ID: 957810497

View in Genome Browser
Species Human (GRCh38)
Location 3:85215203-85215225
Sequence AAGAGAGCCCACTGCCTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1622
Summary {0: 1, 1: 29, 2: 185, 3: 489, 4: 918}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957810497_957810504 19 Left 957810497 3:85215203-85215225 CCTTCAAGGCAGTGGGCTCTCTT 0: 1
1: 29
2: 185
3: 489
4: 918
Right 957810504 3:85215245-85215267 GAAATGCCCTCTGGGAACTAGGG 0: 1
1: 1
2: 26
3: 176
4: 505
957810497_957810502 11 Left 957810497 3:85215203-85215225 CCTTCAAGGCAGTGGGCTCTCTT 0: 1
1: 29
2: 185
3: 489
4: 918
Right 957810502 3:85215237-85215259 CATGTCTAGAAATGCCCTCTGGG 0: 1
1: 1
2: 12
3: 96
4: 482
957810497_957810501 10 Left 957810497 3:85215203-85215225 CCTTCAAGGCAGTGGGCTCTCTT 0: 1
1: 29
2: 185
3: 489
4: 918
Right 957810501 3:85215236-85215258 GCATGTCTAGAAATGCCCTCTGG 0: 1
1: 0
2: 10
3: 65
4: 350
957810497_957810503 18 Left 957810497 3:85215203-85215225 CCTTCAAGGCAGTGGGCTCTCTT 0: 1
1: 29
2: 185
3: 489
4: 918
Right 957810503 3:85215244-85215266 AGAAATGCCCTCTGGGAACTAGG 0: 1
1: 3
2: 28
3: 195
4: 564
957810497_957810505 24 Left 957810497 3:85215203-85215225 CCTTCAAGGCAGTGGGCTCTCTT 0: 1
1: 29
2: 185
3: 489
4: 918
Right 957810505 3:85215250-85215272 GCCCTCTGGGAACTAGGGTCTGG 0: 1
1: 0
2: 3
3: 53
4: 359
957810497_957810508 30 Left 957810497 3:85215203-85215225 CCTTCAAGGCAGTGGGCTCTCTT 0: 1
1: 29
2: 185
3: 489
4: 918
Right 957810508 3:85215256-85215278 TGGGAACTAGGGTCTGGAATAGG 0: 1
1: 14
2: 104
3: 267
4: 577

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957810497 Original CRISPR AAGAGAGCCCACTGCCTTGA AGG (reversed) Intronic
900966388 1:5961710-5961732 AGAAGAGCCCAGTGCCTTCAAGG + Intronic
902143786 1:14379500-14379522 AGGAGAGACCACTGTCCTGAAGG + Intergenic
903452830 1:23466211-23466233 CAGGGAGCTCACTGCCTTCAGGG - Intronic
905739903 1:40361245-40361267 AAGGGAACCCACTGCCTTGAAGG + Intronic
905739967 1:40361587-40361609 AGGGGAGCCCACTGCCCTGAAGG + Intronic
906906042 1:49893480-49893502 AAGGTAGCCCACTGCCCTAAAGG + Intronic
907023718 1:51094780-51094802 AAGGGAACCCACTTCCTGGAAGG + Intergenic
907023788 1:51095139-51095161 AGGGGAGCCCATTGCCCTGAAGG + Intergenic
907261615 1:53222471-53222493 AAGGGAACCCGCTGCTTTGAAGG + Intergenic
907605028 1:55807423-55807445 AAGAGAACCAGCTGCCTTGAAGG + Intergenic
908093113 1:60707198-60707220 AAGGGAACCCACTGTCCTGAAGG + Intergenic
908397615 1:63740682-63740704 AAGGGAACCCAGTGCCTTGAAGG - Intergenic
908598971 1:65718692-65718714 ATGGGAGCCCACTGCCCTGAAGG - Intergenic
908908016 1:69038453-69038475 TGGGGAGCCCACTGCCCTGAAGG + Intergenic
909128523 1:71706751-71706773 AAGGAAACCCACTGCCTTAAAGG + Intronic
909182288 1:72439670-72439692 ACAAGAGCCCACTGCCTTAAAGG - Intergenic
909383987 1:75035244-75035266 AAGGGAGCCCACTGTTCTGAAGG + Intergenic
909438655 1:75673210-75673232 AGGGGAGCCCACTGCCCTGAAGG + Intergenic
909486138 1:76176262-76176284 ATGAAAGCCCACTGCCCAGACGG + Intronic
909615663 1:77605739-77605761 AAAGGAACCCACTGCCTTGAAGG + Intronic
909667684 1:78153929-78153951 AGCAGGGCCCACTGCCCTGAAGG - Intergenic
909674278 1:78221812-78221834 AAGAGTGGCCAATGCTTTGAAGG + Intergenic
909815083 1:79982591-79982613 AAAAAAGCTCACTGCCTTAATGG - Intergenic
909848836 1:80434306-80434328 AAGGGAACCCACTACATTGAAGG - Intergenic
909903058 1:81161481-81161503 AAGGGAACCTGCTGCCTTGAAGG + Intergenic
910229847 1:84974539-84974561 AAGGGAACCTACTGCCTTGAAGG + Intronic
910229895 1:84974794-84974816 AAGGGAGCCCACTGCCCTGAAGG + Intronic
910349335 1:86277772-86277794 AAGGGAACCTGCTGCCTTGAAGG - Intergenic
910379248 1:86608667-86608689 AAGAGAGCCCATTTCCCTAAAGG - Intergenic
910384380 1:86665276-86665298 AGGGGAGCCCACTGCCCTGAAGG + Intergenic
910470393 1:87546847-87546869 AAGGGAGCCCACTGACCTGAAGG - Intergenic
910515363 1:88054317-88054339 AAGGGAGCCCACTGCCCTGAAGG - Intergenic
910547313 1:88432891-88432913 AAGGGAACCTGCTGCCTTGAAGG + Intergenic
910547371 1:88433257-88433279 AGAGGAGCCCACTGCCCTGAAGG + Intergenic
910560235 1:88582182-88582204 AAGGGAACCCATTGCCTTGAAGG + Intergenic
910643497 1:89489447-89489469 AAGAGAACCTACTGCCTGAAAGG + Intergenic
910716371 1:90235846-90235868 AAGAGAGCTTACTGCCCTCAAGG - Intergenic
911019817 1:93375190-93375212 AAAGGAACCCTCTGCCTTGAAGG + Intergenic
911019880 1:93375548-93375570 AGGGGAGTCCACTGCCCTGAAGG + Intergenic
911343973 1:96674230-96674252 AGGGGAGCTCACTGCCCTGAAGG - Intergenic
911344029 1:96674591-96674613 AAGGGAACTCACGGCCTTGAAGG - Intergenic
911496480 1:98637707-98637729 AAGAGAGCCTGCTGTCTTGAAGG + Intergenic
911496518 1:98637963-98637985 AGGGGAGCCCACTGTCCTGAAGG + Intergenic
911536382 1:99105696-99105718 AAGCGAACCCAGTGCCTTAAAGG + Intergenic
911939136 1:104019590-104019612 AAGAGAACCTGCTGCCTGGAAGG - Intergenic
911942773 1:104068940-104068962 AATAGAACCCTCTGCCTTGAAGG - Intergenic
911960909 1:104301452-104301474 AAGGGAACCAGCTGCCTTGAAGG + Intergenic
911988077 1:104657197-104657219 AAGAGAACTCACTGCTTTGAAGG - Intergenic
912036678 1:105324991-105325013 AAGAGAACCCACTGCCTGGAGGG - Intergenic
912059026 1:105641494-105641516 AGGGGAGCCCACTGCCCTGAAGG + Intergenic
912070751 1:105806596-105806618 AAGGAAACCCACTGCCTTAAAGG + Intergenic
912070803 1:105806953-105806975 AGGGGATCCCACTGCCCTGAAGG + Intergenic
912152727 1:106879995-106880017 AAGGGAACCCACAGCCTTGAAGG + Intergenic
912316384 1:108670810-108670832 AAGGGAACCCACTGCCTTGAAGG + Intergenic
912598517 1:110903527-110903549 AAGGGAATCCATTGCCTTGAAGG + Intergenic
912598573 1:110903886-110903908 AAGGGAGCCCACTGCCCTGAAGG + Intergenic
912601099 1:110934094-110934116 AAGGGAACCTGCTGCCTTGAAGG + Intergenic
912601151 1:110934452-110934474 AAGGGAGCCCCCTGCCATTAAGG + Intergenic
912616812 1:111110200-111110222 AAGAGAATCTACTGCCCTGATGG - Intergenic
912633292 1:111267759-111267781 AAGGGAGCCTGCTGACTTGAAGG - Intergenic
912873162 1:113328317-113328339 AAGGGAACCTGCTGCCTTGAAGG - Intergenic
912899245 1:113630343-113630365 AGGAGAGCCCACTGTCCTGAAGG - Intronic
915005317 1:152630034-152630056 AAAGGAACCCACTGCCTTGAAGG + Intergenic
915479081 1:156172952-156172974 GAGACAGCCCAGGGCCTTGATGG + Exonic
915640851 1:157224869-157224891 AAGAGAGACCCCTGCCTGGCTGG - Intergenic
915810904 1:158909717-158909739 AGGGGAGCCCACTGCTATGAAGG + Intergenic
915856860 1:159397508-159397530 AGGGGAGCCCACTACCCTGAAGG + Intergenic
915917431 1:159949384-159949406 AAGAGACACCTCTGCCTTCAAGG - Intergenic
916321844 1:163513103-163513125 ACGGAAGACCACTGCCTTGAAGG + Intergenic
916533460 1:165680486-165680508 AAGTGTGCCCACTGGCATGAAGG - Exonic
917061736 1:171048890-171048912 AAGGGAACCCACTGCCTTGAAGG - Intronic
917191392 1:172422743-172422765 AGAGGAGCCCACTGCCCTGAAGG + Intronic
917226381 1:172788366-172788388 AGGGGAGCCCACTGCTCTGAAGG - Intergenic
917226433 1:172788725-172788747 AAGGGAACTGACTGCCTTGAAGG - Intergenic
917306211 1:173628029-173628051 AAGGGAACCAGCTGCCTTGAAGG + Intronic
917306280 1:173628391-173628413 AGGAGAGCCCACTGCCCTGAAGG + Intronic
917373118 1:174317388-174317410 AAGGGAACCCACTGCCTTGAAGG - Intronic
917377466 1:174364871-174364893 AAAGGATCCCACTGCCTTGAGGG - Intronic
917583943 1:176405863-176405885 GACAGAGTCCACTGCCTTAAAGG - Intergenic
917986601 1:180326411-180326433 AGGGGAGCCCACTGCCCTGAAGG - Intronic
917986667 1:180326794-180326816 AAGGGAACCCACTGCCTTGAAGG - Intronic
918018768 1:180664382-180664404 AAGGGAACCAGCTGCCTTGAAGG - Intronic
918666247 1:187154733-187154755 AAGAGAACCCGCTGCCTTGAAGG - Intergenic
918752702 1:188292639-188292661 AGGGGAGCCCACTTCCCTGAAGG + Intergenic
918854170 1:189729542-189729564 AAGGGAATCCACTGCCCTGATGG - Intergenic
918989919 1:191685051-191685073 AGGGGAGCCCACTGCCCGGAAGG - Intergenic
919003158 1:191860599-191860621 AGGGGAGCCCACTGCCGTGAAGG + Intergenic
919067800 1:192714813-192714835 AAGGGAGCCCATTGCCCTGAAGG + Intergenic
919169783 1:193939085-193939107 AAAGGAACCCAATGCCTTGAAGG + Intergenic
919287615 1:195584959-195584981 AGGACAGCCCACTGCCCTGAAGG + Intergenic
919325306 1:196099754-196099776 AAGGAAACCCACTGCCTTGAAGG + Intergenic
919373638 1:196763697-196763719 AAGGGAACCCAATGCCCTGAAGG - Intergenic
919380077 1:196848374-196848396 AAGGGAACCCAATGCCCTGAAGG - Intronic
919478055 1:198053889-198053911 AGGGGAGCCCACTGCCCTGACGG - Intergenic
920060145 1:203221848-203221870 AAGTCTGCCCACTGTCTTGAAGG + Intronic
920953676 1:210598071-210598093 AAGGGAACCCACTGCTTTGAAGG - Intronic
920983620 1:210862920-210862942 CAGACAGCCCACTGGCTTCAGGG - Intronic
921042625 1:211448380-211448402 AGGGGAGCCCACTGCCATAAAGG + Intergenic
921634554 1:217477135-217477157 AAGGGAACCCACTGCCTTGAAGG + Intronic
921746273 1:218743644-218743666 AGGGGAGTCCACTTCCTTGAAGG + Intergenic
921769723 1:219022038-219022060 GAGGGAGCACACTGCCTTGAAGG + Intergenic
921769780 1:219022398-219022420 AAGGGAGCCCACTTCTCTGAAGG + Intergenic
921929345 1:220742425-220742447 AAGGGAGCCCAATGCCCTGAAGG - Intergenic
921929428 1:220743013-220743035 AAGGGAACCTGCTGCCTTGAAGG - Intergenic
921993967 1:221397016-221397038 AAGGAAACCCGCTGCCTTGAAGG + Intergenic
922044334 1:221928782-221928804 AAGGGAGCGCATTGCCCTGATGG + Intergenic
922320464 1:224482124-224482146 AGGGGAACCCACTGCCCTGAAGG - Intronic
922320518 1:224482482-224482504 AAGGGAGCCCGCTACCTTGAAGG - Intronic
922377111 1:224979894-224979916 AAGGGAACCCACTGCTGTGAAGG + Intronic
922377167 1:224980248-224980270 AGGAGAGCACACTGCCCTGAAGG + Intronic
922685297 1:227634129-227634151 AGGGAAACCCACTGCCTTGAAGG + Intronic
923629289 1:235639382-235639404 AACAGAGCCCCCAGCCTGGAAGG + Intronic
923886651 1:238164810-238164832 AAGAAAACCCATTGCCTTGAAGG - Intergenic
924516165 1:244768104-244768126 AGGGGAGCCCACTTCCATGAAGG - Intergenic
924648869 1:245904997-245905019 AAGGGAAGCCGCTGCCTTGAAGG + Intronic
924898833 1:248372995-248373017 AGGGGAGCCCACTGTCCTGAAGG - Intergenic
1064521676 10:16209521-16209543 AGGAGAGCCCACTGCCCTGAAGG - Intergenic
1064696773 10:17975150-17975172 AGGGGAGCCCACTGACCTGAAGG - Intronic
1065381566 10:25096263-25096285 AAGAGATCCTGCTGCCTTGAAGG - Intergenic
1065431480 10:25661509-25661531 AAGATAGACTGCTGCCTTGAAGG - Intergenic
1065467735 10:26043703-26043725 AAAGGAGCCCGCTGCCCTGAAGG - Intronic
1066142949 10:32526300-32526322 AGGGGAACCCACTGCCCTGAAGG - Intronic
1066148730 10:32591801-32591823 ATGGGAGCCCGCTGCCCTGAAGG - Intronic
1066649691 10:37642746-37642768 AGGGGAGCCCACTGCCCTGAAGG - Intergenic
1066649753 10:37643104-37643126 AAGGGAACCCACTGCCTTGAAGG - Intergenic
1067032579 10:42888292-42888314 AGGGGAGCCCACTGCCCTGAAGG - Intergenic
1067032642 10:42888652-42888674 AAAGGAACCCACTGCCTTGAAGG - Intergenic
1067039337 10:42940686-42940708 ACCAGAGCCCAAGGCCTTGATGG - Intergenic
1067470273 10:46532023-46532045 AACAGTACCAACTGCCTTGAGGG - Intergenic
1067977311 10:51041208-51041230 AAGGGAGCCCACTACCTGGAAGG - Intronic
1068103926 10:52590843-52590865 AGGGGAGCCCACTGCCCTGAAGG - Intergenic
1068392369 10:56414550-56414572 AGGGGAGCCCACTGCCCTGAAGG - Intergenic
1068478747 10:57562697-57562719 AGGGGAGCCCTCTGCCCTGAAGG - Intergenic
1068648868 10:59499653-59499675 AATGGTGCCCACAGCCTTGAGGG - Intergenic
1068809797 10:61242734-61242756 AAGAAAGCACAATGCCTTGTAGG - Intergenic
1069147863 10:64917948-64917970 AGAGGAGCCCACTGCCCTGAAGG + Intergenic
1069193487 10:65519765-65519787 AAGGGAACCTGCTGCCTTGAAGG - Intergenic
1069248832 10:66244007-66244029 AGGGGAGCCCACTGCCCTAAAGG + Intronic
1069343462 10:67439738-67439760 AAGGGAGCCTGCTACCTTGAAGG + Intronic
1069644187 10:69980172-69980194 CAGAGAGCCCACTGCATAGCTGG + Intergenic
1069933551 10:71899945-71899967 AGAGGAGCCCACTGCCCTGAAGG - Intergenic
1069933620 10:71900303-71900325 AAGAGAACCTGTTGCCTTGAAGG - Intergenic
1070059361 10:72967463-72967485 AGGGGAGCCCACTGCCCTGAAGG - Intergenic
1070059425 10:72967811-72967833 AAGGGAACCTGCTGCCTTGAAGG - Intergenic
1070337570 10:75468796-75468818 AAGAGAGGCCACAGGCTGGACGG - Intronic
1070464203 10:76703445-76703467 AAGAAAACCCACTGCCTTGAAGG + Intergenic
1070895425 10:79980024-79980046 AAGAAAACCCACTGCCCTCAAGG + Intronic
1070914987 10:80147847-80147869 AAGGGAACCCACTGCCTTGAAGG + Intergenic
1071197203 10:83175377-83175399 AGGGGAGCCCACTGCCCTGAAGG - Intergenic
1071209188 10:83317931-83317953 AGGGGAGCCCACTGCCCTGAAGG + Intergenic
1071211692 10:83348777-83348799 AAGGGAACCCACTGCTTTGAAGG + Intergenic
1071215296 10:83393888-83393910 AAGGGAACCCAATGCCTTGAAGG - Intergenic
1071869717 10:89780873-89780895 AGGGGAGCCCACTGCCTTCAAGG - Intergenic
1071896709 10:90075889-90075911 AAGGAAGCCCACTGCCCTGAAGG - Intergenic
1071935440 10:90525833-90525855 AGGAGAACTCACTGCCCTGAAGG - Intergenic
1071935553 10:90526501-90526523 AAGGGAACCTCCTGCCTTGAAGG - Intergenic
1072058807 10:91788283-91788305 AAGGGAACCCACTTCCCTGAAGG + Intergenic
1072083578 10:92056979-92057001 AAGGGAACCTGCTGCCTTGAAGG + Intronic
1072132349 10:92507710-92507732 GAGTGAGCTCACTGCTTTGAAGG - Intronic
1072492413 10:95920786-95920808 AAGAGAACCCACTGCCCTGAAGG - Intronic
1073042668 10:100618076-100618098 GAGAGAGGACAGTGCCTTGAGGG - Intergenic
1073708228 10:106010937-106010959 AAGGAAACCCACTACCTTGAAGG - Intergenic
1073737485 10:106366428-106366450 AAGAGAGCCCACTGTATCCAAGG + Intergenic
