG - Intronic
930436283 2:51347723-51347745 AAATCTATGCAACATTTAGGAGG + Intergenic
930469467 2:51794595-51794617 AAATGAAAACTACACTGAGGAGG + Intergenic
930855026 2:56006293-56006315 CAATGAAAGCAACATTTAGAGGG - Intergenic
931623504 2:64234536-64234558 AAAGAAAAGAAACATGTAGGTGG - Intergenic
933053141 2:77626581-77626603 AAAGTAAATCAACATTTAGGTGG - Intergenic
933746001 2:85571802-85571824 AAGGAAAAGGTACATTCAGGAGG - Intronic
934301536 2:91779503-91779525 AAAAAAAAGCCACATGTAGTGGG + Intergenic
935174580 2:100638570-100638592 ATATAACAGCTACTTTTAGAAGG + Intergenic
935238571 2:101158371-101158393 AAAAAACAACTACATTTAGTAGG - Intronic
935243200 2:101195722-101195744 AAAAAAGAGCTACGTTTAGAAGG + Intronic
935463482 2:103366542-103366564 AAATAAATGCTTCATTTTGTAGG - Intergenic
937601617 2:123743088-123743110 AAATAAAAGCTACATATAGAAGG + Intergenic
937995484 2:127691050-127691072 AAAGAAAAGCTAATTTTCGGGGG - Intergenic
939355939 2:141102067-141102089 AAATCAAAGCTACATTTTAACGG + Intronic
939377642 2:141390224-141390246 AAATCAAAACTACAATAAGGTGG + Intronic
939891098 2:147737155-147737177 AAAAAAAAAATACAGTTAGGTGG + Intergenic
940014800 2:149092841-149092863 AAATAAAAAATACCTTGAGGTGG - Intronic
940547950 2:155114492-155114514 AAATAAAAGTTACCTTAAGAAGG + Intergenic
940646179 2:156395022-156395044 AAAAAATAGCTACCTTTATGAGG - Intergenic
941354773 2:164476954-164476976 AAAAAAAGTCTACTTTTAGGGGG + Intergenic
941373882 2:164703657-164703679 AAATACAGGAAACATTTAGGAGG - Intronic
942562076 2:177230775-177230797 TAAGAAAAACTAGATTTAGGAGG - Exonic
943019061 2:182551157-182551179 AAATAATAGCTACAATTGGGGGG + Intergenic
943217081 2:185051628-185051650 AAAAAAAAGTTACAGTTAGGAGG - Intergenic
944913167 2:204329842-204329864 AAACAAAAGCCGAATTTAGGGGG + Intergenic
945484365 2:210377706-210377728 AAGAAAAAGATGCATTTAGGAGG + Intergenic
946050460 2:216858036-216858058 AAACAAAAGTCACATTTAGGAGG + Intergenic
1168752958 20:296691-296713 AAATATAAGCTACCTATACGTGG + Intergenic
1169521341 20:6376576-6376598 AAAGAAAAGCAACAAATAGGAGG - Intergenic
1169657703 20:7943216-7943238 AAAGAAAATCTACATATAAGTGG - Intergenic
1169779162 20:9290721-9290743 AAATGAAAGCCACATTCAGATGG - Intronic
1171315507 20:24188897-24188919 AAAATAAAGCTACATTCATGAGG - Intergenic
1172307260 20:33889432-33889454 AAAGCAGAGCTGCATTTAGGAGG - Intergenic
1172476721 20:35244176-35244198 AAACAAAAGCTATAGCTAGGAGG + Intronic
1172580386 20:36042791-36042813 AAAAAAAAGCCACATATAAGTGG - Intergenic
1173777691 20:45724525-45724547 AAAAAAAAACCACATTTGGGTGG + Intronic
1174876852 20:54235902-54235924 AAATGAAAGATAAATATAGGAGG - Intergenic
1175993318 20:62800636-62800658 AAATAAAAACTTCCTTTTGGAGG - Exonic
