ID: 957810123

View in Genome Browser
Species Human (GRCh38)
Location 3:85211104-85211126
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2868
Summary {0: 2, 1: 12, 2: 175, 3: 515, 4: 2164}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957810123 Original CRISPR CTGATAACACAGAAATTAAA AGG (reversed) Intronic
Too many off-targets to display for this crispr