1073827081 10:107336589-107336611 AGGGGAGCCCACTGCCCTGAAGG - Intergenic
1073827141 10:107336941-107336963 AGGGGAACCCACTGCCTTGAAGG - Intergenic
1073905474 10:108274634-108274656 AGGGGAGCCCACTGCCCTGAAGG - Intergenic
1074226932 10:111493934-111493956 AAGGGAACCCACTGCCTTGAGGG - Intergenic
1074302133 10:112242362-112242384 AGGGGAGCCCACTGCCCTGAAGG - Intergenic
1074302203 10:112242725-112242747 AAGGGACTCCATTGCCTTGAAGG - Intergenic
1074638142 10:115344876-115344898 AAAGGAACCCACTGACTTGAAGG - Intronic
1074645280 10:115443340-115443362 AAGAGAGCCCACAGACTGAAAGG - Intronic
1074709972 10:116169142-116169164 AAGAGGGACCACTGTCTTTATGG + Intronic
1074803486 10:117025818-117025840 AAGGGAACCTGCTGCCTTGAAGG + Intronic
1075961405 10:126570346-126570368 TAGAGAGCACACTGGCTTGGTGG - Intronic
1076094637 10:127721104-127721126 AGGGGAGTCCACTGCCCTGAAGG + Intergenic
1076376791 10:129993720-129993742 AAGGGAACTCACTGCCTTGAAGG + Intergenic
1077427413 11:2489776-2489798 AAGGGAATCCACTGCCTTGGAGG + Intronic
1077562424 11:3272159-3272181 ACGAGAGGCCACCTCCTTGAAGG - Intergenic
1077568318 11:3317979-3318001 ACGAGAGGCCACCTCCTTGAAGG - Intergenic
1077740380 11:4839592-4839614 AAGGGAACCTGCTGCCTTGAAGG + Intronic
1077740439 11:4839933-4839955 AGGGGAGCCCACTGACCTGAAGG + Intronic
1077835517 11:5923607-5923629 AGGGGAGCCCCCTGCCCTGAAGG + Intronic
1077858887 11:6157729-6157751 AGGGGAGCCCACTACCCTGAAGG + Intergenic
1077970286 11:7181988-7182010 AGGGTAGCCCAATGCCTTGAAGG + Intergenic
1078244627 11:9563078-9563100 AAGGGAACCTGCTGCCTTGAAGG - Intergenic
1078690908 11:13579627-13579649 AGGAGAGCCCACTGCCCTGAAGG + Intergenic
1079069218 11:17328688-17328710 AGGGGAGCCCACTTCCCTGAAGG - Intronic
1079111059 11:17605462-17605484 AATAGAGGCAACTGCCCTGATGG - Intronic
1079183532 11:18215259-18215281 AGGAGACCCCACTGCTCTGAAGG + Intronic
1079272309 11:18999954-18999976 GAGAGAACCCACTTCCTTAAAGG - Intergenic
1079530526 11:21447160-21447182 AGGGGAGCCCACTGCTCTGAAGG - Intronic
1079565586 11:21878308-21878330 AAGAGAACCCACTTCCTTGAAGG + Intergenic
1079701687 11:23556167-23556189 AAGGGAGCCCAGTGCCCTAAAGG - Intergenic
1079729292 11:23920545-23920567 AGGGGAGCCCACTCCCTTGAAGG - Intergenic
1080489808 11:32750697-32750719 AGGGGAGCCCACTGTCCTGAAGG - Intronic
1082970232 11:59012705-59012727 AAGGGAGCCCACTGCCCTGAAGG + Intronic
1083071916 11:59993501-59993523 AAGGGAACCCACTGCTTTGAAGG - Intergenic
1083512752 11:63227027-63227049 ATGGGAGCCCACTGCCCTAAAGG - Intronic
1084721023 11:70905684-70905706 ATGAGGGCCCACTTCCTGGATGG - Intronic
1084763821 11:71294559-71294581 GGGGGAGCCCACTGCCTTGAAGG - Intergenic
1085572151 11:77568970-77568992 AAGGGAACCAACTGCCTTAAAGG - Intronic
1086007026 11:82048971-82048993 AAGACAGCCCACTGTCCTGAAGG + Intergenic
1086033060 11:82383751-82383773 AAGAGAACCTGCAGCCTTGAAGG + Intergenic
1086468224 11:87076776-87076798 AAGGGAACCTGCTGCCTTGAAGG - Intronic
1086524642 11:87711213-87711235 ATGGGAGCCTACTGCCCTGAAGG + Intergenic
1086828402 11:91528047-91528069 AAAAGAAACCACTGACTTGAAGG + Intergenic
1087031992 11:93715369-93715391 GAGGAAGCCCACTGCCCTGAAGG - Intronic
1087032055 11:93715726-93715748 AAGAGAACCTGCTGCCTTCAAGG - Intronic
1087299276 11:96413524-96413546 AAGGGAACCCACTACCTTGAAGG + Intronic
1087313414 11:96577394-96577416 AAAGGAACCCACTTCCTTGAAGG - Intergenic
1087377738 11:97366086-97366108 ATGGGAGCCCACTGCCCTGAAGG + Intergenic
1087417171 11:97871809-97871831 AAGGGAACCCACTGCCCTGAAGG - Intergenic
1087473015 11:98601093-98601115 AAGGGAAGCCACTGCCTTGAAGG - Intergenic
1087492392 11:98845025-98845047 AGGAGAAGCCACTACCTTGAAGG - Intergenic
1087498199 11:98917404-98917426 AAGAGAACCCACTGTCTTGAAGG - Intergenic
1087532909 11:99406936-99406958 AGGTGAGCCCACTTCCCTGAAGG - Intronic
1087598368 11:100282973-100282995 AAGGGAGCCCATTGCCCTGAAGG - Intronic
1087598401 11:100283170-100283192 AAAGGAACCCACTACCTTGAAGG - Intronic
1087721008 11:101665349-101665371 AAGAGAACCCACTACCTTGAAGG - Intronic
1087876970 11:103370075-103370097 AGGTGAGCCCACTGCCCTGAAGG + Intronic
1088009839 11:104986576-104986598 AGGGGAGCCCACTGCCCTGAAGG + Intergenic
1088181849 11:107121647-107121669 AGCAGAGCCCACTGCCCTGAAGG + Intergenic
1088362053 11:109001460-109001482 AAGGGAACCTGCTGCCTTGAAGG - Intergenic
1088411559 11:109539819-109539841 AAATAAACCCACTGCCTTGAAGG - Intergenic
1088483777 11:110321253-110321275 CAGTGAGCCCACTCCCATGAAGG - Intergenic
1088569911 11:111213085-111213107 AAAGGAACCCACTGACTTGAAGG + Intergenic
1088938190 11:114425826-114425848 ACAGGAGCCCACTGCCCTGAAGG - Intronic
1089216307 11:116836700-116836722 AAGACAGCCCACAGTCTTGCTGG + Intronic
1089602847 11:119625868-119625890 GAGAGAGCCCAGTGCCTGGCAGG + Intronic
1089824676 11:121264575-121264597 AAGGGAACTCATTGCCTTGATGG - Intergenic
1089845934 11:121458452-121458474 AAGAGAGCTCACTGCATTTTTGG + Intronic
1089937107 11:122375725-122375747 AGGGGAGCCCACTGCCCTGAAGG + Intergenic
1090065280 11:123498121-123498143 AGGGGAGCTCACTGCCCTGAAGG - Intergenic
1090111234 11:123911393-123911415 AAGGGAGGCCACTGCCCTAAAGG + Intergenic
1090352425 11:126115811-126115833 AGGAGGGCCCACTGCCCTGTGGG + Intergenic
1090515656 11:127423741-127423763 AGGAGAGCCCACTGCCCTGAAGG - Intergenic
1090676875 11:129007114-129007136 AGGGGAGCCCACTGCCGTGAAGG - Intronic
1090676938 11:129007461-129007483 AAGGGAACCCACTGCCTTCAAGG - Intronic
1090908457 11:131097391-131097413 AAGAAAGCTCACTGCGGTGAGGG - Intergenic
1091967172 12:4754582-4754604 AAGGGAGCCCACTTCCCTGATGG - Intronic
1091967220 12:4754838-4754860 AAGGGAGCTCGCTGCCTTGAAGG - Intronic
1092497673 12:9012769-9012791 GAGGGAGCCCATTGCCCTGAAGG + Intergenic
1092963119 12:13615229-13615251 GAGTGAGCCCACTGCCATGTAGG + Exonic
1093124546 12:15313029-15313051 AGGAGAGCCTACTTCCCTGAAGG - Intronic
1093321302 12:17718533-17718555 GAGAGAACCTACTGCCCTGAAGG - Intergenic
1093403533 12:18777172-18777194 AAGAGAACGTACTTCCTTGAAGG + Intergenic
1093538166 12:20247829-20247851 AAGGGAATCCTCTGCCTTGAAGG + Intergenic
1093538218 12:20248176-20248198 AAAGGAGCCTACTGCCCTGAAGG + Intergenic
1093588644 12:20872679-20872701 AAAGGAATCCACTGCCTTGAAGG - Intronic
1093620079 12:21278003-21278025 AGGAGAGCTAACTGCCCTGAAGG + Intronic
1093903284 12:24660986-24661008 AGGAGAGCCCACTGCCCTGAAGG - Intergenic
1094258650 12:28465279-28465301 AAGGGAACTCACTGCCCTGAAGG + Intronic
1094380736 12:29840516-29840538 AGGTAAGCCCACTGCCTTGAAGG - Intergenic
1094658168 12:32441034-32441056 AGGGGAGCCCACTTCCCTGAAGG - Intronic
1094658224 12:32441388-32441410 AAGGGAACCCGCTGCCTTGAAGG - Intronic
1094741651 12:33296425-33296447 AAGGGAATCCACTGCCTTGAAGG + Intergenic
1094817656 12:34203798-34203820 GAGAGAACTCACTGCCCTGAAGG + Intergenic
1095133621 12:38571834-38571856 AAGGGAACCCACTACCTTGAAGG + Intergenic
1095163293 12:38941586-38941608 AAGGGAACCTACTGCTTTGAAGG + Intergenic
1095163351 12:38941945-38941967 AGGAGAGCCCACTGCCCAGAAGG + Intergenic
1095169672 12:39019630-39019652 AAGGGAATCCATTGCCTTGAAGG + Intergenic
1095573589 12:43709854-43709876 AAGGGAGCCCACTGTCTTGAAGG - Intergenic
1095625070 12:44304714-44304736 AAGGGAACCCACTGACTTGAAGG + Intronic
1095808163 12:46343735-46343757 AAGAGAGCCTGCTGCCTTGAAGG - Intergenic
1095860273 12:46908662-46908684 AGGAGGGCCCACTTCCCTGAAGG + Intergenic
1097473212 12:60021529-60021551 AGGGGAGCCAACTGCTTTGAAGG - Intergenic
1097508594 12:60507479-60507501 AAGTGAACCCACTGCCTTGAAGG + Intergenic
1097508652 12:60507834-60507856 AGGGGAGCCCACTGCCCTGAAGG + Intergenic
1097552351 12:61090562-61090584 AAGGGAACCCACTGCATTAAAGG - Intergenic
1097569017 12:61308153-61308175 AAGGGAACCTGCTGCCTTGAAGG - Intergenic
1097714794 12:62954824-62954846 AGGAGAGCCCAGTGCTCTGAAGG - Intergenic
1097769944 12:63572179-63572201 AAGAGAGCCCACTGCCCTGAAGG + Intronic
1097791312 12:63818206-63818228 AAGGGAACCCACTGTTTTGAAGG + Intergenic
1097899236 12:64856980-64857002 TGGGGAGCCCACTGCCCTGAAGG - Intronic
1098046676 12:66408101-66408123 AAGGGAACCTGCTGCCTTGAAGG + Intronic
1098060346 12:66554651-66554673 AGGGGGGCCCACTGCCCTGAAGG + Intronic
1098142899 12:67469112-67469134 AGGGGAGCCCACTGCCCTGAAGG - Intergenic
1098333956 12:69382584-69382606 AGAGGAGCCCACTGCCCTGAAGG - Intronic
1098395331 12:70011082-70011104 AGGGGAGCCCACTGCCTTGAAGG + Intergenic
1098736657 12:74113270-74113292 AAGGGAACCCACTGCCTTGAAGG - Intergenic
1098975340 12:76896305-76896327 AAGGGAATCCACTGCCCTGATGG + Intergenic
1099024531 12:77448478-77448500 AGGGGAGCCCACTGCCCTGAAGG + Intergenic
1099100927 12:78439559-78439581 AAGGGAACCCACTGCCCTGAAGG - Intergenic
1099495337 12:83339782-83339804 AAAAGAGACCACTCCCCTGAAGG + Intergenic
1099524753 12:83705610-83705632 AAGAGAACCTACTGCCTTGAAGG + Intergenic
1099610116 12:84857467-84857489 AAGGGAGCCTTCTGCCCTGAAGG - Intergenic
1099616161 12:84938442-84938464 AAGGGAGCCCACTGACCTGAAGG + Intergenic
1099764138 12:86960714-86960736 AAAGGAGCCTACTGCCATGAAGG - Intergenic
1099781695 12:87203148-87203170 AAGGAAGCCCACTGCCTTGAAGG + Intergenic
1099807909 12:87543358-87543380 AAGGGAGCACACTGCCTTGAAGG + Intergenic
1099882213 12:88480427-88480449 ATGGGAACCCACTGTCTTGAAGG + Intergenic
1100060993 12:90575535-90575557 AGGGGAGCCCACTGCCCTGAAGG - Intergenic
1100381190 12:94063322-94063344 AAGGGAACCCGCTGCCTTGAAGG + Intergenic
1100909206 12:99338767-99338789 AAGGGAACCCACTATCTTGAAGG - Intronic
1100946371 12:99788372-99788394 AAGGGAACCCACTGCCTTGAAGG + Intronic
1100996013 12:100302002-100302024 AAGGGGACCCGCTGCCTTGAAGG - Intronic
1101026178 12:100609047-100609069 AGGGGAGGCCACTGCCCTGAAGG - Intronic
1101226696 12:102694644-102694666 AGGGGAGCTCACTGCCCTGAAGG + Intergenic
1101607448 12:106258429-106258451 AAGGGAACCTGCTGCCTTGAAGG + Intronic
1101607509 12:106258789-106258811 AGGGGATCCCACTGCCCTGAAGG + Intronic
1102266643 12:111491650-111491672 AAGGGAACCCATTGCCTTGAAGG + Intronic
1102317911 12:111904882-111904904 AAGAGAACCTGCTGCCTTGAAGG + Intergenic
1103082504 12:118036438-118036460 AAGAGACAACACTGCTTTGATGG + Exonic
1104103124 12:125634314-125634336 AGGGGAGCCCACTGCCCTGCAGG - Intronic
1104103178 12:125634666-125634688 AAGGGAACACACTGCCTTGAAGG - Intronic
1105559011 13:21473159-21473181 AGGGGAGCCCACTGTCCTGAAGG - Intergenic
1105559071 13:21473501-21473523 AAAGAAACCCACTGCCTTGAAGG - Intergenic
1106074739 13:26448466-26448488 AAGAGAACCTGCTGGCTTGAAGG + Intergenic
1106349957 13:28920938-28920960 AGGGGAGCCCACTGCCCTAAAGG - Intronic
1106424184 13:29610306-29610328 AAGATAGGACACTGCCTTTATGG - Intergenic
1106855368 13:33846348-33846370 AAGGGAACCCGCTGCCTTGAAGG - Intronic
1106964106 13:35038607-35038629 AAGGAAACCCACTGCCTTGAAGG - Intronic
1107083881 13:36405190-36405212 AAGAGACCTCACTGCCCTGAAGG - Intergenic
1107210893 13:37852719-37852741 AAGGGAGCCCGCTACCTTGAAGG + Intronic
1107287761 13:38814953-38814975 AGGGGAGCCCACTGTCCTGAAGG - Intronic
1107524228 13:41214168-41214190 AAGGGAACCCTCTGCCTTGAAGG - Intergenic
1107582218 13:41802744-41802766 AAGGGAACCCACTGCCCTGAAGG + Intronic
1107807843 13:44171801-44171823 AGGGGAGCCCACAGCCCTGAAGG - Intergenic
1107808210 13:44174616-44174638 AGAGGAGCCCACTGCCCTGAAGG - Intergenic
1108587898 13:51887112-51887134 TGGAGAGCACACTGCCTTGTAGG - Intergenic
1108858009 13:54819819-54819841 AAGGGAAGTCACTGCCTTGAAGG + Intergenic
1108922562 13:55693732-55693754 AAGGGAGCCCACTACCCTGAAGG + Intergenic
1108973209 13:56402741-56402763 AAGGGAACACACTGCCTTGAAGG + Intergenic
1108989828 13:56640776-56640798 AAGGGAACTCATTGCCTTGAAGG + Intergenic
1109022762 13:57119286-57119308 AAGGAAGCCCACTGCTTTGAAGG - Intergenic
1109522718 13:63533964-63533986 AGGAGAGTCCACTGCCCTAAGGG - Intergenic
1109522771 13:63534336-63534358 AAGGAAGGCCACTGCCTTGAAGG + Intergenic
1109567091 13:64131732-64131754 AGGAGAGCCCACTGCCCTGAAGG + Intergenic
1109747677 13:66647813-66647835 AGGGGAGCCCATTGCCTTGAAGG + Intronic
1109824290 13:67697472-67697494 AAGGGAATCCGCTGCCTTGATGG + Intergenic
1109854718 13:68111590-68111612 AGGGGAACCCACTGCCCTGAAGG + Intergenic
1110078912 13:71286569-71286591 AGGGGAGCCCACTGCCCTCAAGG - Intergenic
1110078971 13:71286917-71286939 AAGGGAGCCTGCTACCTTGAAGG - Intergenic
1110376707 13:74802560-74802582 AAGGGAACCCACTTCCTTGAAGG + Intergenic
1110501268 13:76231246-76231268 AAGGGAACCTACTGTCTTGAAGG + Intergenic
1110501327 13:76231598-76231620 AGGGGAGCCCACTGCCCTAAAGG + Intergenic
1110889501 13:80680393-80680415 AGGAAAACCCACTGCCCTGATGG - Intergenic
1110916773 13:81030768-81030790 AAGGGAACCCACTGCCCTGATGG - Intergenic
1111390815 13:87592209-87592231 AAAGGAATCCACTGCCTTGAAGG + Intergenic
1111449097 13:88390841-88390863 AAGAGAACCTATTTCCTTGAAGG + Intergenic
1111449144 13:88391189-88391211 AAGGGAGCCCACTAACCTGAAGG + Intergenic
1111639343 13:90947545-90947567 AGGGGAGCCCACTGCCCTGAAGG + Intergenic
1112176806 13:97033909-97033931 AAGAGAATTCACTGCCCTGATGG + Intergenic
1112176926 13:97034800-97034822 AAGAGAATTCACTGCCCTGATGG + Intergenic
1112471540 13:99694092-99694114 AAGAGGTTCCAGTGCCTTGATGG - Intronic
1112618854 13:101034569-101034591 AAGGGAGCCCACTACCCTGAAGG - Intergenic
1112658092 13:101474209-101474231 AGGGAAGCCCACTGCCCTGAAGG + Intronic
1113244318 13:108377541-108377563 AAGTGAACCTGCTGCCTTGAAGG - Intergenic
1113558621 13:111258486-111258508 AAGGGAACCCACTGCTTGGAAGG + Intronic