1176597649 21:8762051-8762073 AAATAATAGTCAAATTTAGGGGG + Intergenic
1176629785 21:9126582-9126604 AAATAATAGTCAAATTTAGGGGG - Intergenic
1176993769 21:15529579-15529601 AAAACAAAGCTATATTGAGGAGG + Intergenic
1177607773 21:23404179-23404201 TAATAAGAAGTACATTTAGGGGG - Intergenic
1177662822 21:24109233-24109255 ACATAAATGCTTCATTTAGATGG + Intergenic
1177861455 21:26459457-26459479 TAAAAAAAGCGACATTTATGTGG - Intergenic
1179230313 21:39498195-39498217 ACATAAAAGCTATTTTAAGGGGG - Intronic
1179293581 21:40041365-40041387 AAATAAAACCCATCTTTAGGTGG - Intronic
1180209900 21:46288858-46288880 AAATAAAAACAACAATTAGCCGG + Intronic
1180375960 22:12093886-12093908 TAAAAAAAGCTAGATTTAGAAGG - Intergenic
1180376783 22:12100950-12100972 AAATAATAGTCAAATTTAGGGGG + Intergenic
1182032729 22:27172406-27172428 AAAGAAAAGATACATTTTTGAGG - Intergenic
1182465179 22:30511219-30511241 AAATAAAAGCTTCTCTTGGGAGG - Intergenic
1183249047 22:36715649-36715671 AAATAAAATCTCCAGTTAGAAGG - Intergenic
1183254305 22:36752380-36752402 ATATAAAACCTACTTTTAGAAGG - Intergenic
1183826280 22:40390300-40390322 AAATAAAGGCTACATGTTGGGGG - Intronic
949303321 3:2609949-2609971 AGATAAAAGCTACTTTTATTTGG - Intronic
950419795 3:12892195-12892217 TAATAAAAGATACTTTTAGGTGG + Intergenic
950913532 3:16619213-16619235 CAATAAAGGCTCCATTTAGTAGG + Intronic
951812093 3:26712113-26712135 AAATAAAACCATCATGTAGGAGG - Intergenic
951820271 3:26800929-26800951 AAATAAAAGGTATGTTTTGGTGG - Intergenic
951995710 3:28725946-28725968 AAACAAATGCTACAGTTAAGAGG - Intergenic
952215279 3:31272103-31272125 AAATAAGGGCCACATTTGGGAGG - Intergenic
952326915 3:32328557-32328579 AAAAAAAAGCAACACTTAGTTGG + Intronic
952591694 3:34962977-34962999 AAATAAAAGGAACAATGAGGTGG - Intergenic
953348260 3:42194392-42194414 AAAAAAAAGCAAAAATTAGGTGG - Intronic
953584071 3:44184272-44184294 AAATAAAAGCTATTTTGAGGTGG - Intergenic
954359314 3:50110897-50110919 ATATAAAAATTACATTTTGGTGG - Intronic
954543906 3:51416459-51416481 AAATATACGGTAAATTTAGGTGG - Intronic
954893639 3:53956383-53956405 AATGAAAAGATACATTTGGGGGG - Intergenic
955678086 3:61470537-61470559 ATATAAAAGTTATATCTAGGTGG + Intergenic
957096552 3:75782161-75782183 AAATAATAGTCAAATTTAGGGGG - Intronic
957361286 3:79162364-79162386 AACTGAAAGCTAAATTAAGGTGG + Intronic
957381731 3:79439533-79439555 AAATAAATGTTACTTTTAGAAGG - Intronic
957411273 3:79843979-79844001 AAATGAAAGCTACATTTCTCTGG - Intergenic
957805062 3:85136275-85136297 AAATAAAAGCTACATTTAGGAGG - Intronic
957992075 3:87639004-87639026 AAATAAAAGCAAAATATTGGTGG - Intergenic
958619462 3:96538141-96538163 AAATAAACCCTACCTTTACGTGG + Intergenic
959014432 3:101117327-101117349 AAATATTACATACATTTAGGGGG + Intergenic