1114072645 14:19126897-19126919 AGGGGAGCCCACTGCCCTGACGG - Intergenic
1114072705 14:19127254-19127276 AAGGAAACCCACTGCCTTGAAGG - Intergenic
1114089552 14:19272718-19272740 AAGGAAACCCACTGCCTTGAAGG + Intergenic
1114089612 14:19273075-19273097 AGGGGAGCCCACTGCCCTGACGG + Intergenic
1114245023 14:20905058-20905080 AAGAAAACCCACTGCCTAGAAGG + Intergenic
1114245080 14:20905417-20905439 AGGGGAGCCTACTGCCCTGAAGG + Intergenic
1114248031 14:20933230-20933252 AAGAAAACCCACTGCCTAGAAGG + Intergenic
1114250861 14:20959309-20959331 AAGAAAACCCACTGCCTAGAAGG + Intergenic
1114783711 14:25570040-25570062 AGGGGAGCCCACTGCCCTGAAGG - Intergenic
1114820332 14:26010236-26010258 AAAAGAACCCACTGTCCTGAAGG + Intergenic
1114985173 14:28217641-28217663 AACAGAACCCACTGCCTTGAAGG - Intergenic
1115133933 14:30086587-30086609 AGAGGAGCCCACTGCCCTGAAGG + Intronic
1115620336 14:35134531-35134553 AAGGGAACTCACTGCCTTGAAGG - Intronic
1115820973 14:37211971-37211993 AAGGGAACTCACTGCCTTGAAGG + Intronic
1115948671 14:38694786-38694808 AGTAGAGCCCATTGCCCTGAAGG + Intergenic
1116045696 14:39740260-39740282 AAGGAAACCCACTGCCTTGAAGG + Intergenic
1116057840 14:39885783-39885805 AAGGGAGCCCACTGCCCTGAAGG + Intergenic
1116275629 14:42827773-42827795 AAGGGAACCTGCTGCCTTGAAGG - Intergenic
1116354853 14:43914928-43914950 AGGGGAGTCCACTGCCCTGAAGG + Intergenic
1116392789 14:44413607-44413629 AAGAGAACCCATTGCCTCAAAGG + Intergenic
1116413168 14:44649517-44649539 GAGGGAGCCTGCTGCCTTGAAGG + Intergenic
1116422157 14:44745219-44745241 AAGGGAGCCCACTGACCTTAAGG + Intergenic
1116434074 14:44877345-44877367 AAGGGAGCCCACTGTCCTGAAGG + Intergenic
1116504817 14:45665270-45665292 AAGGGAGCCCACTGCCCTGAAGG - Intergenic
1116583682 14:46674840-46674862 AAGGGAACCCACTGCCTTGAAGG + Intergenic
1116677744 14:47927061-47927083 AAGGGAACCTGCTGCCTTGAGGG - Intergenic
1116701677 14:48252598-48252620 AAGATAGTCAACTACCTTGATGG - Intergenic
1116765918 14:49070485-49070507 AAGGGAACCTACTGCCTTGAAGG + Intergenic
1116889038 14:50249556-50249578 AAGGGAACCTACTGCCTTGGAGG + Intronic
1116889149 14:50250248-50250270 AGGGGAGCCCACTGCCCTGAAGG + Intronic
1116930716 14:50688230-50688252 AAGGGAGCCCACTGCCTTGACGG - Intergenic
1117233948 14:53752133-53752155 AAGAGAACTTGCTGCCTTGAAGG + Intergenic
1117264959 14:54077048-54077070 AAGGGAACCCACTACCTTGAAGG - Intergenic
1117384232 14:55194923-55194945 AGGGGAGCCCACTGCCCTGAAGG - Intergenic
1117418323 14:55518836-55518858 AAGGGAACTCGCTGCCTTGAAGG + Intergenic
1117483094 14:56168558-56168580 AGGGGACCCCACTGCCCTGAGGG - Intronic
1117483160 14:56168918-56168940 AAGGGAACCCACTGCCTTGAAGG - Intronic
1117606228 14:57431499-57431521 AGGGGAGCCCACTGCCTGGAAGG + Intergenic
1117606962 14:57440053-57440075 AAGGGAGCCCACTGCCCTGAAGG - Intergenic
1117629162 14:57671486-57671508 AAGGGAACCCACTGACTTGAAGG + Intronic
1117696991 14:58375822-58375844 TAGAGAGCCCACTAGTTTGAAGG + Intergenic
1117843052 14:59880954-59880976 AAGGGAACTTACTGCCTTGAAGG - Intergenic
1117893237 14:60449931-60449953 AAGGGAATCCACTGCCTTGAAGG + Intronic
1117893300 14:60450282-60450304 AGGGGAGCCCACTACCCTGAAGG + Intronic
1118034202 14:61849054-61849076 AAGGGAGCCTGCTGCCTTGAAGG - Intergenic
1118241189 14:64060390-64060412 AAGGGAACCCACTTCCTCGAAGG - Intronic
1118431191 14:65720352-65720374 AAGGGAGCCCAGTGCCCTGAAGG - Intronic
1118539081 14:66802698-66802720 AAGGGAACCCACAGCCTTGTAGG - Intronic
1118697331 14:68397756-68397778 AAGGAAGCACACTGCATTGAAGG + Intronic
1119096847 14:71840658-71840680 AAGAGAACACACTGCCTTGAAGG - Intergenic
1119197525 14:72728269-72728291 AAGAGATCCCTCTGGCTGGAGGG + Intronic
1120100087 14:80435007-80435029 AAGAGAACCAACTGCCCTGAAGG + Intergenic
1120340658 14:83217058-83217080 AGGGGAGCCCACTGCCCTAAAGG - Intergenic
1120439699 14:84520665-84520687 AAAGGAGCCCACTGCCTTGAAGG - Intergenic
1120697404 14:87659607-87659629 AAGGGAACCCACTGCCTTGAAGG + Intergenic
1120697468 14:87659938-87659960 GAGGGAGCCCACTGCCTTGAAGG + Intergenic
1121607543 14:95252321-95252343 ATGAGAGCCCACAGCATTGCAGG + Intronic
1121644864 14:95510855-95510877 AAGGAAGCCCACTGCCTTTGTGG - Intergenic
1121856563 14:97275840-97275862 AGCAGAGCCCCCTGCCTTGGTGG - Intergenic
1123508669 15:20972599-20972621 AAGGGAACCTGCTGCCTTGAAGG - Intergenic
1123565890 15:21546348-21546370 AAGGGAACCTGCTGCCTTGAAGG - Intergenic
1123602150 15:21983635-21983657 AAGGGAACCTGCTGCCTTGAAGG - Intergenic
1124633882 15:31352980-31353002 AACAGAGCCCACAGCCTAGGTGG - Intronic
1125272310 15:37952817-37952839 AGGGGATCCCACTGCCCTGAAGG + Intronic
1125567079 15:40685030-40685052 AGGGGAACTCACTGCCTTGAAGG - Intergenic
1126015646 15:44347960-44347982 AAGGGAACCTCCTGCCTTGAAGG + Intronic
1126053360 15:44707472-44707494 AAGGGAACCTGCTGCCTTGAAGG - Intronic
1126183748 15:45810894-45810916 AATGGAACCTACTGCCTTGATGG + Intergenic
1126250817 15:46565897-46565919 AAGGGAACCTGCTGCCTTGAAGG - Intergenic
1126294950 15:47129599-47129621 AGGGGAACCCACTGCCCTGAAGG - Intergenic
1126440569 15:48683761-48683783 GAGGGGGCCCACTGCCATGAAGG + Intergenic
1126517645 15:49554039-49554061 AATGGAACACACTGCCTTGAAGG - Intronic
1126534115 15:49742168-49742190 AATAGAACCCACTGCCTTTCAGG + Intergenic
1126660692 15:51030570-51030592 AGGTGAGCCCACTGCCCTGAAGG - Intergenic
1126979867 15:54228598-54228620 AAGGGAACCTGCTGCCTTGAAGG - Intronic
1127022203 15:54760569-54760591 AAGGGAACCTGCTGCCTTGAAGG + Intergenic
1127155796 15:56123308-56123330 AAGGGAACCCACTACGTTGATGG - Intronic
1127170924 15:56300128-56300150 AAGGGAGCCTACTTCCCTGAAGG + Intronic
1127177995 15:56382246-56382268 AGGGGAGCCCACTCCCTTGAAGG - Intronic
1127800515 15:62473238-62473260 AAGTGAGCCCAGTGCTGTGAAGG - Intronic
1127945248 15:63744739-63744761 AGGAGAACCCACTGCCCTGAAGG - Intronic
1127971506 15:63965840-63965862 AGGGGAGCCCACTGCCCTGAAGG - Intronic
1127971565 15:63966172-63966194 AAGGGAATCCACTGCCTTGAAGG - Intronic
1128364511 15:66988266-66988288 AGGGGAGCCCACTGCCTTGAAGG + Intergenic
1128491851 15:68154865-68154887 AAGACAGACATCTGCCTTGAAGG + Intronic
1128901088 15:71423437-71423459 AAGGGAACCTGCTGCCTTGAAGG - Intronic
1129030596 15:72615092-72615114 AGGGGGGCCCACTGCCCTGAAGG - Intergenic
1129209630 15:74060220-74060242 AGGGGAGCCCACTGCCCTGAAGG + Intergenic
1129477436 15:75795605-75795627 AGGGGAGCCCACTGCCCTGAAGG - Intergenic
1129642365 15:77393530-77393552 AAGAGAACCCACTGCCTTGAAGG + Intronic
1129642424 15:77393885-77393907 AGGGGAGCCCACTGCTCTGAAGG + Intronic
1129835496 15:78702866-78702888 AGGGGAGCCCACTGCCCTGAAGG - Intronic
1130511771 15:84595391-84595413 AAGGGAACCTGCTGCCTTGAAGG + Intergenic
1130961733 15:88663926-88663948 AGGATAGCCCACTGCCCTGATGG + Intergenic
1130995348 15:88900413-88900435 AGGAGAGGCCACAGCCTGGAGGG + Intronic
1131315075 15:91328843-91328865 AGGGGAGCCCACTGCCCTGAAGG - Intergenic
1131374240 15:91910381-91910403 AAGAGAGCATGCTGCCTTGTAGG - Intronic
1131950207 15:97673490-97673512 AGGAGAACCCACTGCCTTGAAGG - Intergenic
1132230673 15:100181558-100181580 AAGGAAACCCATTGCCTTGAAGG - Intronic
1132439086 15:101841213-101841235 AGGGGAGCCCACTGTCCTGAAGG - Intergenic
1132439149 15:101841571-101841593 AAAGGAACCCACTGCCTTGAAGG - Intergenic
1202974257 15_KI270727v1_random:273441-273463 AAGGGAACCTGCTGCCTTGAAGG - Intergenic
1132756773 16:1489082-1489104 CTCAGAGCCCACTGGCTTGAAGG - Intergenic
1133834218 16:9351787-9351809 AAGGGAACCTGCTGCCTTGAAGG - Intergenic
1134406945 16:13969375-13969397 AGGGGAGCTCACTGCCCTGAAGG - Intergenic
1135879520 16:26240574-26240596 AAGAAAACCCACTGCCTTGAAGG + Intergenic
1136085035 16:27878794-27878816 AAGAGGGACCACTGCCTTGGGGG + Intronic
1136679248 16:31945945-31945967 ATGGGAGCCCATTGCCCTGAAGG + Intergenic
1137227115 16:46524088-46524110 AGGGGAGCCCACAGCCTTGAAGG - Intergenic
1137227181 16:46524458-46524480 AAGGGAACCCGCTGCCTTGAAGG - Intergenic
1137593196 16:49706452-49706474 AAGGGGGCTCACTGCCTTGTGGG + Intronic
1137914319 16:52412236-52412258 AGGAGTTCCCTCTGCCTTGAAGG + Intergenic
1138638325 16:58362017-58362039 AAGGGAACCCACTGTCTTGAAGG - Intronic
1139103848 16:63802194-63802216 AAGGGAACACACTGCTTTGAAGG - Intergenic
1139122947 16:64042799-64042821 AAGGGAACCTACTGCCTTGAAGG + Intergenic
1140646605 16:77038244-77038266 AGGGGAGCCCACTGCTCTGAAGG - Intergenic
1141010885 16:80397406-80397428 AGAGGAGCCCACTGCCCTGAAGG + Intergenic
1141485173 16:84334087-84334109 AGGGGAGCCCAGTGCCCTGAAGG + Intergenic
1142888796 17:2929726-2929748 AAAAGAGCCCACTGCCTTCGTGG - Intronic
1142919225 17:3169878-3169900 AAGGGAACCTGCTGCCTTGAAGG + Intergenic
1143413667 17:6728983-6729005 AAGAGAACCCACTGCCTCGAAGG + Intergenic
1145200937 17:20944210-20944232 CAGGGAGCCCACTTCCCTGAAGG - Intergenic
1147252402 17:39160844-39160866 AAGAGAGGCCCATGCCTGGATGG + Intronic
1148134370 17:45282848-45282870 AAAGGACACCACTGCCTTGAGGG + Intronic
1148691520 17:49529638-49529660 AAGATAGCTCACTGCCGTGGTGG + Intergenic
1148695805 17:49557387-49557409 CATGGAGCCCACTGCCTTGATGG + Intergenic
1149075647 17:52594417-52594439 AAGGGAACCCAGTGCCCTGAAGG - Intergenic
1149153194 17:53594373-53594395 AAGGGAACCCATTGCCTTGAAGG - Intergenic
1149157383 17:53647997-53648019 AAGAGAACCCTCTGCCTTTAAGG - Intergenic
1149184359 17:53979629-53979651 AAGAGAGCCCATTTCCTTGAAGG - Intergenic
1149231257 17:54536963-54536985 AAGAGAACCCACTGCCTTGAAGG + Intergenic
1149231296 17:54537219-54537241 AGGGGAGTCCACTGCCCTGAAGG + Intergenic
1149234921 17:54578426-54578448 AAGGGAGCCCACTGCCTTGAAGG + Intergenic
1150137939 17:62706000-62706022 GAGTGAGCCCAGGGCCTTGATGG - Intronic
1150871045 17:68911194-68911216 AGGGGAGCCCATTGCCCTGAAGG + Intronic
1152231703 17:79117190-79117212 AGGAGGCCCCACTGCCTGGAAGG + Intronic
1153356637 18:4143861-4143883 AAAGGAACCCACTGCCTTGAAGG - Intronic
1153429520 18:5000415-5000437 AAGAGAGCCCACTTCCCTGAAGG + Intergenic
1154104946 18:11514654-11514676 AATAGAGCACACAGCCTGGACGG + Intergenic
1154230675 18:12553335-12553357 AGGGGAGCCCACTGCCCTGAAGG + Intronic
1154386610 18:13898133-13898155 AGGTGAGCCCACTGCCCTGAAGG + Intronic
1154491154 18:14923265-14923287 AAGGGAGCTCACTGCCCTGAAGG + Intergenic
1154930943 18:20995548-20995570 AGAGGAGCCCACTGCCCTGAAGG + Intronic
1155282158 18:24250864-24250886 AGGGGAGCCCACTGCCCTGAAGG + Intronic
1155443368 18:25884939-25884961 AAGCAAGCCCACTGCCTTGAAGG + Intergenic
1155533822 18:26795104-26795126 AGAGGAGCCCACTGCCCTGAAGG + Intergenic
1155782102 18:29849735-29849757 AAGAGAACACACTGCTTTGAAGG - Intergenic
1155792836 18:29996042-29996064 AAGGGATCCCATAGCCTTGAAGG + Intergenic
1156021588 18:32605977-32605999 AAGGGAACCCACTGCCTTGAAGG - Intergenic
1156155842 18:34300953-34300975 AAGGGAACCTACTGCCTTAAAGG + Intergenic
1156379453 18:36544541-36544563 GAGGGAGCCGACTGCCGTGACGG - Intronic
1156912413 18:42426288-42426310 AAGAGAACCCGCTGCCTTGAAGG - Intergenic
1157022675 18:43805535-43805557 AAGGGAACCCACTACCTTGAAGG - Intergenic
1157048852 18:44136053-44136075 AAGAAAGGCTACTGCCCTGAGGG - Intergenic
1157288560 18:46393925-46393947 AATAGTGCCCACTGCCTGGTGGG + Intronic
1157308845 18:46536877-46536899 CAAAGATCCCACTGCCTGGAGGG + Intronic
1157700049 18:49756598-49756620 AAGACAGTCCACTGACTTCATGG + Intergenic
1157879281 18:51304715-51304737 AAGGGAACCTGCTGCCTTGAAGG + Intergenic
1158431306 18:57389845-57389867 AGGGGAGCCCACTGCCCTAAAGG + Intergenic
1158468465 18:57712894-57712916 AAGGGAGCCTGCTGCCTTGCAGG + Intronic
1158468628 18:57714050-57714072 AGGGGAGCTCACTGCCCTGAAGG + Intronic
1158481323 18:57824166-57824188 AAGGGAATCCGCTGCCTTGAAGG - Intergenic
1159284958 18:66336923-66336945 AAGGGAACCCATTGCCTTGAAGG - Intergenic
1159564929 18:70037516-70037538 AAGGGAACCCACTGCCTTGAAGG + Intronic
1159648038 18:70943047-70943069 AAGGGAACCCATTGGCTTGAAGG + Intergenic
1159802611 18:72919837-72919859 AAGAGAACCTGCAGCCTTGAAGG - Intergenic
1160138437 18:76296039-76296061 AAGAGAACCCACTGCCTTGAAGG - Intergenic
1162487030 19:10967267-10967289 AAGAAAGCCCCCTTCCCTGAGGG - Intronic
1162666803 19:12220421-12220443 AAGGGAACCTACCGCCTTGAAGG - Intergenic
1162692999 19:12449349-12449371 AGGGGAGCCCACTGCACTGAAGG - Intronic
1162693055 19:12449675-12449697 AAGGAAACCCACTGCCTTGAAGG - Intronic
1163281299 19:16319677-16319699 AAGGGAGGCCCCTGTCTTGAGGG + Intergenic
1163613987 19:18315904-18315926 AAGAGAGCAAACTGCCATGCTGG + Intronic
1164063532 19:21695136-21695158 CAGAGCGCTCACTGCCTGGAGGG + Intergenic
1164408531 19:27976772-27976794 AAGGGAACCTGCTGCCTTGAAGG + Intergenic
1164491101 19:28714933-28714955 AGGGAAGCCCACTGCCCTGAAGG + Intergenic
1164687129 19:30174254-30174276 AAGGGAGCTGACTGCCTTGGAGG + Intergenic
1165984076 19:39752140-39752162 AAGAGAGCCCACTGCCCTGGAGG + Intergenic
1166408373 19:42539886-42539908 AAGGGAGCCCACTGCCTTGAAGG - Intronic
1166538227 19:43589354-43589376 AAGTGATCCTCCTGCCTTGATGG - Exonic
1166756062 19:45192306-45192328 AGGGGAGCCCACTGCCCTGAAGG - Intronic
1167582164 19:50351531-50351553 AGGGGAGCCCACTGCCCTGAGGG - Intronic
1168615465 19:57833776-57833798 AACAGAACCTGCTGCCTTGAAGG - Intronic
1168621320 19:57881671-57881693 AACAGAACCTGCTGCCTTGAAGG + Intronic
925269397 2:2591594-2591616 ATGAAAGCCCACTGCCTTGAAGG + Intergenic
925588510 2:5487210-5487232 AAGAGAACCTGGTGCCTTGAAGG + Intergenic
925698919 2:6613452-6613474 AAGGAACCCCACTGCCTTGAAGG - Intergenic
926478324 2:13356657-13356679 AAGGGAGCCTTCTGCCTTGAAGG + Intergenic
926600882 2:14844307-14844329 AAGGGAACTCACTGCCTTGAAGG + Intergenic
926600937 2:14844660-14844682 ATGGGAGCCCACTGCCCTGAAGG + Intergenic
926602008 2:14855174-14855196 AAAGGAACCCACTGCCTTGAAGG + Intergenic
927309814 2:21617647-21617669 GCCAGAACCCACTGCCTTGAAGG - Intergenic
927424989 2:22971389-22971411 AAGGGAACCCGCTGCCTTGAAGG + Intergenic
928293530 2:30061171-30061193 AAGGGAATCCACTGCCTTGAAGG + Intergenic
928313040 2:30225994-30226016 AAGAGGGACCACTGGCTTTAGGG + Intergenic
928472176 2:31585557-31585579 AAGGGAACCCACTGCTTTGAAGG + Intergenic
928750087 2:34460346-34460368 AAGGGAAGCCTCTGCCTTGAAGG - Intergenic
928786072 2:34887757-34887779 AAGGGAACCCAACGCCTTGAAGG - Intergenic
928828905 2:35455264-35455286 AGGGAAGCCCACTGCCCTGAAGG - Intergenic
928932363 2:36637403-36637425 AGGGGAGCTCACTGCCCTGAAGG + Intronic
929099963 2:38302089-38302111 AAGGGAACCCACTGTCTTGAGGG + Intronic
929281707 2:40087309-40087331 AGGTGAGCCCACTACCCTGAAGG - Intergenic
929473175 2:42217303-42217325 TAGAGACTCAACTGCCTTGATGG - Intronic
929525017 2:42693637-42693659 AGGGGAGCCCAGTGCCCTGAAGG - Intronic
929529268 2:42736868-42736890 AAGAAAGCCCACTGCCTTGAAGG - Intronic
929534209 2:42770367-42770389 CAGAGAGCCCACTGCCAGGCCGG - Intronic
929926582 2:46217313-46217335 AAGGGAACCTATTGCCTTGAAGG - Intergenic
930041489 2:47128673-47128695 AGGGGAGCCCACTGCCCTGAAGG - Intronic
930492527 2:52093432-52093454 AAGAGAACCCATTGCTTTGAAGG - Intergenic
930727370 2:54695127-54695149 AAGAGAACCTGCTGCCTTGAAGG + Intergenic
930727428 2:54695486-54695508 AGGGGAGCCCACTCCCTTGAAGG + Intergenic
930778289 2:55196955-55196977 AGGGGAGCCCACTGCCCTGAGGG + Intronic
930895405 2:56440328-56440350 AAGAGAGCCCACTGCCCTGTAGG - Intergenic
930895452 2:56440689-56440711 AAGGTCACCCACTGCCTTGAAGG - Intergenic
930947456 2:57092496-57092518 AAGAGAGCCCACTGCCCTCATGG - Intergenic
930970977 2:57396332-57396354 AGGAGAGCCCACTGGCCTGGAGG - Intergenic
930971327 2:57398258-57398280 AAGGGAACCCCCTGTCTTGAAGG - Intergenic
931001903 2:57794227-57794249 AACGGAACCTACTGCCTTGAAGG - Intergenic
931161973 2:59702594-59702616 AAGGGAACCCACAACCTTGAAGG - Intergenic
931343630 2:61426355-61426377 AGGGGAGCCCACTGCCCTGAAGG + Intronic
931736565 2:65199654-65199676 AGGGGAACCCACTGCCCTGATGG + Intergenic
931989827 2:67779046-67779068 AGAAGAGCCCACTGCCATGAAGG + Intergenic
933162839 2:79044930-79044952 AAGGGAACCTGCTGCCTTGAAGG + Intergenic
933194556 2:79373598-79373620 AAATGAGCCCACAGCCTGGATGG + Intronic
933348938 2:81128003-81128025 AAGGGAGCCTACAGCCCTGAAGG - Intergenic
933348986 2:81128318-81128340 AAGGGAACCTGCTGCCTTGAAGG - Intergenic
933944887 2:87277652-87277674 GAGAGAGGCCACAGTCTTGAGGG + Intergenic
935356622 2:102207483-102207505 AAGGGGACCCGCTGCCTTGACGG - Intronic
935532706 2:104254099-104254121 AGGGGAGCCCACTTCCCTGAAGG + Intergenic
935576550 2:104717296-104717318 AGGGGAGCCCACTGCCCTGAAGG - Intergenic
935576606 2:104717655-104717677 AAAAGATCCTACTGCCTTGAAGG - Intergenic
935928220 2:108093506-108093528 AGGAGAGCCCACTGCCCTGAAGG - Intergenic
935928267 2:108093762-108093784 AAGAGATCCTGCTGCCTTGAAGG - Intergenic
935989394 2:108705643-108705665 AAGGGAACCCACTGCCTTGAAGG + Intergenic
936335321 2:111583938-111583960 GAGAGAGGCCACAGTCTTGAGGG - Intergenic
936511257 2:113149472-113149494 ATGGGAGCCCACTGCCTTGAAGG - Intergenic
936511320 2:113149842-113149864 AAGAGAAATCACTGCCTTGAAGG - Intergenic
936795244 2:116196018-116196040 AAGGAAGCCCACTGCCCTGAAGG - Intergenic
936940368 2:117878363-117878385 AGGAGAGCCCACTGCCCTGAAGG - Intergenic
937557736 2:123180216-123180238 AAGAGAACCCAATTTCTTGAAGG + Intergenic
937590954 2:123612738-123612760 AAGAGAACCCACTGCCTTGAAGG + Intergenic
937591194 2:123615049-123615071 AAGAGAACCCATTGCCTTGAAGG + Intergenic
937613542 2:123893030-123893052 AGGGGAGCACACTGCCCTGAAGG - Intergenic
937613596 2:123893374-123893396 AAAGGAACCCACTGCCTTGAAGG - Intergenic
937617564 2:123944177-123944199 AAGTGAACCCACTGCCTTGAAGG + Intergenic
937628355 2:124069098-124069120 AGGGGAGCCCATTGCCATGAAGG + Intronic
937739454 2:125333188-125333210 AAGGGAAACCACTGACTTGAAGG + Intergenic
938177963 2:129153449-129153471 AAGGGAACCTGCTGCCTTGAAGG - Intergenic
938216960 2:129526275-129526297 AAGGGAACCCACTGCCTTGAAGG + Intergenic
938486883 2:131720367-131720389 AGGGGAGCCCACTGCCCTGACGG - Intergenic
939144498 2:138396257-138396279 AAGGGAACCTGCTGCCTTGAAGG + Intergenic
939257253 2:139759862-139759884 AAGGGGACCCACTGCCTTGAAGG - Intergenic
939443176 2:142275815-142275837 AGGGGAGCCCATTGCCCTGAAGG - Intergenic
939443232 2:142276144-142276166 AAAGGAACTCACTGCCTTGAAGG - Intergenic
939483427 2:142778582-142778604 AGGGGAGCTCACTGCCCTGAAGG - Intergenic
939707896 2:145478280-145478302 AGGAGAGCCCATTTCCCTGAAGG - Intergenic
939707947 2:145478625-145478647 TAGAGAACCCACTGCCTTAAAGG - Intergenic
940122259 2:150279673-150279695 AAGAGAGGGCAATACCTTGAAGG - Intergenic
940315200 2:152320747-152320769 AAAGGAACCTACTGCCTTGAAGG - Intergenic
940443974 2:153754429-153754451 AAGGGAACCCAGTGTCTTGAAGG - Intergenic
940468691 2:154064990-154065012 AGGGGAGCCCACTGCCATGAAGG + Intronic
940503767 2:154527275-154527297 AGGAGAGCCCCCTGCCCTGAAGG - Intergenic
940559848 2:155281398-155281420 AAGAAAACCCACTACCTTGAAGG - Intergenic
941303343 2:163830337-163830359 AAGGGAACACATTGCCTTGAAGG - Intergenic
941357347 2:164510722-164510744 AAGGGAGCCCACTACCATAAAGG + Intronic
941357469 2:164511510-164511532 AAGGGAACCCACTGCCTTGAAGG + Intronic
941528230 2:166632151-166632173 AAGGGAGCCCACTGCTCTGAAGG - Intergenic
941678634 2:168371360-168371382 AGGGGAGCCCATTGCCCTGAAGG + Intergenic
941745997 2:169087732-169087754 AAGGAAACCCACTGCCTTGAAGG - Intronic
942352351 2:175065685-175065707 AGGGGAGCCCACTGCCCTGAAGG + Intergenic
942391759 2:175502445-175502467 AGCGGAGCCCACTGCCCTGAAGG - Intergenic
942461871 2:176174329-176174351 AGGAGAGCTCACTGCCTTGCAGG + Intergenic
942778527 2:179613500-179613522 AGGGGAACCTACTGCCTTGAAGG - Intronic
942814272 2:180033757-180033779 AGGGGAGCCCACTTCCCTGAAGG - Intergenic
942881876 2:180871221-180871243 AACAGAACCCACTGCCTTGAAGG + Intergenic
942914972 2:181294413-181294435 AAGGGAACCTGCTGCCTTGAAGG + Intergenic
942972237 2:181970958-181970980 AGGGGAGCCCACTGGCCTGAAGG - Intronic
942975780 2:182015653-182015675 AAAGGAACCCACTGCCTTGAAGG - Intronic
943067590 2:183105323-183105345 AGGAGAGCCCACTGCCCTAAAGG - Intergenic
943099557 2:183471668-183471690 AAGGAAACCCACTGCCTTAAAGG - Intergenic
943208180 2:184927865-184927887 AGGGGAGCCCACTGCCCTGAAGG - Intronic
943226758 2:185187913-185187935 AGGGGAGCCCACTGCCCTAAAGG - Intergenic
943302695 2:186223545-186223567 AAGAGAACCCACTGCCTTGATGG + Intergenic
943309688 2:186310506-186310528 AAAGGAACCCACTGCCTTGAAGG + Intergenic
943309739 2:186310865-186310887 AGGGGAGCCCACTACCCTGAAGG + Intergenic
943427920 2:187759397-187759419 AAGGGAATCCACTGTCTTGAAGG - Intergenic
943484693 2:188464894-188464916 GAGGAAGCCCACTGCCATGACGG - Intronic
943484737 2:188465253-188465275 AAAGGAACCTACTGCCTTGAAGG - Intronic
943831779 2:192472803-192472825 AAGGAAGCCCACTGCCCTGTAGG + Intergenic
943933611 2:193886202-193886224 AGGAGAGCCCACTACCCTGAAGG + Intergenic
944095911 2:195968097-195968119 AGGGGAGCCCACTGCCCTGAAGG - Intronic
944095968 2:195968362-195968384 AAGAGAACCCACTGCCTTGAAGG - Intronic
944096671 2:195975815-195975837 AAGAAAACCCACTGGCTTGAAGG + Intronic
944133291 2:196370265-196370287 AAGGGAACTCACTTCCTTGAAGG - Intronic
944550420 2:200839989-200840011 AGGGGAGCCCACTACCCTGAAGG + Intergenic
944616374 2:201464981-201465003 AGGGTAGCCCACTGCCCTGAAGG - Intronic
944760411 2:202808232-202808254 AGGGGAGCCCACTACCTTGAAGG + Intronic
944855117 2:203759953-203759975 AAGGGAACCTGCTGCCTTGAAGG - Intergenic
944955043 2:204798789-204798811 AAGGGAACCCGATGCCTTGAAGG + Intronic
944955101 2:204799128-204799150 ACGGGAGCCCACTACCCTGAAGG + Intronic
945181752 2:207099211-207099233 CAGAGAGCACACAGCTTTGAGGG + Intronic
945461587 2:210116045-210116067 AGGGGAGCCCACTGTCCTGAAGG + Intronic
945551772 2:211229349-211229371 AGGGGAGCCCACTGCTCTGAAGG + Intergenic
945575673 2:211525703-211525725 AAGCGAGCCCATTGCCCCGAAGG + Intronic
945713671 2:213331287-213331309 AAGGGACCCCACTGCCTTGAAGG + Intronic
945739778 2:213645494-213645516 AAAAGAACCCACTGCCTTGAAGG - Intronic
945754487 2:213829745-213829767 AAGGGAACCTGCTGCCTTGAAGG - Intronic
946509114 2:220335185-220335207 AAGGGAACCCATTGCCTTGAAGG - Intergenic
946697292 2:222372463-222372485 AAGGGAACCCACTGATTTGAAGG + Intergenic
946984671 2:225258141-225258163 AAGGGAACCAGCTGCCTTGAGGG + Intergenic
947009107 2:225546574-225546596 AAGGGAGCCCACTGCCCTGAAGG - Intronic
947312378 2:228818424-228818446 AAGGGAAACCACTGCCTTGAAGG - Intergenic
947439718 2:230108882-230108904 AGGGGAGCCCACTGCCCTGAGGG - Intergenic
947687158 2:232097995-232098017 AAGAGAACCTGTTGCCTTGAAGG - Intronic
947893052 2:233643437-233643459 AGGGGAGCCCACTGCCTTGAAGG - Intronic
948215469 2:236226178-236226200 AACACAGCCAACTACCTTGAAGG - Intronic
948475528 2:238216570-238216592 AAGGGAACTCACTGCCTTGAAGG - Intergenic
1168742101 20:200636-200658 AAGGGAACCCACTGCCTTGAAGG - Intergenic
1168917204 20:1499989-1500011 AGGGAAGCCCACTGCCCTGAAGG - Intergenic
1168917260 20:1500348-1500370 AAGGGAACCCACTGCCTTGAAGG - Intergenic
1169256775 20:4105783-4105805 AAGAGAGACCCCTGCCATCACGG + Intergenic
1169617946 20:7471221-7471243 AGGTGAGCCCAGTGCCCTGAAGG - Intergenic
1169628639 20:7600499-7600521 TGGGGAGCCCACTGCCCTGAAGG + Intergenic
1169988771 20:11475140-11475162 AGCAGAGCCCACTGCCCTGAAGG + Intergenic
1170086927 20:12544343-12544365 AGGAGAATCCACTGCCCTGAAGG - Intergenic
1170086982 20:12544701-12544723 AAGGGAATCCACTGTCTTGATGG - Intergenic
1170236008 20:14105875-14105897 AAGAGAACCTGCGGCCTTGAAGG + Intronic
1170236054 20:14106156-14106178 TGGGGAGCCCACTGCCCTGAAGG + Intronic
1170311500 20:14997310-14997332 AAGGGAACCCACTGCCTTGAAGG + Intronic
1170668350 20:18406452-18406474 AAGGGAACTCACTGTCTTGAAGG + Intronic
1170668417 20:18406805-18406827 AGGGGAGCCCACTGCCCTGAAGG + Intronic
1170864081 20:20137635-20137657 GGAAGAGCCCACTGCCCTGAAGG - Intronic
1171937957 20:31293835-31293857 AAGGGAACCCACTGCTTTGAAGG + Intergenic
1171937998 20:31294080-31294102 AGGGGAGCCCACTGCCCTGAAGG + Intergenic
1171942871 20:31348473-31348495 AAGAGAATCCACTGCCTTAAAGG + Intergenic
1171943004 20:31349149-31349171 AGGGGAGCTCACTGCCCTGAAGG + Intergenic
1172203558 20:33145747-33145769 ACGGGAGGCCACTGCCCTGAAGG - Intergenic
1172419024 20:34798075-34798097 ACAAGAGCCCACTGTCCTGAAGG + Intronic
1173004201 20:39127156-39127178 ATGGGAACCCACTGCCTTGAAGG - Intergenic
1173204195 20:40979825-40979847 AAGGAAACCCACTGCCCTGAAGG - Intergenic
1173204250 20:40980191-40980213 GAGGGAGCCTACTGCTTTGAAGG - Intergenic
1174831839 20:53820495-53820517 AGGGGAGCCCACTGCCCTGAAGG - Intergenic
1174938569 20:54898621-54898643 AGGGGAGCCCACTGTCCTGAAGG + Intergenic
1175223842 20:57433450-57433472 AAGACAGGCCCCTGCCTTCACGG + Intergenic
1176067044 20:63203322-63203344 GACAGAGCCCACCGTCTTGACGG + Exonic
1177105150 21:16946042-16946064 AAGGTAAACCACTGCCTTGAAGG + Intergenic
1177137298 21:17318808-17318830 AAGGGAACCCACTGCCTTGAAGG + Intergenic
1177222260 21:18209768-18209790 AAGGGAACCTACTGCCTTGAAGG - Intronic
1177275996 21:18913633-18913655 AAGGGAAACCACTGCCTTGAAGG - Intergenic
1177569677 21:22871109-22871131 AAGGGAACCCACTGCCTTAAAGG - Intergenic
1177577975 21:22983016-22983038 AAGGGCACCCACTGCCCTGAAGG + Intergenic
1178216575 21:30605706-30605728 AAGGGAAACTACTGCCTTGAAGG + Intergenic
1178705413 21:34868760-34868782 AAGAGAACCCACAGCCTTGGGGG - Intronic
1179011136 21:37557204-37557226 AAGAGAGTGCCCTGCTTTGATGG - Intergenic
1179395887 21:41039740-41039762 AAGGGAACCTGCTGCCTTGAAGG + Intergenic
1180491091 22:15849272-15849294 AGGGGAGCCCACTGCCCTGACGG - Intergenic
1180491151 22:15849629-15849651 AAGGAAACCCACTGCCTTGAAGG - Intergenic
1183529753 22:38347038-38347060 AAGAGACCCCCTTGCCTTCATGG - Intronic
1184862513 22:47181884-47181906 AAGGGAATCCACTGCCCTGAAGG + Intergenic
1184862557 22:47182139-47182161 AGGGGAGCCCACTGCCCTGAAGG + Intergenic
1185003285 22:48259784-48259806 GAGAGTGCCATCTGCCTTGAAGG - Intergenic
949235732 3:1806317-1806339 AAGAGAACCTGCTGCCTTGAAGG - Intergenic
949448503 3:4161686-4161708 AGGGGAGCCCACTGCCCTGAAGG - Intronic
949829293 3:8197065-8197087 AAGATAACCTGCTGCCTTGAAGG - Intergenic
950695677 3:14699496-14699518 AAGGGAACCCACTGCCTTGAAGG - Intronic
951032268 3:17895642-17895664 AAGAGAACCCATTGCCTTGAAGG - Intronic
951102338 3:18703508-18703530 AAGGGAGCCCACTGCCCTGAAGG + Intergenic
951172174 3:19554972-19554994 AACAGAACCCACTGCCTTGAAGG - Intergenic
951177828 3:19622686-19622708 AAGTGAACCCACTGCCTTGAAGG - Intergenic
951181952 3:19669151-19669173 AGGGGAGCCCACTGCCCTGAAGG + Intergenic
951435432 3:22657262-22657284 AAGAGGAGCCACTGCCCTGAAGG - Intergenic
951436951 3:22676277-22676299 AAGGGAGCCCACTGCACTGAGGG - Intergenic
951437018 3:22676638-22676660 GAGGGAACCCACAGCCTTGAAGG - Intergenic
951522453 3:23622027-23622049 CAGATCCCCCACTGCCTTGAGGG - Intergenic