960287209 3:115843164-115843186 ACATAAAAGCTAAATTTACCTGG - Intronic
960339115 3:116453754-116453776 AAAAAAAAGCTAGATTCAGAGGG + Intronic
960388908 3:117052693-117052715 AAATAGAATCTACATTTTGATGG + Intronic
960643409 3:119851339-119851361 AAATGAAACCTACATCTAGTTGG + Intronic
960660188 3:120049658-120049680 AAATAAAAGATTCATATGGGGGG + Intronic
961075758 3:123980185-123980207 ACATAAATGCTACATCTAGCTGG - Intronic
964065875 3:152578288-152578310 AACTAAAAGCCACTTTTATGTGG + Intergenic
964131303 3:153290450-153290472 AAAGAAAACCTTCATGTAGGAGG + Intergenic
965094087 3:164200461-164200483 AAATAAAAGCTAAAAGTAGGTGG + Intergenic
966645032 3:182236233-182236255 AAATAAAAGCCTCAGTTGGGTGG + Intergenic
966671235 3:182528480-182528502 AAATAAATGCTAAATTTCTGAGG - Intergenic
967022238 3:185532866-185532888 TGATTAAAACTACATTTAGGAGG - Intronic
967376602 3:188810493-188810515 TAATAAAAGTTACATGTATGTGG - Intronic
967691138 3:192475013-192475035 AAAGAAGAGCTACATTAATGAGG - Intronic
968337072 3:197922973-197922995 AAATATAAGCTACATGCAGAGGG + Intronic
970113953 4:12671621-12671643 AAAAAAAATGTGCATTTAGGTGG + Intergenic
970428229 4:15964786-15964808 AAAAAAAACCTACCTTTAGCTGG - Intronic
971334191 4:25707530-25707552 AAATAAAACCTAGATAAAGGTGG - Intergenic
971348761 4:25837393-25837415 AAAAAAAAGCTTCATAAAGGAGG + Intronic
971819798 4:31537402-31537424 ACATAAAAGATACAATTTGGTGG - Intergenic
972431987 4:38991739-38991761 AAATATAAAATACAGTTAGGTGG + Intronic
973233784 4:47873371-47873393 AAATAAATGCCAGATGTAGGTGG - Intronic
973323771 4:48836380-48836402 GAATAAAAGGTTCATTTAGAAGG + Intronic
973360952 4:49164305-49164327 AAATAATAGTCAAATTTAGGGGG + Intergenic
974119975 4:57626537-57626559 AAATAAAAAAGACATATAGGTGG + Intergenic
974468217 4:62285287-62285309 AAATAAAAGCTATACTGAGATGG - Intergenic
974629094 4:64459723-64459745 AAATGACACCTACATTTAGGTGG + Intergenic
976026553 4:80694888-80694910 AAATAAAAGCCTCATTTACATGG + Intronic
976925024 4:90485524-90485546 AAATAAAAGTTAAATTGGGGGGG - Intronic
977746356 4:100552313-100552335 AAATAAAATCTAGATTCAGATGG - Intronic
978066777 4:104414434-104414456 TGATAAAAGCTACACTGAGGAGG + Intergenic
978142097 4:105329667-105329689 AAATAAAAGCTAGTTTGAGAAGG - Intergenic
979662173 4:123269753-123269775 AAAGAAAAGATGCATTAAGGGGG - Intronic
979694755 4:123600300-123600322 AAATAAAAGGTTCATTTAGCTGG - Intergenic
980234970 4:130093028-130093050 AAATAAAAGCTGCCTTTGGGTGG - Intergenic
980804262 4:137791435-137791457 AAATAAAAAATTCAATTAGGTGG + Intergenic
980962315 4:139487601-139487623 AAAACAAAGCTGCATTTGGGAGG + Intergenic
981050287 4:140303141-140303163 AAAAAAAAGCTTTCTTTAGGGGG + Intronic
981224171 4:142272167-142272189 AAAAAAAAGCAGCATTTAGAAGG - Intronic