951819335 3:26791011-26791033 AGGAAAGCCCACTGCCCTGAAGG - Intergenic
951819397 3:26791374-26791396 AAGGGAACCCATTGCCTTGAAGG - Intergenic
951929723 3:27951906-27951928 AGGGGAGCCAACTGCCCTGAAGG - Intergenic
952132785 3:30384291-30384313 AGGGGAGTCCACTGCCCTGAAGG - Intergenic
952132838 3:30384655-30384677 AAGGGAACCTTCTGCCTTGAAGG - Intergenic
952672996 3:35993740-35993762 AAGGGAACCTACTGCCTTGAAGG + Intergenic
952811859 3:37411401-37411423 AGGGGAGACCACTGCCCTGAAGG - Intronic
952811922 3:37411762-37411784 AAGGAAACCCACTGCCTTGAAGG - Intronic
953362385 3:42309384-42309406 AGAGGAGCCCACTGCCCTGAAGG - Intergenic
953699623 3:45185713-45185735 AAGACAGGCTACTGACTTGATGG + Intergenic
954262501 3:49449671-49449693 AAGACTGCCCACAGCCTTCAAGG + Intergenic
954449834 3:50565836-50565858 AAGGGAGCCCCCTGCCTTCCTGG + Exonic
954488077 3:50873279-50873301 AAGGGAACCTGCTGCCTTGAAGG - Intronic
954491751 3:50913194-50913216 AAGAAAACCCGCAGCCTTGAAGG - Intronic
954763483 3:52894794-52894816 CAGTGAGCCCATTGCCTCGAGGG + Intronic
954879366 3:53823291-53823313 AAGGGAGACCACTACCTTCATGG + Exonic
954880267 3:53831026-53831048 AGGGGAGCCCACTGCCCTGAAGG + Intronic
955274345 3:57533221-57533243 AGGGGAGCCCAATGCCCTGAAGG - Intronic
955274408 3:57533593-57533615 AAGGGAACCTGCTGCCTTGAAGG - Intronic
955441069 3:58955945-58955967 AAGGGAACCCACTGCCTTGGAGG + Intronic
955583046 3:60445423-60445445 AAGAAAGCACACTGCTGTGATGG + Intronic
957434395 3:80154838-80154860 AAGAAAACCCACTGCCTTGAAGG - Intergenic
957621871 3:82604448-82604470 TAGAGCATCCACTGCCTTGATGG + Intergenic
957621928 3:82604815-82604837 AGGTGAGCCCACTACCCTGAAGG + Intergenic
957699238 3:83687616-83687638 ACAAGATCCCACTGCCTTCAAGG - Intergenic
957810497 3:85215203-85215225 AAGAGAGCCCACTGCCTTGAAGG - Intronic
957907633 3:86578385-86578407 AAGGGAGCCCACTGCCTTGAAGG - Intergenic
957915786 3:86686717-86686739 AAGGAAACCCATTGCCTTGAAGG + Intergenic
957976149 3:87447650-87447672 AAGGGATCCCACTGCCCTGAAGG - Intergenic
958078328 3:88712618-88712640 AGTGGAACCCACTGCCTTGAAGG + Intergenic
958085270 3:88798158-88798180 AGAGGAGCCCACTGCCCTGAAGG - Intergenic
958141159 3:89564344-89564366 AAGGGAGCCCACTGCCCTGAAGG + Intergenic
958147091 3:89639892-89639914 AAGACAACCCACTTCCTTGAAGG + Intergenic
958617582 3:96515205-96515227 AAAGGAACCCACTGCCTTAAAGG + Intergenic
958662471 3:97088464-97088486 CAGAGAACCCACAGACTTGAGGG - Intronic
958669107 3:97180271-97180293 AGGAGTGCCCAATGCCCTGAAGG - Intronic
958682791 3:97353048-97353070 AAGGAATCCCACTGCCTTGAAGG + Intronic
958756870 3:98260029-98260051 AGGGGAGCCCACTGCCTGAAGGG - Intergenic
958839952 3:99191654-99191676 AAGGGGACCCACTGCCTTGAAGG + Intergenic
958876649 3:99624573-99624595 AAGGGAACCTGCTGCCTTGAAGG + Intergenic
958876706 3:99624959-99624981 AGAGGAGCCCACTGCCCTGAAGG + Intergenic
959113472 3:102149057-102149079 AGTGGAGCCCACTGCCCTGAAGG + Intronic
959127488 3:102307822-102307844 AAGGGAACCGATTGCCTTGAAGG + Intronic
959189846 3:103097359-103097381 AGGGGAACCCACTGCCCTGAAGG - Intergenic
959285030 3:104397747-104397769 AAGGGAACCTGCTGCCTTGAAGG + Intergenic
959409087 3:105997883-105997905 AAGGGAACCCATTGCCTTGAAGG - Intergenic
959413992 3:106061700-106061722 AAGGGCACCCACTACCTTGAAGG + Intergenic
959640170 3:108623412-108623434 AAATGAATCCACTGCCTTGAAGG - Intronic
959725059 3:109533482-109533504 AAGAGAATCCTCTGCCTTGAAGG - Intergenic
959762025 3:109977079-109977101 AAGGGAACCTGCTGCCTTGAAGG - Intergenic
959913694 3:111793421-111793443 AGGGGAGTCCACTGCCCTGAAGG - Intronic
959913754 3:111793757-111793779 AAGGGAGCCCACTGCCTAGAGGG - Intronic
960067349 3:113387802-113387824 AGGAAAGCCCACTGTCCTGAAGG + Intronic
960153510 3:114274877-114274899 AAGGGAGCCCACTGCCCCGAAGG - Intergenic
960153558 3:114275238-114275260 AAGAGAACCAGCTGCCTTGAAGG - Intergenic
960298103 3:115968437-115968459 AAGAGAACCTGCTGCTTTGAAGG - Intronic
960490720 3:118313946-118313968 AAGGGAACCTATTGCCTTGAAGG + Intergenic
960521198 3:118657843-118657865 AAGGGAACCCACTGCCTTGAAGG - Intergenic
960541169 3:118864263-118864285 AAGGGAGCCCACTGCCCTGAGGG - Intergenic
960564886 3:119122768-119122790 AAGTGAACCCACTGCCTTGAAGG + Intronic
960619020 3:119621481-119621503 ATGGGAGCCCAGTGCCATGATGG - Intronic
960681236 3:120249597-120249619 GAGGGAACCCACTGCATTGAAGG + Intronic
960681299 3:120249952-120249974 AGGGGAGCCCACTGTCCTGAAGG + Intronic
960870044 3:122239177-122239199 AGGGGAGCCCATTGCCTTGAAGG + Intronic
961610437 3:128132999-128133021 AGGGGAGCCTACTGCCCTGAAGG + Intronic
961952268 3:130762374-130762396 AAGGGAACCCACTGCCTTGAAGG + Intergenic
961986253 3:131138167-131138189 AGGGGAACCCACTGCCCTGAGGG + Intronic
962015127 3:131431496-131431518 AAGGGAACCCACTGCCTTGAAGG + Intergenic
962038806 3:131683367-131683389 AAGGAAGCCTACTGCCTTGAAGG - Intronic
962078658 3:132114110-132114132 CTGAGAACTCACTGCCTTGAAGG - Intronic
962151909 3:132902482-132902504 AAAGGAACCCACTGCCTTGAAGG + Intergenic
962193607 3:133336805-133336827 AGGGGAGCCCACTGCCCTGAAGG + Intronic
962483297 3:135816379-135816401 AAGGGAGCCCACTGCCTTGAAGG + Intergenic
962638781 3:137361376-137361398 AAGGGAACCCACTTCCCTGAAGG - Intergenic
962688350 3:137868797-137868819 AAGAAAGGCCACTGTCTTGAAGG + Intergenic
962688393 3:137869050-137869072 AAGGGAGCCCACTGCCCTGAAGG + Intergenic
962698988 3:137978826-137978848 AGGGGAGCCCACTACCCTGAAGG - Intergenic
962759155 3:138492923-138492945 TAGGGAAGCCACTGCCTTGAAGG - Intergenic
962767551 3:138579619-138579641 AAAGGAGCCCACTGCCTTGGAGG + Intronic
962862606 3:139418750-139418772 AAGGGAGCCCATTGCTCTGAAGG - Intergenic
962870827 3:139491576-139491598 AAGGGAACCCACTGCCCTGAAGG - Intergenic
962899331 3:139745307-139745329 TAGAGAGCCTACTGCCTAGCAGG - Intergenic
963021064 3:140873506-140873528 AAGATAGTCCCCTGCCCTGACGG - Intergenic
963154095 3:142077580-142077602 AAGGGAACCTACTGCCTTGAAGG + Intronic
963310057 3:143700089-143700111 AAGGGAACCCACTGCCTTAAAGG + Intronic
963365055 3:144323843-144323865 AAGAGAGCCCACTCCCTGAAGGG + Intergenic
963411293 3:144931346-144931368 AAGGGAACCTACTGCCTTAAAGG + Intergenic
963411352 3:144931703-144931725 ACGGGAGCCCACTGCCCTGAAGG + Intergenic
963515274 3:146301074-146301096 AAGGGAACCCACTGCAATGAAGG + Intergenic
963571986 3:147009039-147009061 AAGGGAACCCACTGACTTGAAGG - Intergenic
963591761 3:147269646-147269668 AAGGAAACTCACTGCCTTGAAGG + Intergenic
963676218 3:148315136-148315158 AAGAGAACCCACTGACTTGAAGG + Intergenic
963692288 3:148519495-148519517 AGGGGAGCACACTGCCCTGAAGG + Intergenic
963763383 3:149308063-149308085 AAGGGAACCCATTGCCTTAAAGG - Intergenic
963802306 3:149688197-149688219 AAGGGAACCCACTGCCCTGAAGG + Intronic
963995936 3:151708911-151708933 AAGGGAACCCACTGCCTTGAAGG + Intergenic
964059629 3:152505590-152505612 AAGGGAACCCACTGCCTTGAAGG - Intergenic
964140747 3:153396543-153396565 AAGGGAACCTGCTGCCTTGAAGG - Intergenic
964179367 3:153865269-153865291 AAGAGACCCCACTGCCTTGAAGG + Intergenic
964209280 3:154210133-154210155 AGGGGAGCCCACTGCCCTGAAGG - Intronic
964239478 3:154574627-154574649 AAGGGAAGCCACTTCCTTGAAGG + Intergenic
964339006 3:155688652-155688674 AAGGGAGTCCACTGCCTTGAAGG + Intronic
964686789 3:159404393-159404415 AGAGGAGCCCACTGCCCTGAAGG + Intronic
964871663 3:161319556-161319578 AAGGGAATCCACTGCCTTGAAGG + Intergenic
964936483 3:162094993-162095015 AAGAAAACCTACTGTCTTGAAGG - Intergenic
965014597 3:163140566-163140588 AAGGGAATCCATTGCCTTGAAGG - Intergenic
965026133 3:163303931-163303953 AAGGGATGCCATTGCCTTGAAGG + Intergenic
965059979 3:163773069-163773091 AGGGGAGCCTACTGCCCTGAAGG - Intergenic
965118303 3:164519985-164520007 AGGGGAGCCCAGTGCCCTGAAGG - Intergenic
965209630 3:165768277-165768299 AAGAGAACCTGCTGCCTTGAAGG - Intergenic
965236920 3:166136420-166136442 AAGAGAACTCACTGCCTTGAAGG - Intergenic
965317366 3:167208922-167208944 AAGAGAGGCCACTGCATTAACGG + Intergenic
965349942 3:167599471-167599493 AGGAGAGCCCACTGCCCTGAAGG - Intronic
965350882 3:167609946-167609968 AAGGGAACCCACTACCCTGAAGG + Intronic
965358671 3:167709987-167710009 AATGGAGCTCACTGCCCTGAAGG + Intronic
965380646 3:167983434-167983456 ATAGGAGCCCACTGCCCTGAAGG + Intergenic
965415158 3:168384256-168384278 AGGGGAGCCCAGTGCCCTGAAGG - Intergenic
965415214 3:168384574-168384596 AAGGGAACCCACTGCCTTGAAGG - Intergenic
965742417 3:171889949-171889971 AAGGGAACTCACCGCCTTGAAGG - Intronic
965844482 3:172946110-172946132 AAGGGAACCTGCTGCCTTGAAGG + Intronic
965860750 3:173146847-173146869 AAGGGAACCCACTGCGTTGAAGG + Intergenic
965867056 3:173217039-173217061 AAGAGAACCCCCTACCTTAAAGG - Intergenic
965975315 3:174613669-174613691 AAAGGAGCCTACTGCCCTGAAGG - Intronic
966151641 3:176873385-176873407 AAGAAAACCTGCTGCCTTGAAGG + Intergenic
966313064 3:178615913-178615935 AAGAGAACCCACTGCCTTGAAGG - Intronic
966328996 3:178790162-178790184 AAGGGAACCTACTGCCTTGAAGG + Intronic
966400901 3:179546219-179546241 AAGGGAACCCACAGTCTTGAAGG + Intergenic
966453965 3:180094154-180094176 AATGGAGCCCACTGACTTGAAGG - Intergenic
966468229 3:180256408-180256430 AAGGGAAACCACTGCCTTGAAGG + Intergenic
967608918 3:191481610-191481632 AAGGGAACCTGCTGCCTTGAAGG + Intergenic
967677447 3:192316994-192317016 AAAGGAACCCAATGCCTTGAAGG + Intronic
967677561 3:192317651-192317673 AAGGGAACTCGCTGCCTTGAAGG + Intronic
967696995 3:192543755-192543777 AAGGGAATCCACTGCCTTGAAGG - Intronic
968004906 3:195236173-195236195 AAGAGAACTCACTGCCCTTAAGG - Intronic
968005032 3:195236839-195236861 AAGGGAGCCTACTGCCCTGAAGG - Intronic
968018047 3:195357084-195357106 AAGGGAACTCACTGCCCTGAAGG + Intronic
968334389 3:197900844-197900866 AAGGGAACCCACTGCCTTGTAGG + Intronic
968429133 4:544934-544956 AATGGAGCCCCCTGCCTTGAAGG - Intergenic
969106842 4:4812820-4812842 AACATAGGCCACTGCCTGGATGG + Intergenic
970071239 4:12162193-12162215 AAGGGAACCCACTGGCTTGAAGG - Intergenic
970098002 4:12486922-12486944 AAAGGAACCCACTTCCTTGAAGG - Intergenic
970413392 4:15833112-15833134 AGGGGAGCCCACTGCTTTGAAGG - Intronic
970442471 4:16093610-16093632 ATGAAAGCCCACTGCCCTAATGG + Intergenic
970667499 4:18354307-18354329 AAGGGAACCTGCTGCCTTGAAGG - Intergenic
970892826 4:21067154-21067176 AAGATAACCTGCTGCCTTGAAGG + Intronic
971095696 4:23399581-23399603 AAAGGAACCCACTGCCTTAAAGG - Intergenic
971263457 4:25077319-25077341 AAGACAGCCCCCTGCCCTCAAGG + Intergenic
971567855 4:28168270-28168292 AAGGGAACCTGCTGCCTTGAAGG - Intergenic
971914498 4:32850734-32850756 AAGGGAGTCCACTGCCCTGATGG - Intergenic
972021657 4:34323375-34323397 AGGAGAGCTCACTGCCCTGCAGG + Intergenic
972125320 4:35758364-35758386 AAGGAAGACCACTACCTTGAAGG - Intergenic
972207807 4:36798922-36798944 AAGGAAGCCCACTGTCCTGATGG + Intergenic
972237471 4:37150674-37150696 AAGGGAACCCACTGCCTTAAAGG - Intergenic
972253841 4:37332847-37332869 CAGGGAGCCCATTGCCCTGAAGG + Intronic
972468811 4:39384318-39384340 AAGAGAACCCACTGCCTTGAGGG - Intergenic
972851633 4:43057510-43057532 CAGGGAGCCCACTGTCTTAAAGG + Intergenic
972902347 4:43700462-43700484 AGGAGAGCCCACTGCCCTGAAGG - Intergenic
972902717 4:43704015-43704037 AAGGAGGCCCACTGCCCTGAAGG - Intergenic
973327468 4:48878039-48878061 ATGAGATCACACTGCCTTGAAGG - Intergenic
973852804 4:54977689-54977711 AGGAGAGCCCACTGCCCTGCAGG + Intergenic
974285679 4:59864446-59864468 AAGGGAACTCACTGCCCTGAAGG - Intergenic
974290306 4:59921167-59921189 AAGAGAACTCACTGGCTTTAAGG + Intergenic
974298956 4:60040442-60040464 AGGAGATCCCACTGCCCTGAAGG - Intergenic
974309610 4:60187870-60187892 AAGAGAACCTACTACCTTGAAGG + Intergenic
974593232 4:63983225-63983247 AGAAGAGCCCACTGCCCTGAAGG - Intergenic
974630368 4:64480381-64480403 ATGGGAACCCGCTGCCTTGAAGG - Intergenic
975095300 4:70450328-70450350 AGGGGAGCCCACTGTCCTGAAGG - Intronic
975095354 4:70450690-70450712 AAGGGAACCTGCTGCCTTGAAGG - Intronic
975095623 4:70453510-70453532 AAGGGAGCCCAGTGCCCTGAAGG - Intronic
975295284 4:72727117-72727139 AAGGGAACCCACTTCCCTGAAGG + Intergenic
975313109 4:72925373-72925395 AGGGGAGCCCACTGCCATGAAGG - Intergenic
975369526 4:73568483-73568505 AAGTGAACCCACTGCCTAGAAGG - Intergenic
975503925 4:75117503-75117525 AGGAAAGCCCACTACCCTGAAGG + Intergenic
975525373 4:75343064-75343086 AATACAGCCCACTTCTTTGAAGG - Intergenic
975592818 4:76017317-76017339 AAGGGAACCTGCTGCCTTGAAGG - Intronic
975629653 4:76387329-76387351 AAGGGAACCCATTGCCTTGAAGG + Intronic
976016386 4:80560216-80560238 AAGGGAAACCTCTGCCTTGAAGG + Intronic
976041118 4:80885962-80885984 AGGGGAGCCCACTGCCTTGAAGG + Intronic
976128664 4:81860462-81860484 AAGGGAACCCACTGTCTTGAAGG + Intronic
976278329 4:83301236-83301258 AAGAGGGCCCACTGTCATTATGG - Intronic
976444075 4:85110311-85110333 AAGTGAACCTGCTGCCTTGAAGG + Intergenic
976453898 4:85223494-85223516 AAGGGAACCCACTGTCTTGAAGG - Intergenic
976722084 4:88178678-88178700 AGGGGAGCCCACTGCCTGAAGGG + Intronic
976762805 4:88568704-88568726 AAGACAACCCACTGACTTGAAGG - Intronic
976943782 4:90739210-90739232 AAGGGAACCCACTGCCCTAAAGG - Intronic
976982091 4:91244022-91244044 AGGAGAGTCCACTGCCCTGAAGG + Intronic
977044382 4:92050981-92051003 AAGGGAACCCACTGCCTTGAAGG + Intergenic
977178606 4:93845486-93845508 AAGACAGATCACTGCCTTCATGG + Intergenic
977307490 4:95342786-95342808 AGGGGGGCCCACTGCCCTGAAGG + Intronic
977325676 4:95572201-95572223 AGGAGAGCCCACTGCCCTGAAGG - Intergenic
977399170 4:96510020-96510042 AGGGGAGCCCACTGTCCTGAAGG + Intergenic
977399312 4:96511253-96511275 AGGGGAGCCTACTGCCCTGAGGG + Intergenic
977521858 4:98094598-98094620 AGGGGAGCCCACTGACCTGAAGG + Intronic
977744965 4:100535693-100535715 AAAGGAGCCTACTGCTTTGAAGG + Intronic
977753386 4:100635676-100635698 AGGAGAGCCCATTGCCCTGAAGG + Intronic
977854771 4:101876095-101876117 TAGGGAACCCACTGCCTTGAAGG + Intronic
977873663 4:102123787-102123809 AGGGGAGCCCACTACCCTGAAGG - Intergenic
978008630 4:103651476-103651498 ATGGGAGCCCACTGCCCTGAAGG - Intronic
978008687 4:103651833-103651855 AAGGGAACCCACTGCCTTGAAGG - Intronic
978116095 4:105022150-105022172 AGGGGAGCCCACTGCCTTGAAGG + Intergenic
978116453 4:105025063-105025085 AAGGGAACCCACTGCCTTGAAGG + Intergenic
978116505 4:105025406-105025428 AAGGGAGACCACTGCCCTGAAGG + Intergenic
978212690 4:106157088-106157110 AAGGGAACCTGCTGCCTTGAAGG - Intronic
978258258 4:106718712-106718734 AAGGGAACCTGCTGCCTTGAAGG + Intergenic
978258321 4:106719071-106719093 AGGGGAGCCTACTGCCCTGAAGG + Intergenic
978261701 4:106768056-106768078 AAGGGATCCCACTGCCTTGAAGG + Intergenic
978810392 4:112842905-112842927 CAGAGAGCCCACAGCCCTGCGGG - Intronic
978922412 4:114200591-114200613 AGGAAAGACCACTGCCCTGAAGG - Intergenic
978922454 4:114200875-114200897 AAGGGAACCTACTGCCTTGGAGG - Intergenic
978934577 4:114359380-114359402 AGGGAAGCCCACTGCCCTGAAGG - Intergenic
978936989 4:114389478-114389500 GAGAGAGCTGACTGCCTTGCAGG - Intergenic
979184609 4:117772619-117772641 AAGGGAACCGGCTGCCTTGAAGG + Intergenic
979413495 4:120407036-120407058 AGGGGAGCCCATTGCCCTGATGG + Intergenic
979504436 4:121479742-121479764 AGGAGAGCCCACTGCCCTGAAGG - Intergenic
979572960 4:122252053-122252075 AAGGGAACCCACTGCATTGAAGG + Intronic
979573016 4:122252409-122252431 CAGGGAGCCCACTGTCCTGAAGG + Intronic
979594970 4:122525079-122525101 AGGGGATCCCACTGCCCTGAAGG - Intergenic
979945853 4:126830437-126830459 AAGTGAGCCCACTGCCCTGAAGG + Intergenic
980347195 4:131636236-131636258 AATAGAACCCACTGTCTTGAAGG + Intergenic
980442934 4:132871087-132871109 AAGGGAGCCTGCTGCCTTGAAGG + Intergenic
980442981 4:132871446-132871468 AGGGGAGTCCACTGCCTTGAAGG + Intergenic
980660787 4:135855374-135855396 AGGGGAGCCCACTGCCCTAAAGG - Intergenic
980660837 4:135855732-135855754 AAGGGAACCTACTGCCTTGAAGG - Intergenic
980686803 4:136240102-136240124 AAGGGAACCCTCTGCCTTGATGG + Intergenic
980752980 4:137116321-137116343 AAGAGAACCCACTACCTCAAAGG + Intergenic
980960592 4:139470777-139470799 AAGGGAACCTGCTGCCTTGAAGG - Intronic
981298091 4:143156158-143156180 AGGTGAGCCCACTACCCTGAAGG - Intergenic
981483867 4:145264358-145264380 AAGAGAGCCCACTGCTGTGTGGG + Intergenic
981518325 4:145634448-145634470 AGGGGAGCCCACTGCCCTGAAGG - Intronic
981558644 4:146023294-146023316 AAGAGAACCTGCTGCCTTGAAGG - Intergenic
981836822 4:149064547-149064569 AAGGGAACCTGCTGCCTTGAAGG + Intergenic
981837002 4:149065580-149065602 AGGGGAGCTCACTGTCTTGAAGG + Intergenic
981871068 4:149486820-149486842 AGGGGAGCCCACTGCCCTGAAGG - Intergenic
981895623 4:149795828-149795850 AAGGGAACACACTGCCTTGAAGG + Intergenic
981895677 4:149796169-149796191 AGGGGAGCCCACTCCCTTGAAGG + Intergenic
981975532 4:150723463-150723485 AAGTGAACCCAGTGCCTTGAAGG + Intronic
981996130 4:150977401-150977423 AAGGGAACCCGCTGCCTTGAAGG + Intronic
982339876 4:154285490-154285512 AGGGGAGCCTACTGCCTTGAAGG + Intronic
982615280 4:157633542-157633564 AAGGTAACCCCCTGCCTTGAAGG + Intergenic
982683353 4:158459052-158459074 AGGGGAGCCCACTTCCCTGAAGG - Intronic
982719718 4:158847497-158847519 AAAGGAACCCGCTGCCTTGAAGG + Intronic
982899555 4:160981038-160981060 AAGAGATCCTGCTGCCTTGAAGG - Intergenic
982911534 4:161148621-161148643 AAAGGAAGCCACTGCCTTGAAGG + Intergenic
983165939 4:164477450-164477472 GAGGGAGCCCACTGCCATGAAGG - Intergenic
983165998 4:164477808-164477830 AAAAGAACCTGCTGCCTTGAAGG - Intergenic
983456304 4:167968885-167968907 AGGGGACCCCACTGCCCTGAAGG + Intergenic
983839428 4:172438202-172438224 CTGAGAGACCACTGCATTGAAGG - Intronic
983860620 4:172701496-172701518 AAGACAGAAGACTGCCTTGATGG - Intronic
984068535 4:175081982-175082004 AAGGGAACCCACTGCCTTGAAGG - Intergenic
985384768 4:189434102-189434124 AAGGGAACCCACTACTTTGAAGG - Intergenic
985675051 5:1226643-1226665 AAGAGACCCCAGTGCCCCGAGGG - Intronic
986262417 5:6160023-6160045 AAGAGAGGGCACTGCCTCCATGG - Intergenic
986544425 5:8879995-8880017 AGGAGAGCCCACTTCCCTGAAGG - Intergenic
986548318 5:8924171-8924193 AAGGTAACCCACTGCCTTGAAGG + Intergenic
986631198 5:9775681-9775703 AAGGGAACCCACTGCCTTGAAGG - Intergenic
986756282 5:10839619-10839641 AAGAGAATCCACTGCCTTGAAGG + Intergenic
986812249 5:11372903-11372925 AGGAGAGACCACGGCATTGATGG - Intronic
986885215 5:12225925-12225947 AGGGGAGCCCACTTCCCTGAAGG - Intergenic
986899392 5:12413159-12413181 AAGGGAAACCACTGCCTTGAAGG - Intergenic
987163946 5:15174206-15174228 AAGGGAACCCATGGCCTTGAAGG + Intergenic
987163994 5:15174452-15174474 AGGAGAGCCCACTGTACTGAAGG + Intergenic
987496556 5:18652701-18652723 AAGAGAACTTACTGCCCTGAAGG - Intergenic
987564257 5:19564469-19564491 AAGGGAACCTGCTGCCTTGAAGG + Intronic
987616089 5:20276441-20276463 AAGGGAACCCACTGTCTTGAAGG + Intronic
987823077 5:22991264-22991286 AAGGAAACCCACTGCCTTGAAGG + Intergenic
988117868 5:26920137-26920159 AAGGAAGCCCACTTCCCTGAAGG + Intronic
988299379 5:29403395-29403417 AAGGGAACCCACTGCCTTGAAGG + Intergenic
988299425 5:29403631-29403653 AGGAGAGTCCACTTCCCTGAAGG + Intergenic
988376257 5:30439547-30439569 AAGGGAGCCCACTTCCCTGAAGG + Intergenic
988608472 5:32703210-32703232 AGGGGAGCCCAGTGCCCTGAAGG - Intronic
988931665 5:36041051-36041073 AAGAGAACCTGCTGCCCTGAAGG + Intronic
989215364 5:38899649-38899671 AAGAGAACCTGTTGCCTTGAAGG - Intronic
989427833 5:41316615-41316637 GAGGGAGCCCACTGCCCTGAAGG + Intronic
989504811 5:42215387-42215409 AGGGGAGCCCACTGCCCTGAAGG - Intergenic
989628937 5:43461186-43461208 AAGGGAAACCCCTGCCTTGAAGG + Intronic
989681214 5:44031950-44031972 AAGGGAACCCACTGCCTTGAAGG + Intergenic
989723120 5:44553405-44553427 AGGTGAGCCCACTGCTCTGAAGG - Intergenic
990202776 5:53397037-53397059 AAGGGAGCCCACTGCCCTGAAGG - Intergenic
990202835 5:53397389-53397411 AAGGGAACCCACTGCTTTGAAGG - Intergenic
990579074 5:57150944-57150966 AAGGGAAACCACTGCCCTGAAGG - Intergenic
990827904 5:59922606-59922628 AAGGGAACCTGCTGCCTTGAAGG + Intronic
990899912 5:60739069-60739091 AAGAGAAACTGCTGCCTTGAAGG + Intergenic
990923779 5:60996030-60996052 AGGGGAGCCCACTGTCCTGAAGG - Intronic
990933100 5:61115299-61115321 AAGAAAGCCCACTGCCCTGAAGG - Intronic
990978668 5:61581735-61581757 TAGAGAGCCTACTCACTTGAAGG - Intergenic
991080582 5:62594772-62594794 GAGAGAGCCCACAACCTAGAAGG + Intronic
991237837 5:64419457-64419479 AAGGGAACTCACTGCCCTGAAGG + Intergenic
991297193 5:65093746-65093768 AAGACAGCCCACTGCACTGAAGG + Intergenic
991395322 5:66198758-66198780 AAGGGAACCCACTGTCTTGAAGG - Intergenic
992284983 5:75225917-75225939 AGGGGAGCCCACTGCTCTGAAGG + Intronic
992291332 5:75283181-75283203 AAGGGAACCCTCTGCCTTGAAGG + Intergenic
992531820 5:77659555-77659577 AAGGGAACCCCCTGCTTTGAGGG - Intergenic
992587176 5:78252443-78252465 AAGGGAGCCCACTGTCCTGAAGG + Intronic
992657213 5:78922451-78922473 AAGGGAGCCCACTACCTTGAAGG + Intronic
992934502 5:81687755-81687777 TAGGGAACCCACTGTCTTGAAGG + Intronic
992934561 5:81688101-81688123 AAGGAAGCCCACTGTCCTGAAGG + Intronic
993197285 5:84764909-84764931 AAGGGAACCCACTTCCTTGAAGG - Intergenic
993257051 5:85605014-85605036 AAAGGAAACCACTGCCTTGAAGG + Intergenic
993279343 5:85905312-85905334 AAGGGAACCTGCTGCCTTGAAGG + Intergenic
993287389 5:86016576-86016598 AAGAGAACCTATTGCCTTGAAGG - Intergenic
994028543 5:95114041-95114063 AAGAGAACCTACAGGCTTGAAGG + Intronic
994217831 5:97158999-97159021 AGGGGATCCCACTGCCCTGAAGG - Intronic
994235582 5:97358491-97358513 AGGGGAGCCCACTGCCCTAAAGG - Intergenic
994264656 5:97700421-97700443 AGGGGAGCCCACTTGCTTGAAGG + Intergenic
994292918 5:98051084-98051106 AAGGGAACCCACTGCCTTGGAGG + Intergenic
994309997 5:98258883-98258905 AAGAGAGCACATTGCCTGGAAGG - Intergenic
994428719 5:99628145-99628167 AGGGGAGCCCACTGCCCTGAAGG - Intergenic
994477694 5:100291169-100291191 AAGGAAACCCTCTGCCTTGAAGG - Intergenic
994529943 5:100956602-100956624 AAGAGAATCCACTACCTTGAAGG + Intergenic
994659978 5:102641760-102641782 AAGAGAAACTATTGCCTTGAAGG + Intergenic
994845769 5:104986895-104986917 AGGGGAGCCCACTGCCCTGAAGG - Intergenic
994974081 5:106779872-106779894 AAGAGAACCCTCTGCCTTGAAGG + Intergenic
995265269 5:110152389-110152411 AAGGAAACTCACTGCCTTGAAGG + Intergenic
995371874 5:111427509-111427531 AGGGGAGCCCACTGCCATGAAGG + Intronic
995514857 5:112944191-112944213 AGGGGAGCCTACTGCCCTGAAGG + Intergenic
995697772 5:114899465-114899487 AGGGGAGCCCACTGCCCTTAAGG - Intergenic
995697831 5:114899826-114899848 AAGGTAACCCATTGCCTTGAAGG - Intergenic
995770582 5:115665118-115665140 AAGGGAACCTGCTGCCTTGAAGG + Intergenic
995770634 5:115665475-115665497 AGAAGAGCCCACTACCCTGAAGG + Intergenic
995778002 5:115746130-115746152 AAGGGAACCCACTGCCTTGAAGG - Intergenic
996133378 5:119809327-119809349 AGGAGAGCCCATTGCCCTGAAGG - Intergenic
996161599 5:120173606-120173628 AAGGGAACCCTCTGCCTTGAAGG + Intergenic
996166436 5:120229260-120229282 AAGAGATCCCATTGTCTTGAAGG - Intergenic
996210124 5:120798365-120798387 AAGGGAACCCACTACCTTGCAGG + Intergenic
996210172 5:120798721-120798743 AGGAGAGCCCACTGTCCTGAAGG + Intergenic
996486186 5:124038044-124038066 AAAAGAGCCAACTGGCTTGAAGG + Intergenic
996961480 5:129255471-129255493 AAGGGAGCCCACTGCCCTAAAGG - Intergenic
996968309 5:129331714-129331736 AAGGGAACCCGCTGCCCTGAAGG + Intergenic
997073311 5:130642645-130642667 AAGGGAACCTGCTGCCTTGAAGG - Intergenic
997104592 5:131004404-131004426 AAGGGAATCCACTGCCTTGAAGG + Intergenic
997186199 5:131884435-131884457 AAGGGAACCCACTGCCTTGAAGG + Intronic
997402038 5:133611293-133611315 AAGAAACCCCACTGCCTCGGCGG + Intronic
997832676 5:137164674-137164696 AGGAGAGCCCATTGCCCTGAAGG + Intronic
998058170 5:139096947-139096969 AAGGGAGCCCACTGCGCTGAAGG + Intronic
998695202 5:144630745-144630767 AAGGGAACCCACTGCCTTGAAGG + Intergenic
998716365 5:144889332-144889354 AAGAGAACTGGCTGCCTTGAAGG + Intergenic
998716422 5:144889683-144889705 AGGGGAGCCCACTGCTCTGAAGG + Intergenic
999406564 5:151312242-151312264 AGGGTAGCCCACTGCCTTGAAGG - Intergenic
999406614 5:151312496-151312518 AAGGGAACCCACTGTCTTGAAGG - Intergenic
999559521 5:152785663-152785685 AAAGAAACCCACTGCCTTGAAGG + Intergenic
999849468 5:155523102-155523124 AGGGGAGCCTACTGCCCTGAAGG - Intergenic
1000498820 5:162021647-162021669 AAGGGAACTCTCTGCCTTGAAGG + Intergenic
1000539349 5:162520648-162520670 AAGGAAGCCTGCTGCCTTGAAGG - Intergenic
1000651305 5:163822021-163822043 AGGGAAGCCCACTGCCCTGAAGG - Intergenic
1000651353 5:163822276-163822298 AAGGGAACCCTCTACCTTGAAGG - Intergenic
1000806826 5:165805725-165805747 AAGGGAACCCATTGCCTTGAGGG - Intergenic
1003493358 6:6642572-6642594 AAGAATGTCCACTGCCTTCAGGG - Intronic
1004041735 6:11985833-11985855 AAGAGAGCCCACTTTATAGAAGG + Intergenic
1004271415 6:14199473-14199495 AAGAGAGTTCACTGCTTTGAGGG + Intergenic
1004983032 6:21047559-21047581 AAAAGTGCCCACTGACTTAAAGG - Intronic
1005345809 6:24889228-24889250 ATGAGCTCTCACTGCCTTGAGGG - Intronic
1005981437 6:30839864-30839886 AAAGGAGCCCAGTGCCTTGAGGG - Intergenic
1006554285 6:34852369-34852391 AATGGAACCCACTGCCTTGAAGG - Intronic
1007021896 6:38529044-38529066 AAGGGAGCCCACTGCCCTGAAGG + Intronic
1008017885 6:46541767-46541789 AGGGGAGCCCACTGCCCTGAAGG + Intergenic
1008101055 6:47391932-47391954 AAGGGAACCCATTGCCCTGAAGG - Intergenic
1008177645 6:48288353-48288375 AAGGGAACCTGCTGCCTTGAAGG - Intergenic
1008192337 6:48475385-48475407 AAGGGAACCTACTGCCCTGAAGG + Intergenic
1008642057 6:53474279-53474301 AAGGGATCCTATTGCCTTGAAGG - Intergenic
1008707536 6:54181402-54181424 AAGGGAGCCCATTGCCTGAAGGG - Intronic
1008707591 6:54181755-54181777 AAGAGAACCCGCTGCCTTGAAGG - Intronic
1008752810 6:54757565-54757587 AAGGGAGTCCACTGCCCTGAAGG - Intergenic
1008857914 6:56113467-56113489 AAGTAAACCCACTGCCTTGAAGG + Intronic
1009039326 6:58158198-58158220 AAGGGAGCCCACTGCCATGAAGG - Intergenic
1009215225 6:60913041-60913063 AAGGGAGCCCACTGCCATGAAGG - Intergenic
1009266481 6:61561733-61561755 AGAGGAGCCCACTGCCCTGAGGG - Intergenic
1009687777 6:66986380-66986402 AGGGGAGCCCACTGACTTGAAGG - Intergenic
1009744821 6:67798862-67798884 AAGAGAACAAACTGCCCTGAAGG + Intergenic
1009771251 6:68145322-68145344 AAGGGAACCTGCTGCCTTGAAGG - Intergenic
1009782903 6:68293210-68293232 AATGGAACCCACTGACTTGAAGG + Intergenic
1009893809 6:69721818-69721840 AAGGGAGCCCATTGCCCTGCAGG + Intronic
1009978490 6:70699786-70699808 AGAGGAGCCCACTGCCTTGAAGG - Intronic
1009978652 6:70700876-70700898 AAGGGAACCCACTGCCTTGAAGG - Intronic
1010018723 6:71135327-71135349 AAGGGAACCCACTGCCCTGAAGG + Intergenic
1010299477 6:74243471-74243493 AGGGGAGCCCACTGCCCTGAAGG - Intergenic
1010325035 6:74554638-74554660 AAGGAAACTCACTGCCTTGAAGG + Intergenic
1010325087 6:74554993-74555015 AGGGGAGCCCACTGCCCTGAAGG + Intergenic