981362122 4:143859204-143859226 AAATAAAAACTACATGTGAGGGG - Intergenic
981372858 4:143980041-143980063 AAATAAAAACTACATGTGAGGGG - Intergenic
981381947 4:144083281-144083303 AAATAAAAACTACATGTGAGGGG - Intergenic
981497035 4:145405463-145405485 AAATCAAAACAACATTTTGGTGG - Intergenic
981771584 4:148316434-148316456 AAATCAAAGCTACCTTTACCTGG - Intronic
982599831 4:157434192-157434214 AAATAAAAAATAAATTTAGTTGG + Intergenic
982834112 4:160101739-160101761 ATTTAAAAGCTACTTTTAAGTGG - Intergenic
983565055 4:169141798-169141820 AAAAAAAAGCAAAAATTAGGCGG - Intronic
984371558 4:178872799-178872821 AAATAAATTCTAAAATTAGGTGG + Intergenic
985148561 4:186920832-186920854 AAATAAAAGGCACATTTTGTTGG + Intergenic
1202757557 4_GL000008v2_random:79327-79349 AAAAAAAAGCTAGATTTAGAAGG - Intergenic
1202758382 4_GL000008v2_random:86383-86405 AAATAATAGTCAAATTTAGGGGG + Intergenic
986144126 5:5061140-5061162 AAATAAAACCTACATCTACTTGG + Intergenic
986482278 5:8201880-8201902 AATTATAAGCTACATTTATGAGG - Intergenic
986639581 5:9858896-9858918 AAATAAAAGCAAGAATTAGTAGG + Intergenic
986810461 5:11353126-11353148 AAATAAATGCTACATGTATTTGG + Intronic
986828264 5:11545373-11545395 ATAGAAAAGCTACATTTGGCTGG + Intronic
987639037 5:20587801-20587823 AAATTAAAGATACATTTAAGTGG + Intergenic
987871964 5:23631105-23631127 AAATAAAAGCTTCACATGGGTGG - Intergenic
988095868 5:26609279-26609301 AAATAAAAGCTCCATTAGGATGG + Intergenic
989668401 5:43884563-43884585 AAATCTAAGATAAATTTAGGAGG - Intergenic
990020320 5:51118577-51118599 AAATCAAAACCACATTGAGGTGG + Intergenic
990146150 5:52762528-52762550 AAATATAAGCTCCATTAAGATGG + Intergenic
990554862 5:56922630-56922652 AAAAAAATGCTACATTGAGCAGG + Exonic
990660319 5:58006988-58007010 AAAAAAAAGCTATATTTGGCAGG + Intergenic
991345766 5:65665979-65666001 AAATGAAAGCTATATTCAGAAGG + Exonic
991571574 5:68059913-68059935 AAATAAAAACTTTATTTGGGAGG - Intergenic
992983698 5:82204697-82204719 AAAAAGAAGCTACATTTAAGAGG + Intronic
993282623 5:85946074-85946096 AAATAAAAAATAAAGTTAGGTGG + Intergenic
993435515 5:87888227-87888249 AAAAAAAAGCAACAAGTAGGAGG - Intergenic
993746772 5:91609604-91609626 AAGTAATAGTTACATTTAGTTGG - Intergenic
994159551 5:96541462-96541484 AATTAAAAACATCATTTAGGAGG - Intronic
994254896 5:97580824-97580846 AAAGAAAAGGTACACTTATGAGG + Intergenic
994424522 5:99568068-99568090 AAATAAAAGCTACATTAAATGGG - Intergenic
994867905 5:105301378-105301400 TAATTAAAGCTACTTTCAGGTGG + Intergenic
995242609 5:109902105-109902127 AAATTCAAGATACATTTTGGAGG - Intergenic
995290408 5:110444632-110444654 AACTAAAAACAACATTTAAGGGG - Intronic
995631319 5:114135955-114135977 AAATAAGAGCTACATAAAGAAGG + Intergenic