1010343189 6:74781337-74781359 AGGGGAACTCACTGCCTTGAAGG + Intergenic
1010343239 6:74781694-74781716 AGGGGAGCCCACTTCCCTGAAGG + Intergenic
1010528859 6:76941939-76941961 AAGGGAACCCACTGTCTTGAAGG + Intergenic
1010596498 6:77769751-77769773 AAGGGAACCCATTGCCTTGAAGG + Intronic
1011033225 6:82944721-82944743 AGGGGTGCCCACTGCCCTGAAGG + Intronic
1011232522 6:85178723-85178745 AAGGGACCTCACTGCCCTGAAGG - Intergenic
1011291195 6:85779151-85779173 AAGGGAACTCACTGCCTTGAAGG - Intergenic
1011322809 6:86115828-86115850 AGGGGAGCACACTGCCCTGAAGG - Intergenic
1011343268 6:86340711-86340733 AAGGGAGCTCACTTCCTTAAAGG + Intergenic
1011433114 6:87309103-87309125 AAGAGAAGCCACAGCCTTGGCGG + Intronic
1011446944 6:87451424-87451446 AAGGGAACCCATTGCCCTGAAGG + Intronic
1011598356 6:89037658-89037680 AAGGGAAACTACTGCCTTGAAGG + Intergenic
1012059626 6:94462523-94462545 AGGAGAACCCACTGCCCTGAAGG - Intergenic
1012190753 6:96276947-96276969 AAGGTAACCCACTTCCTTGAAGG + Intergenic
1012483117 6:99689962-99689984 AGGGGAGCCCAATGCCCTGAAGG + Intergenic
1012620590 6:101339598-101339620 AGGGGAGCCCACCGCCCTGAAGG - Intergenic
1012715279 6:102660946-102660968 ATGAGAACCCACTGTCCTGAAGG + Intergenic
1012827375 6:104163091-104163113 AGGGGAGCCCACTGCCCTGAAGG + Intergenic
1012827624 6:104165336-104165358 AAGAGAACCTGCTACCTTGAAGG + Intergenic
1013908576 6:115246838-115246860 AGGAGATCCCACTGCCCTGATGG + Intergenic
1013925648 6:115468536-115468558 AAGGGAACTCACTGCCTTGAAGG - Intergenic
1014234589 6:118940157-118940179 GAGGGAACCCACTGCCTTGAAGG + Intergenic
1014234655 6:118940542-118940564 AGGAGAGCCCACTGCCCTGAAGG + Intergenic
1014542396 6:122692573-122692595 ATGGGAGCCCACTGCCCTGAAGG - Intronic
1014583065 6:123162060-123162082 AGGGGAGCCCACTGCCCTGAAGG + Intergenic
1014832128 6:126115178-126115200 GAGGAAGCCCTCTGCCTTGAAGG - Intergenic
1014840823 6:126218465-126218487 AAGTGAAACCACTGCATTGAAGG - Intergenic
1014865226 6:126521146-126521168 AGGGGAGCCCACTTCCCTGAAGG - Intergenic
1015030281 6:128586539-128586561 AAGGGAACCCACTGCCTTAAAGG + Intergenic
1015460737 6:133487992-133488014 AGGGGTGCCCACTGCCCTGAAGG + Intronic
1015578786 6:134701579-134701601 GAGGGAGCCCACTTCCCTGAAGG - Intergenic
1016135191 6:140532308-140532330 AAGAGAACCAACTTCCTTAAAGG + Intergenic
1016151116 6:140744467-140744489 AAGGAAACCCACTGCCTTGAAGG + Intergenic
1016153964 6:140780719-140780741 AAGGGAGCCCACTGCCTTCAAGG + Intergenic
1016229773 6:141788826-141788848 AAGGGAACACATTGCCTTGAAGG + Intergenic
1016457392 6:144245222-144245244 AAGGGAACCTGCTGCCTTGAAGG - Intergenic
1016623844 6:146143137-146143159 TGGAGAACCCATTGCCTTGAAGG - Intronic
1016643796 6:146380529-146380551 ACAGGAGCCCACTGCCCTGAAGG - Intronic
1016704664 6:147092569-147092591 AAGAGTGCACACAGCCTTTAGGG + Intergenic
1017243419 6:152196164-152196186 AGGGGAGCCCACTCCCCTGAAGG - Intronic
1017243475 6:152196524-152196546 AAGAGAACCTGCTGCATTGAAGG - Intronic
1017379670 6:153813839-153813861 AGGGGAGCCCACTGCCCTAAAGG + Intergenic
1017387405 6:153901794-153901816 AAAGGAGCCCACTGTCCTGAAGG + Intergenic
1019260582 7:79776-79798 AAGAGAGTCCACACCCTGGAAGG + Intergenic
1020135518 7:5585893-5585915 AAGAGGGCCCAAAGCCCTGAAGG - Intergenic
1020509068 7:9029906-9029928 ATGAGAGCCGACTGCCTTTGAGG + Intergenic
1020515026 7:9107118-9107140 AGGGGAGCCCGCTGCCCTGAAGG + Intergenic
1020520012 7:9173593-9173615 GAGAGAACCCACTGCCTTGAAGG - Intergenic
1020572973 7:9889998-9890020 AAGAGAACCTGCTGCCTTGAAGG + Intergenic
1020577170 7:9947661-9947683 AAGGGAATCCACTGCCCTGACGG + Intergenic
1020624244 7:10558275-10558297 AAGGGAGCCCACTGCCCTGAAGG + Intergenic
1020895019 7:13929182-13929204 AATAGAGCCCACTGTATTGCAGG + Intronic
1021034768 7:15784695-15784717 AAGGGAACCCACTGCCTTGAAGG + Intergenic
1021046108 7:15924990-15925012 AAGGAAACCCACTGCCTTAAAGG + Intergenic
1021046166 7:15925350-15925372 AAAGGAGCCCACTGCTTTGAAGG + Intergenic
1021130987 7:16913035-16913057 AGGGGAGCCCATTGCCCTGAAGG - Intergenic
1021131049 7:16913392-16913414 AAGGGAACCCACTGCCTTGTAGG - Intergenic
1021214576 7:17900696-17900718 AGGGGAGCCCATTGCCCTGAAGG - Intronic
1021214638 7:17901060-17901082 AAGGGAACCTACTGCTTTGAAGG - Intronic
1021382375 7:19983681-19983703 AGGGGAGCCCACTGCCTTATGGG - Intergenic
1021770960 7:24000707-24000729 ACCAAAGGCCACTGCCTTGATGG - Intergenic
1021923070 7:25506283-25506305 TGGGGAGCCCACTGCATTGAAGG + Intergenic
1022348270 7:29539330-29539352 AGGGGAGCCCACTGCCCTGAAGG + Intergenic
1022366954 7:29730587-29730609 AAGAGAGCCCACTGCCCTGAAGG - Intergenic
1022557979 7:31318921-31318943 AAGAGATCCTACTTCCTTGTAGG + Intergenic
1022562320 7:31362624-31362646 CAGAGACCCCTCTGCCTTTAGGG + Intergenic
1022741110 7:33122613-33122635 AGGAGAACCCACTGCCCTGAAGG - Intergenic
1022749850 7:33213369-33213391 ATGGGAGCCCACTGCCCTGAAGG - Intronic
1022898414 7:34776806-34776828 AAGGGAAACTACTGCCTTGAAGG - Intronic
1023267512 7:38423055-38423077 AACAGAGGCCACTGGCTTCAGGG + Intronic
1023646239 7:42318817-42318839 TAGAGGACCTACTGCCTTGAAGG + Intergenic
1023716229 7:43046862-43046884 AAGGGAGCCTTCTGCCTTGAAGG + Intergenic
1024369086 7:48559409-48559431 AAGGGAGCCCACTGCCTTGAAGG - Intronic
1024415007 7:49096340-49096362 AAGAGAATCCACTGCCTTGAAGG + Intergenic
1024661243 7:51497335-51497357 AGGGAAGCCCACTGCCCTGAAGG - Intergenic
1024662453 7:51511275-51511297 AAGGGAACCTGCTGCCTTGAAGG - Intergenic
1024860613 7:53835567-53835589 TAGAGAGCACACTGCTGTGAGGG - Intergenic
1025160459 7:56654859-56654881 AAGAGAACACACTGCCTTGAAGG + Intergenic
1025160549 7:56655495-56655517 AACAGAGCTCACTGCCCTGAAGG + Intergenic
1025718168 7:63983153-63983175 AAGAGAACACACTGCCTTGCAGG + Intergenic
1025726267 7:64064336-64064358 AAGAGAACACACTGCCTTGAAGG - Intronic
1025755084 7:64330791-64330813 AAGAGAACACACTGCCTTGAAGG - Intronic
1027264211 7:76485031-76485053 AAAAGAGCCCCCTGCCTTCCCGG - Intronic
1027315580 7:76983145-76983167 AAAAGAGCCCCCTGCCTTCCCGG - Intergenic
1027524039 7:79245027-79245049 AAGGGAACCCACTTCCTTAAAGG + Intronic
1027799361 7:82732767-82732789 GAGAGAACCCACTGCCCTGAAGG + Intergenic
1028021179 7:85775634-85775656 GAGAGAGCCCACTGGCTTGCTGG - Intergenic
1028022388 7:85792636-85792658 AAGGGAACCCAGTGTCTTGAAGG + Intergenic
1028264491 7:88705882-88705904 AAGGGAACCCACCGTCTTGAAGG - Intergenic
1028266547 7:88733384-88733406 AGGGGAGCCCACTTCCCTGAAGG - Intergenic
1028266605 7:88733746-88733768 AAGGGAACCCTCTGCCTTGAAGG - Intergenic
1028284638 7:88981245-88981267 AATGGAGCACACTGCCTTGAAGG - Intronic
1028354355 7:89887795-89887817 AAGGGAACCCATTGCCTTGAAGG - Intergenic
1028868078 7:95736515-95736537 AGCAGAGCCCACTGCCCTGAAGG - Intergenic
1028929574 7:96397867-96397889 AAGGGAATCCACTGCCTTGAAGG - Intergenic
1029797287 7:102909284-102909306 AGGGGAACCCACTGCCCTGAAGG - Intronic
1029797350 7:102909631-102909653 AAGGGAACCTGCTGCCTTGAAGG - Intronic
1029825313 7:103186868-103186890 AAGAGAGCCCACTGCCCTGAAGG + Intergenic
1030222418 7:107110670-107110692 AAGGGAACCTACTGCCTTGAAGG + Intronic
1030370465 7:108694036-108694058 AAGGGAGCCCACTTCCCTGAAGG - Intergenic
1030370514 7:108694379-108694401 AAGGGAACCTACTGCCTTGAAGG - Intergenic
1030391312 7:108931659-108931681 AAGGGAGCCCACTGCCTTAAAGG - Intergenic
1030408353 7:109143395-109143417 AAGGGAACCCACTGACTTGAAGG - Intergenic
1030431576 7:109455435-109455457 AGGAGATCCCACTGCCTGGAAGG - Intergenic
1030431643 7:109455792-109455814 AAGGGAATCCACTTCCTTGAAGG - Intergenic
1030629413 7:111879226-111879248 AAGGGAGCCAACTTCCTTGAAGG + Intronic
1031353430 7:120762963-120762985 AAGGAAGCCCACTGCCCTGAAGG - Intergenic
1031412538 7:121457055-121457077 AAGTGAACCCACTGCCTTTAAGG - Intergenic
1031639145 7:124140503-124140525 AAGGAAACCTACTGCCTTGAAGG - Intergenic
1031905722 7:127458037-127458059 AAGGCAACCCACTCCCTTGAAGG + Intergenic
1031905847 7:127458832-127458854 AGGGGAGCCCACTGCCCTGAAGG + Intergenic
1032138767 7:129307490-129307512 AGGGGAGCCCACTGCCCTGAAGG - Intronic
1033887280 7:145964018-145964040 AAGGGAGCCCACTACTCTGAAGG + Intergenic
1034003413 7:147442394-147442416 AGGGGAGCCCACTTCCCTGAAGG - Intronic
1034398098 7:150842636-150842658 AAGGGAGCCCATTGTCTTGAAGG + Intronic
1035346905 7:158206332-158206354 AGGAAAACCCACTGCCTTGAAGG + Intronic
1035550825 8:523557-523579 AGGGGAACCCACTGCCCTGAAGG + Intronic
1035604852 8:923368-923390 CTGAGGGGCCACTGCCTTGATGG + Intergenic
1037254860 8:16942009-16942031 ACGGGAGTCCACTGCCCTGAAGG + Intergenic
1037354122 8:17999036-17999058 AGGAGAGCCCACTGCCCTGAAGG - Intronic
1037354178 8:17999404-17999426 AAGGAAACCCACTGCCTTAAAGG - Intronic
1037686246 8:21141898-21141920 ATGAGAGCCCCTTGCCTGGATGG - Intergenic
1038416139 8:27397392-27397414 AAGAGAGCCAGGTGCCTTGCAGG + Intronic
1039663667 8:39495761-39495783 GAAGGAACCCACTGCCTTGAAGG + Intergenic
1039663721 8:39496119-39496141 AGGAGAGTCCAATGCCCTGAAGG + Intergenic
1040095725 8:43440570-43440592 AGGGGAGCCCACTGTCCTGAAGG + Intergenic
1040485704 8:47869425-47869447 AAGGGAACCTGCTGCCTTGAAGG + Intronic
1040485772 8:47869791-47869813 AGGGGAGCCCACTACCCTGAAGG + Intronic
1040628115 8:49175508-49175530 AAGGGAACTCACTGCCTTGAAGG + Intergenic
1040743164 8:50604988-50605010 AAGGAAACCCACTGCCTTGAAGG - Intronic
1040745402 8:50635682-50635704 AGGGGAGCCCACTTCCCTGAAGG - Intronic
1041415983 8:57609303-57609325 AAGGGAGCTCACTACTTTGAAGG + Intergenic
1041416045 8:57609662-57609684 AGGAGAGCCTACTGCCCTGAAGG + Intergenic
1041616004 8:59907417-59907439 AAGGGAACCCACTGACTTGAAGG + Intergenic
1041823242 8:62063276-62063298 AAGGGAATACACTGCCTTGAAGG + Intergenic
1041823309 8:62063653-62063675 AAGGGAGCCCACTGTCTGAAGGG + Intergenic
1041883316 8:62778595-62778617 AGGAGAGCCCACTTCCCTGAAGG - Intronic
1042082572 8:65071324-65071346 AAGGGAACCCATTGCCTTGAAGG - Intergenic
1042162644 8:65912640-65912662 AAGGGAGCCCACTGCCTTGTAGG + Intergenic
1042297903 8:67242456-67242478 AAGGGAACCCACTGCCTTGAAGG + Intronic
1042297966 8:67242777-67242799 AGGGAAGCCCACTGCCCTGAAGG + Intronic
1042428155 8:68673026-68673048 GAGAGAACTCACTGCCTTGAAGG + Intronic
1042726845 8:71888269-71888291 AAGAGAGCCCACTGTTCTGAAGG - Intronic
1042898354 8:73695366-73695388 AAAGGAACCCACTGCCTTGAAGG + Intronic
1042980229 8:74518588-74518610 AAGGGAACTTACTGCCTTGAAGG + Intergenic
1043080059 8:75755385-75755407 AAGAAAACCTGCTGCCTTGAAGG + Intergenic
1043080109 8:75755741-75755763 AGGGGAGCTCACTGCCCTGAAGG + Intergenic
1043366826 8:79542774-79542796 AGGGGAGCCCACTGCCTTGAAGG + Intergenic
1043366879 8:79543133-79543155 AGGGGAGCCCACTGTCTTGAAGG + Intergenic
1043567293 8:81562180-81562202 AAGGGAACCTGCTGCCTTGAAGG + Intergenic
1043600298 8:81929178-81929200 AAGGGAGCCCACTACTTTAAAGG + Intergenic
1043627011 8:82273942-82273964 AGGGGAGCCCACTGCTTTGAAGG + Intergenic
1043740174 8:83801428-83801450 AAGGGAGCTCACTGCCTTAAAGG - Intergenic
1044241441 8:89893019-89893041 AAGGGAACCTGCTGCCTTGAGGG + Intergenic
1044635466 8:94319661-94319683 AAGGGAACCCACTGCCTTGAAGG - Intergenic
1045041291 8:98227138-98227160 AGGAGAGCCCACTTCCCTGAAGG - Intronic
1045041345 8:98227497-98227519 AAAGGAAGCCACTGCCTTGAAGG - Intronic
1045124220 8:99071960-99071982 AGGGGAGCCCACTGCCCTAAAGG - Intronic
1045124292 8:99072323-99072345 AAGAAAACCCACTACCTTTAAGG - Intronic
1045589918 8:103582187-103582209 GATGGAACCCACTGCCTTGAAGG + Intronic
1045592461 8:103613440-103613462 AGGGGAGCCCACTGCCCTGAAGG - Intronic
1045599002 8:103692633-103692655 AAAGGAACCCACTGCCCTGAAGG - Intronic
1045733462 8:105267733-105267755 AAAAGAACCTGCTGCCTTGAAGG - Intronic
1045800619 8:106096943-106096965 AAGGGAACCCGCTGCCTTGAAGG + Intergenic
1046143163 8:110121220-110121242 AAGGGAAGCCACTTCCTTGAAGG + Intergenic
1046169435 8:110485835-110485857 AAGGAAGCCCACTTCCCTGAAGG + Intergenic
1046205384 8:110988324-110988346 AAGTGAGTCCACTGAATTGATGG - Intergenic
1047841155 8:128754704-128754726 AAAGGAACCCACAGCCTTGAAGG + Intergenic
1047901071 8:129422955-129422977 AAGGGAATCCTCTGCCTTGAAGG + Intergenic
1047910094 8:129518455-129518477 AAAGGAACCCACTGCCTTGAAGG + Intergenic
1047910140 8:129518707-129518729 ACCAGAGTCCACTGCCTTTATGG + Intergenic
1047933603 8:129753400-129753422 AAGGGAACCTACTGCCTTGAAGG + Intronic
1047933660 8:129753756-129753778 AGGAGAGCCCACTTCCCTAAAGG + Intronic
1048029859 8:130621141-130621163 AAGGGAGCCCACTACCCTGAAGG - Intergenic
1048118798 8:131555689-131555711 AAGAGAGCCCACTTTCCTGAAGG + Intergenic
1048646636 8:136428185-136428207 AAGGGAACCTGCTGCCTTGAAGG + Intergenic
1049490111 8:142893789-142893811 AAGAGAACCTGCTGCCTTGAAGG - Intronic
1050109318 9:2198554-2198576 AAGGGAGGCCACCACCTTGATGG + Intergenic
1050211632 9:3265048-3265070 AAGAGAACTCTCTGCCATGATGG + Intronic
1050211635 9:3265090-3265112 AAGAGAACTCTCTGCCATGATGG + Intronic
1050238796 9:3612721-3612743 AGGGGAGCCCACTTCCCTGAAGG - Intergenic
1050248153 9:3713601-3713623 AAGGGAACCCACTGCCTTGAAGG + Intergenic
1050248208 9:3713951-3713973 AGGGGAGCCCACTGCCCTGAAGG + Intergenic
1050355724 9:4781119-4781141 AAGAGAACCTACTGCCTTGAAGG + Intergenic
1050355891 9:4782312-4782334 AGGGGAGCCCACTGCCCTGAAGG + Intergenic
1050644328 9:7702742-7702764 AAGAGAACCCACTGCCTTGAAGG - Intergenic
1050906939 9:11016357-11016379 AAGAGAACCTGCTGCCTTGAAGG - Intergenic
1050913922 9:11107830-11107852 AAGGCAACCCACTGCCTTGAAGG + Intergenic