996091743 5:119358085-119358107 AAAAAAAAGCTACGTATAAGAGG - Intronic
996296050 5:121918227-121918249 AATTTAAAACTACATTGAGGAGG + Intergenic
996588623 5:125120149-125120171 AATTGAAAGCTACAATTAGCTGG + Intergenic
997018555 5:129967472-129967494 AAATAAATGCCATATTTAGCAGG - Intronic
998145599 5:139726192-139726214 AAATAAAAGCAAAAATTAGCTGG + Intergenic
998492122 5:142556235-142556257 AAACAAAAGCCACACTTAGTAGG - Intergenic
998885105 5:146685895-146685917 ACATACAAGCTAGATTTTGGTGG - Intronic
998944671 5:147325574-147325596 AAATAAAAACTAAATGTAGAGGG - Intronic
999182377 5:149678997-149679019 AAATAAAGTGTACATTTAGAAGG + Intergenic
1000789564 5:165588807-165588829 AAATAAAAGAAACATTTAAAAGG + Intergenic
1002034101 5:176452731-176452753 AAATTAAAGCCAGATTTTGGAGG + Intronic
1002555163 5:180031490-180031512 AAAAAAAAGTTAAATTTGGGGGG + Intronic
1004121402 6:12825919-12825941 AAAGAAAAGAAACATTTAGGAGG + Intronic
1004438805 6:15626229-15626251 TAATAAAAGCTACTTTTGTGGGG + Intronic
1005669365 6:28089651-28089673 CCAAAAGAGCTACATTTAGGGGG + Intergenic
1006757303 6:36427382-36427404 GAATAGAAGGTAGATTTAGGAGG - Intronic
1007954242 6:45901912-45901934 GGGTAAAAGCCACATTTAGGAGG - Exonic
1008011552 6:46473014-46473036 AATTAAAAACTACATTTATCTGG - Intronic
1008133645 6:47747071-47747093 AAATAGAAGCTACTTTTAGGAGG - Intergenic
1008703831 6:54133369-54133391 CAATAATAGCTAAGTTTAGGAGG + Intronic
1009279877 6:61735116-61735138 AAACAAAAGCTACAGTGAGTAGG - Intronic
1009321848 6:62300808-62300830 AAATTAAAGATATATTTTGGAGG + Intergenic
1010138930 6:72589857-72589879 AAATAAAACATCAATTTAGGTGG + Intergenic
1010923519 6:81714490-81714512 AAATAAAAACTATTTTGAGGTGG + Intronic
1013550712 6:111205103-111205125 AGATTAAAGCCATATTTAGGAGG + Intronic
1014338933 6:120177819-120177841 AAAGAAAAGCTGCATTTTTGTGG + Intergenic
1014941892 6:127450537-127450559 ACATAAAGGCTACTTTTAGTAGG + Intronic
1015012647 6:128370055-128370077 AAATGAAAGCTGCATTTCAGAGG + Intronic
1015042751 6:128741709-128741731 AAATAATACCTACATTTAAGTGG - Intergenic
1016040290 6:139425791-139425813 AAAATAAAGCTACAGTTTGGAGG + Intergenic
1016724274 6:147343110-147343132 AAATAATAGCTTCATTTATTGGG + Intronic
1016731198 6:147430133-147430155 AAATAAAACCTGCATTTCAGTGG - Intergenic
1018038673 6:159903156-159903178 AAATAGGAGCTACATATCGGAGG - Intergenic
1018500336 6:164402894-164402916 AACTTAAAGCTACATTTATTAGG + Intergenic
1018541012 6:164879100-164879122 AAATAACAGCTACAATCATGTGG + Intergenic
1020200967 7:6079703-6079725 AAATAAAATCTACCATTAGGGGG - Intergenic
1020689827 7:11340209-11340231 AAATTAAAGCCACATATATGAGG + Intergenic
1020828891 7:13067836-13067858 ACAGAGAAGCTACATTTTGGAGG + Intergenic
1021143958 7:17062494-17062516 AAAGCAGAGCTACATTCAGGAGG - Intergenic
1021364455 7:19759407-19759429 AACTAAAAGCTTTATTTCGGTGG + Intronic
1021447022 7:20744599-20744621 AAATATAAGCTACATCCATGGGG + Intronic
1021658808 7:22898196-22898218 AAATAAAAGCAAAAATTAGCTGG - Intergenic
1021893544 7:25211857-25211879 AAAAAAAAGATATATTTTGGAGG - Intergenic
1021952863 7:25792281-25792303 ACAGAAAAGCTAAATTTTGGGGG - Intergenic
1022858809 7:34343684-34343706 AAATAAAACCTCTATTTAGGAGG + Intergenic
1023102640 7:36734646-36734668 AAATTAACTCTACATTTTGGAGG - Intergenic
1023202180 7:37710655-37710677 AAATAAATGGTACTTTTAGTGGG + Intronic
1023641787 7:42266333-42266355 AAAAAAAAGCAACATTGAGAGGG - Intergenic
1024444799 7:49464867-49464889 AAAGAAAAGCTACGTTTACTTGG - Intergenic
1024864312 7:53887120-53887142 GGATAAAAGTTATATTTAGGTGG + Intergenic
1025070182 7:55891297-55891319 AAATAAAAATTACATTTTGCAGG - Intronic
1025070221 7:55891739-55891761 AAATAAAAATTACATTTTGCAGG - Intronic
1026356899 7:69565747-69565769 AAATAAAAGATATATTTGGCTGG - Intergenic
1027705223 7:81523856-81523878 ATCTAAGAGCTACATTTATGCGG - Intergenic
1027709904 7:81587084-81587106 AATAAGAAGCTATATTTAGGTGG - Intergenic
1028369831 7:90078663-90078685 AAATACAAGCTAAATTTAAGAGG + Intergenic
1028474910 7:91242555-91242577 AATTACAATCTGCATTTAGGCGG + Intergenic
1028568724 7:92262176-92262198 ATATAACAGTTACATTTAGGAGG - Intronic
1030014980 7:105210148-105210170 AAATAAACTCTACATTTAGTAGG + Intronic
1030436821 7:109532312-109532334 AAATCAAGCCTTCATTTAGGAGG - Intergenic
1030654631 7:112153296-112153318 ATTTAAAAACTACATTTAAGTGG + Intronic
1030950220 7:115781486-115781508 AAATAAAAGGTATGTTTAGGGGG + Intergenic
1031490940 7:122387414-122387436 AACAAAAAGCTTCATTTGGGTGG - Intronic
1031864290 7:127020887-127020909 AAATTAAAGCTCCTTTTAAGTGG + Intronic
1032182567 7:129692917-129692939 AGAAGAAAGCTTCATTTAGGTGG - Intronic
1032244663 7:130199721-130199743 AAATAAAAATTATATTTTGGTGG + Intronic
1035297330 7:157874509-157874531 AAATAAAAGCTCGAGTTAAGGGG - Intronic
1035345926 7:158198156-158198178 AATTTAAAGATACATTTATGAGG - Intronic
1035687715 8:1537857-1537879 AAAAGAGAGCTAAATTTAGGTGG + Intronic
1035839125 8:2791812-2791834 AAGTAACAGCAACATTTAGTTGG - Intergenic
1036709538 8:11069247-11069269 AAAAAAAATCTACATTTGGAGGG + Intronic
1037679548 8:21084563-21084585 AAAGAAAAGCTACACATGGGGGG - Intergenic
1038171128 8:25133291-25133313 AAAAAAAAGATACATTGATGGGG + Intergenic
1039036168 8:33361532-33361554 AAATAAAAGCTTCCTTGAAGTGG + Intergenic
1039409789 8:37343081-37343103 AAATAAAAGGTACATTAAGGCGG - Intergenic
1040853668 8:51926977-51926999 AAATAAAACCTAAATTTGTGTGG - Intergenic
1040879834 8:52192677-52192699 ACAAAAAAGGTACAGTTAGGAGG + Intronic
1040895495 8:52364204-52364226 AAATAAGAAATACATATAGGAGG - Intronic
1041083020 8:54231336-54231358 AAATAACAGCTACATGAAGGGGG - Intergenic
1041476715 8:58275528-58275550 AAATAAAAGCTATGTCTTGGTGG + Intergenic
1041627197 8:60043905-60043927 ACATAAAAGGTACATTAAAGAGG - Intergenic
1042584473 8:70319564-70319586 AAATAAAAGCTCTATTTAGCTGG + Intronic
1043075353 8:75692092-75692114 AAAAAAAATCTATATTTATGTGG - Intergenic
1043681940 8:83039272-83039294 AAATAAAAACTACATTAAAATGG - Intergenic
1044024752 8:87154931-87154953 ATATGAAAGGTAAATTTAGGAGG + Intronic
1044161783 8:88927250-88927272 AAATATAAAGTACATTTATGGGG + Intergenic
1044299617 8:90568368-90568390 AAATCAAAGAAACATTTGGGAGG - Intergenic
1044362102 8:91298229-91298251 AAATACAAGCTACACTTTAGTGG - Intronic
1044362192 8:91299998-91300020 AAATACAAGCTACACTTCAGGGG + Intronic
1044577213 8:93782937-93782959 ACATAAAAGCTTAATTTAAGTGG + Intronic
1044963256 8:97551859-97551881 AAAAAAAAGACACACTTAGGGGG - Intergenic
1045247494 8:100456139-100456161 AAACAAAAGCTACACTGAGCAGG - Intergenic
1045714144 8:105021886-105021908 AAATCAAAGCAAAATTTAAGTGG - Intronic
1046544587 8:115633462-115633484 AAAGACAAGCTACATAAAGGTGG + Intronic
1046672255 8:117068990-117069012 AAATTCAAGATACATTTTGGAGG - Intronic
1047399402 8:124533268-124533290 AAATGGTAGCTACATTAAGGAGG + Intronic
1048552339 8:135445167-135445189 AAATAAAAGCTATTTGTAAGAGG + Intergenic
1048926324 8:139275820-139275842 AAATAAATCCTAAATCTAGGAGG + Intergenic
1051087389 9:13365759-13365781 AAAGAAAGGCTATATTTTGGTGG + Intergenic
1052086593 9:24274613-24274635 AAAAAAAATCTACATATAAGTGG - Intergenic
1052400109 9:27989333-27989355 AAATATAAGATACATTCAGATGG + Intronic
1054724021 9:68632369-68632391 AAATTAAAGCTGCCTTTTGGTGG - Intergenic
1055015342 9:71611020-71611042 AAATAAAAGCTGTATTGACGAGG + Intergenic
1055341546 9:75289663-75289685 AAATTAAATCAACATTTTGGTGG - Intergenic
1055746803 9:79456157-79456179 AAATAAGAGATACAAATAGGTGG - Intergenic
1055871703 9:80888327-80888349 ACATACAAGCTATATTTAGAAGG + Intergenic
1056132326 9:83598833-83598855 AAATAAAAGCCACAATTATCTGG - Intergenic
1056168147 9:83958058-83958080 AAAAAAAAGCTCCATTTGGGAGG - Intergenic
1056878412 9:90362635-90362657 AAAAAAAAGATACATCTATGTGG - Intergenic
1057124659 9:92607440-92607462 AGCTAAAGGGTACATTTAGGGGG + Intronic
1059626420 9:116071946-116071968 ACATAAGAGCTACCTTAAGGAGG - Intergenic
1060434187 9:123579573-123579595 AAATAAAAGCTTAGATTAGGTGG + Intronic
1060561320 9:124546396-124546418 AAACATAAGATACTTTTAGGTGG + Intronic
1061517889 9:131100022-131100044 AACAAAAAGCTAAATTTGGGCGG - Intronic
1061606923 9:131717774-131717796 AAAAAAAGGCTACATTTAAAGGG + Intronic
1203689989 Un_GL000214v1:33394-33416 AAATAATAGTCAAATTTAGGGGG + Intergenic
1203752619 Un_GL000218v1:94267-94289 AAATAATAGTCAAATTTAGGGGG - Intergenic
1203538348 Un_KI270743v1:64190-64212 TAAAAAAAGCTAGATTTAGAAGG - Intergenic
1203539172 Un_KI270743v1:71255-71277 AAATAATAGTCAAATTTAGGGGG + Intergenic
1203646286 Un_KI270751v1:70659-70681 AAATAATAGTCAAATTTAGGGGG - Intergenic
1186100170 X:6147356-6147378 AAATAAAAGACACATTTTGAAGG - Intronic
1186840665 X:13481733-13481755 AAATAAAAAATACAGTTAGAAGG + Intergenic
1186862431 X:13686719-13686741 AAAAAAAAGCTACAAGTAAGTGG - Intergenic
1187416033 X:19094348-19094370 AAAAAAAAAATAGATTTAGGAGG - Intronic
1187855698 X:23634547-23634569 AAAAAAAAGCTATATGGAGGTGG - Intergenic
1187874042 X:23788962-23788984 AAATAAAATTTACACTTAAGGGG - Intergenic
1188699858 X:33245487-33245509 AAATAAAAGGAAAATTTAGAAGG + Intronic
1189422189 X:40866149-40866171 AAATATGAGAGACATTTAGGAGG - Intergenic
1189948095 X:46200987-46201009 ACATAAAAAGGACATTTAGGAGG + Intergenic
1190490280 X:50975468-50975490 ATTTAAAAGGTACAATTAGGTGG + Intergenic
1190626082 X:52340081-52340103 AGATAGAAGCTGCATTTAAGTGG + Intergenic
1190794749 X:53730590-53730612 ACATAAAAGCTGCATTTTCGGGG - Intergenic
1190819370 X:53959276-53959298 AAGTAAAAGGTACATTTATAGGG - Intronic
1192986463 X:76405187-76405209 AAATAAAAGCATCATTTTGGGGG - Intergenic
1193211793 X:78815387-78815409 AAATAAATGATACATTTTTGAGG + Intergenic
1193278924 X:79625186-79625208 TTACAAAAGCTACATTTAGCAGG + Intergenic
1193734430 X:85140006-85140028 TAATAGCAGTTACATTTAGGAGG - Intergenic
1194191863 X:90847565-90847587 AAATGAAAGACACACTTAGGGGG - Intergenic
1194735441 X:97507477-97507499 GAATAAAAGTTACATTAAGATGG - Intronic
1194876643 X:99197754-99197776 AAATAAAAGGAAAATGTAGGAGG - Intergenic
1195071834 X:101288884-101288906 AAATGAAAGTTGCAGTTAGGGGG - Intronic
1195406368 X:104518437-104518459 AAATAAAAACAAAATTTAGCCGG - Intergenic
1195583787 X:106538554-106538576 AAATCAAAGCTACAAAAAGGAGG + Intergenic
1195616491 X:106916582-106916604 ACAAAAAAGCTAAATTTTGGAGG + Intronic
1196393741 X:115237062-115237084 AACTAAATGCTAACTTTAGGGGG + Intergenic
1197507345 X:127322532-127322554 AAAAAAAAGCTTCAATTATGAGG - Intergenic
1198033115 X:132774669-132774691 AAAAAAAAGCTACTTTGAAGGGG - Intronic
1198856711 X:141025362-141025384 AAACAAAACCTAAATTTAGTAGG + Intergenic
1198905982 X:141562005-141562027 AAACAAAACCTAAATTTAGTAGG - Intergenic
1199473618 X:148222096-148222118 AAATAAAACCAATATTTTGGTGG - Intergenic
1199583525 X:149386177-149386199 AAGTAAAAGTAACATTTAGTAGG - Intergenic
1200052123 X:153439417-153439439 CAAAAAAATCTACATTTAGAGGG + Intergenic
1200538502 Y:4430000-4430022 AAATGAAAGACACACTTAGGGGG - Intergenic