1051039139 9:12785103-12785125 AAGGGAACCCGCTGCCCTGAAGG - Intronic
1051704297 9:19860347-19860369 AAGGGAACCTGCTGCCTTGAAGG + Intergenic
1051921750 9:22274917-22274939 AAGGGAAACTACTGCCTTGAAGG + Intergenic
1052063332 9:23987226-23987248 AGGGAAGCCCACTGCCCTGAAGG + Intergenic
1052420222 9:28234193-28234215 AAAGGAGCCCACTGCCCTGAAGG + Intronic
1052476817 9:28971137-28971159 AAGAGAACTCACTGCCTTAAAGG + Intergenic
1052476857 9:28971398-28971420 AAGGGAGCCCACTGCCCTAAAGG + Intergenic
1052585696 9:30425107-30425129 AAAAGAACCCAGTGTCTTGAAGG - Intergenic
1052666974 9:31507773-31507795 AGGGGAGCCCAGTGCCTTGAAGG - Intergenic
1053040084 9:34862903-34862925 AAGGGAGCCTACTGCCCTGAAGG + Intergenic
1053110240 9:35453535-35453557 ATGGGAGCCCACTTCCCTGAAGG + Intergenic
1053204462 9:36174319-36174341 AGGGAAGCCCACTGCCCTGAAGG + Intergenic
1053566296 9:39256243-39256265 AAGATAGCACACTTCCTTCAAGG + Intronic
1054130853 9:61362770-61362792 AAGATAGCACACTTCCTTCAAGG - Intergenic
1054999471 9:71432486-71432508 AAAAGAGCTCATTGCTTTGAAGG - Intronic
1055181186 9:73388770-73388792 AAGGGAGCCCACTGTTCTGAAGG - Intergenic
1055243789 9:74217145-74217167 AAAGGAACCTACTGCCTTGAAGG - Intergenic
1055302015 9:74891937-74891959 AAAGGAACCCACTCCCTTGAAGG + Intergenic
1055339281 9:75264004-75264026 AAGGGAACCCACTGCCTTGAAGG - Intergenic
1055387292 9:75776063-75776085 AGGAGAGTCCAGTGCCCTGAAGG + Intergenic
1055886448 9:81069300-81069322 AGGAAAGCCCACTGCCCTAAAGG - Intergenic
1055886505 9:81069657-81069679 AAGGGAACCTACTGCCTTGAAGG - Intergenic
1056211232 9:84367278-84367300 AGGGGAGCCCATTGCCCTGAAGG - Intergenic
1056338791 9:85603415-85603437 AAGAGAACCCACTGCCTTAAAGG + Intronic
1056516733 9:87359335-87359357 AAGAGAGCCCACTGTCTTGAAGG + Intergenic
1056685065 9:88752431-88752453 AAGAGGGCCCACTACCATGGGGG + Intergenic
1056752667 9:89363480-89363502 CAGAGAGCTCTCTGCCTGGAGGG - Intronic
1057209763 9:93193325-93193347 AATAGAGCCCCCAGCCATGAAGG - Intronic
1058226554 9:102371551-102371573 AAGGGACTCCACTTCCTTGAAGG - Intergenic
1058780189 9:108325458-108325480 AATTAAGCCCACTGCCCTGAAGG + Intergenic
1059044498 9:110851035-110851057 CAGAGTGCTCCCTGCCTTGAAGG + Intergenic
1059432818 9:114260155-114260177 AAGGGAGCCCAGTGAGTTGAAGG - Intronic
1059515356 9:114889409-114889431 AAGGGAACCCAGTGCCTTGAAGG + Intergenic
1059555456 9:115276195-115276217 AGGACAGCCCACTTCCCTGAAGG - Intronic
1059900584 9:118921189-118921211 AGATGAGCCCACTGCCCTGAAGG - Intergenic
1059900649 9:118921544-118921566 AAGGGAACCCACTGCCTTGAAGG - Intergenic
1060328674 9:122643862-122643884 AAGGGAACCCACTGTCTTGATGG + Intergenic
1060790409 9:126482113-126482135 CAGAGACCCCACTGCCATGCAGG - Intronic
1060926259 9:127457386-127457408 AGGAGGGCCCAGTACCTTGATGG - Exonic
1061074649 9:128333693-128333715 AAGGGAGCCCTCTGCCTCCAAGG - Exonic
1185923664 X:4122925-4122947 AAGTGCGCCCACTGTCTTGGAGG + Intergenic
1186601948 X:11048038-11048060 AAGTGAACCAGCTGCCTTGAAGG - Intergenic
1186602123 X:11049439-11049461 AGGTGAGCCCACTGCCTTGAAGG - Intergenic
1186691812 X:11985651-11985673 AAAGGATCCCACTGCCCTGAAGG + Intergenic
1186911718 X:14174438-14174460 AAGGGAACCTGCTGCCTTGAAGG - Intergenic
1187090933 X:16095894-16095916 AAAGGATCCCACTGCCTTGAAGG - Intergenic
1187132732 X:16518180-16518202 AAGGGAATCCACTACCTTGAAGG + Intergenic
1187579357 X:20591948-20591970 AAGGGAGCCCACTGCCTTGAAGG - Intergenic
1187610617 X:20939244-20939266 AAGGGAACCTGCTGCCTTGAAGG - Intergenic
1187612893 X:20961541-20961563 AGGGTAGCCCACTGCCCTGAAGG + Intergenic
1187618678 X:21026898-21026920 AGGGGAGCCCACTGCCCTGAAGG - Intergenic
1187623604 X:21086093-21086115 AGGGGAGCCCACTACCCTGAAGG + Intergenic
1187836194 X:23434791-23434813 AAGGAAAACCACTGCCTTGAAGG + Intergenic
1187844945 X:23525315-23525337 AAGGGAGCCCACTGCCCTGAAGG + Intergenic
1187846227 X:23540852-23540874 AAGGGAACCTGCTGCCTTGAAGG + Intergenic
1188040588 X:25366637-25366659 AAGGGAACCCGCTGACTTGAAGG - Intergenic
1188068854 X:25695130-25695152 AGGGGAGTCCACTGCCCTGAAGG - Intergenic
1188108289 X:26168054-26168076 AAGGGAACCCGCTGCCTTGAAGG - Intergenic
1188116507 X:26250888-26250910 AAGTGAACCTGCTGCCTTGAAGG + Intergenic
1188140834 X:26548434-26548456 AAGGGAACCTGCTGCCTTGAAGG - Intergenic
1188742998 X:33809291-33809313 AAGGGAATCCACTGACTTGAAGG - Intergenic
1188749975 X:33893260-33893282 AGGGGAGCACACTGCCTTGAAGG - Intergenic
1188846274 X:35076391-35076413 AGGGGAGCCCACTGCCCTGACGG - Intergenic
1188846547 X:35078731-35078753 AACAGGGCCCACTGACCTGAGGG - Intergenic
1188864661 X:35300185-35300207 AAGGGAGCCCACTGCCCTGAAGG + Intergenic
1188943039 X:36263672-36263694 AGGAGAGCCCAGTGCCCTGAAGG - Intronic
1189223094 X:39389459-39389481 AAGAGAACCATCTGCCCTGACGG - Intergenic
1189405691 X:40720898-40720920 AAGGGAACCTGCTGCCTTGAAGG + Intronic
1189593813 X:42543366-42543388 AAGGGAACCTGCTGCCTTGAAGG + Intergenic
1189593874 X:42543724-42543746 AGGAGAGCCTAGTGCCCTGAAGG + Intergenic
1189628146 X:42921300-42921322 AAGGGAACCTGCTGCCTTGAAGG + Intergenic
1189640726 X:43068000-43068022 AAGGGAACCTGCTGCCTTGAAGG + Intergenic
1189670187 X:43400244-43400266 AAGAGAACCCACTGCCTTGAAGG + Intergenic
1189770095 X:44416924-44416946 AAGCGAACCCGCTGCCTTGAAGG - Intergenic
1189858422 X:45247636-45247658 AGAGGAGCCCACTGCCCTGAAGG - Intergenic
1189868820 X:45360757-45360779 AAGGGAACCCACTAACTTGAAGG - Intergenic
1189869994 X:45371469-45371491 AAGGGAATCCACTACCTTGAAGG + Intergenic
1189890018 X:45591497-45591519 AGGGGAGCCCACTGCCTTGAAGG - Intergenic
1190046216 X:47113373-47113395 AAGAGAACCTGCTGCCTTGAAGG + Intergenic
1190122312 X:47672337-47672359 AGGGGAGCCCACTGCCCTGAAGG - Intergenic
1190156993 X:48002303-48002325 GAGAGAGCACACAGCCTTCATGG - Intronic
1190452595 X:50596237-50596259 CAGAGAGCTGGCTGCCTTGAGGG - Exonic
1190537790 X:51446857-51446879 AAGGGAACCCACTGCCTTGAAGG - Intergenic
1190588172 X:51968024-51968046 AAGGGAACACGCTGCCTTGAAGG - Intergenic
1190614557 X:52217194-52217216 AAGGGAACCCACTGTCTTGAAGG + Intergenic
1190804767 X:53824771-53824793 AAGGGAACCCAGTGCCTTGAAGG + Intergenic
1190808321 X:53860746-53860768 AGGGGAGCCCACTGCCCTGGAGG - Intergenic
1191059260 X:56277731-56277753 AGGAGAACTCACTGCCCTGAAGG - Intronic
1191116766 X:56860807-56860829 AAGGAAACCCACTGCCTTGAGGG - Intergenic
1191194151 X:57703657-57703679 AAGAGAACCCATTGCCCTGAAGG - Intergenic
1191207409 X:57849455-57849477 AGGGGAGCCCACTGCCCTCAAGG - Intergenic
1191694633 X:63977436-63977458 CAGGGAGCCCAGTGCCCTGAAGG + Intergenic
1191700683 X:64038620-64038642 AGGGGAGCCCAATGCCCTGAAGG + Intergenic
1191826890 X:65375696-65375718 AAGGGAACCCACCACCTTGAAGG + Intronic
1191826952 X:65376053-65376075 AATGGAGCCCACTGCCCTAAAGG + Intronic
1191829571 X:65401839-65401861 AAAGGAACCCACTGCATTGAAGG + Intronic
1191834149 X:65446092-65446114 AAGGGAACCTGCTGCCTTGAAGG - Intronic
1191924566 X:66295863-66295885 AAAAGAACACACTGACTTGAAGG - Intergenic
1191943529 X:66504637-66504659 AAGGGAATCCACTGCCTTGAGGG + Intergenic
1191946954 X:66544804-66544826 AAGAGAACTCACTGCCTTGAAGG - Intergenic
1191955207 X:66636581-66636603 GAGAGAGCCCACTGTCTTCAGGG - Intronic
1192001805 X:67159193-67159215 AGGTGAGCCCACTTCCCTGATGG + Intergenic
1192008336 X:67241160-67241182 AGGGGAACTCACTGCCTTGAAGG + Intergenic
1192045976 X:67674686-67674708 AGAGGAGCCCACTTCCTTGAAGG - Intronic
1192060176 X:67816588-67816610 AAGGGAACCCACTGCCTTGAAGG + Intergenic
1192073149 X:67962200-67962222 AAGGGAAACCACTGCCTTAAAGG + Intergenic
1192077844 X:68018292-68018314 AAGGGAACTCACTGCCTTGAAGG + Intergenic
1192304405 X:69944060-69944082 AGGGGAGCCCACTGCCCTGAAGG - Intronic
1192374843 X:70549165-70549187 AAAGGTACCCACTGCCTTGAAGG + Intronic
1192380770 X:70613944-70613966 AAGAGAACCCATTGCCTTGAAGG + Intronic
1192393315 X:70753495-70753517 CAGGGAACCCACTACCTTGAAGG + Intronic
1192400209 X:70827170-70827192 AAGGGAACCCACTGCCTTGAAGG + Intronic
1192400270 X:70827494-70827516 AGGAGAGCCCACTGCCCTGAAGG + Intronic
1192521441 X:71804728-71804750 AGGAGAGCCCACTGCCCTGAAGG + Intergenic
1192640456 X:72857259-72857281 AAGGGAACACCCTGCCTTGAAGG + Intergenic
1192640726 X:72859573-72859595 AGGGGAGCCCACTGCCCTAAAGG + Intergenic
1192640985 X:72861203-72861225 AGGGGAGCCCACTGCCCTAAAGG - Intergenic
1192641255 X:72863517-72863539 AAGGGAACACCCTGCCTTGAAGG - Intergenic
1192667370 X:73101953-73101975 AAGAGAACCTATTGCCTTGAAGG - Intergenic
1192694482 X:73399876-73399898 AGAGGAGCCCACTACCTTGAAGG + Intergenic
1192714749 X:73627692-73627714 AGGAGAGCACACTGCCCTGAAGG - Intronic
1192714797 X:73628036-73628058 AAGGGAACCCACTGCCTTGAAGG - Intronic
1192725971 X:73752503-73752525 AAGGGAACCCACTGCTTTGTAGG - Intergenic
1192826701 X:74704607-74704629 AGGGGAGCCCACTTCCCTGAAGG - Intergenic
1192839210 X:74836529-74836551 AAGAGAAACTGCTGCCTTGAGGG - Intronic
1192858477 X:75039784-75039806 AGGGGAGCACACTGCCCTGAAGG - Intergenic
1192858531 X:75040137-75040159 AATGGAACCCACTGCCTTGAAGG - Intergenic
1192863721 X:75107605-75107627 AAGGGAATCCACGGCCTTGAAGG + Intronic
1192863782 X:75107957-75107979 AAGGGGGCCCACTGCCCTGAAGG + Intronic
1192875280 X:75223081-75223103 AAGGAAACCCAATGCCTTGAAGG - Intergenic
1192908575 X:75579033-75579055 AAGAGAACCTGCTGCCTTGAAGG - Intergenic
1192940593 X:75908079-75908101 TCGAGAGGCCACTGCCCTGAAGG - Intergenic
1192940636 X:75908334-75908356 AAGGGAAACCACTGCCTTGAAGG - Intergenic
1192959314 X:76110523-76110545 AGAAGAGCCCACTGCCCTGAAGG + Intergenic
1193012869 X:76697190-76697212 AGGGGAGCCCTCTGCCTTGTGGG + Intergenic
1193052377 X:77115157-77115179 AGGAGAGCCCACTGCCTTGAAGG - Intergenic
1193052430 X:77115515-77115537 AAGAGAACTCACTGCCCTGAAGG - Intergenic
1193092591 X:77510550-77510572 AGGGGAGCCCACTGCCCAGAAGG + Intronic
1193098356 X:77578899-77578921 AGTGGAGCCCACTGCCCTGAAGG + Intronic
1193147528 X:78092837-78092859 AAGGGAACCTACTGCTTTGAAGG - Intronic
1193161866 X:78237746-78237768 AGAAGAGCCCACTACCCTGAAGG - Intergenic
1193163570 X:78257069-78257091 AAGAGAACCTGGTGCCTTGAAGG - Intergenic
1193167850 X:78302298-78302320 AGGGGAGCCCACTGCCATGCAGG - Intronic
1193169026 X:78315165-78315187 AAGGGAACCTGCTGCCTTGAAGG + Intronic
1193173009 X:78358291-78358313 AAGGGAGACCACTGACCTGAAGG - Intergenic
1193184980 X:78501507-78501529 AAGATAACCCACTGCCTTGAAGG + Intergenic
1193194831 X:78619579-78619601 AAGGGAGCCCACTGTCCTGAAGG - Intergenic
1193260745 X:79403902-79403924 AAGGGAACCCATTGCCTTGAAGG + Intergenic
1193280369 X:79641663-79641685 AAGGGAACCTGCTGCCTTGAAGG - Intergenic
1193293825 X:79809870-79809892 CAGAAAACCCACTGCCTTGAAGG - Intergenic
1193409036 X:81140919-81140941 AGGGGAGCCCACTGCCCTGAAGG + Intronic
1193417043 X:81237994-81238016 AAGGGAACCCACTGCCTTGAAGG + Intronic
1193417093 X:81238251-81238273 AAGGGAGCCCACTGCCCTGAAGG + Intronic
1193441070 X:81539568-81539590 GAGAAAGCCCACTGCCTTGAAGG + Intergenic
1193455351 X:81724983-81725005 AGGAGAGCCCACTGCCCTGAAGG + Intergenic
1193463467 X:81817984-81818006 AGGAGAGCCCACTGCCATGAAGG - Intergenic
1193463523 X:81818342-81818364 AAGAGAACCAGATGCCTTGAAGG - Intergenic
1193585048 X:83311164-83311186 AAGGGAACCTACTTCCTTGAAGG + Intergenic
1193596446 X:83451685-83451707 AAGGGAACCTACTGCCTTGAAGG - Intergenic
1193755932 X:85408663-85408685 AAAGGAACCCAGTGCCTTGAAGG - Intergenic
1193802479 X:85952823-85952845 AGGGGAGCCCACTGCCATGAAGG + Intronic
1193815758 X:86102767-86102789 AGGGAAGCCCACTGCCCTGAAGG + Intergenic
1193856754 X:86612096-86612118 AAGGGAACCCACTACCTTGAAGG - Intronic
1193877900 X:86884661-86884683 AGGGGAGCCCACTACCTTGAAGG - Intergenic
1193905894 X:87243688-87243710 AAAAGAACCCACTTCCTTGAAGG - Intergenic
1193907553 X:87261459-87261481 AAGGGAACCCACTGCCTTGAAGG + Intergenic
1193930288 X:87544079-87544101 AGGGGAGCCCACTGCCCTGAAGG + Intronic
1193931874 X:87562681-87562703 AAGGGACTCTACTGCCTTGAAGG + Intronic
1193980875 X:88180606-88180628 AGGGGAGCCCACTGCCCTGAGGG - Intergenic
1194023569 X:88723825-88723847 AGGGGAGCCTACTGCCCTGACGG + Intergenic
1194065255 X:89253147-89253169 AAGGGAACCTGCTGCCTTGAAGG + Intergenic
1194112608 X:89853949-89853971 AAGAGAACCGACTCCCTTGAAGG + Intergenic
1194165093 X:90505984-90506006 AGGGGAGCCCATTGCCCTGAAGG + Intergenic
1194196683 X:90903175-90903197 AGGGGAGCCCACTGCCCTGAAGG - Intergenic
1194223604 X:91227307-91227329 GAGGGAACCCACTGCCTTCAAGG + Intergenic
1194285660 X:92007495-92007517 AGGAGAGGCCATTGCCCTGAAGG - Intronic
1194285723 X:92007889-92007911 AAGGGAACCTGCTGCCTTGAAGG - Intronic
1194288510 X:92039601-92039623 AGGGGAGCCCACTTCCATGAAGG - Intronic
1194291095 X:92072534-92072556 AAGGGAACCTCCTGCCTTGAAGG - Intronic
1194338738 X:92682557-92682579 AAGGAAACCCACTGCCTTGAAGG - Intergenic
1194358540 X:92918583-92918605 AAGGAAACCCACTGCCTTGAAGG - Intergenic
1194370848 X:93069734-93069756 AGGAGAGCCTACTGTCCTGAAGG + Intergenic
1194391404 X:93322033-93322055 AAGAGAACAAACTGCCTTAAAGG - Intergenic
1194415449 X:93606306-93606328 AAGGGAACCCACTGCCTTGAAGG + Intergenic
1194438069 X:93894155-93894177 AGGGGAGCCCACTGTCTGGAAGG - Intergenic
1194526502 X:94983767-94983789 AGGGGAGCCCACTTCCCTGAAGG + Intergenic
1194532538 X:95069165-95069187 AGGGGAGCCCACTGCCCTGAAGG + Intergenic
1194550393 X:95291071-95291093 AAGTGAGCTCTCTGCCTTGAAGG + Intergenic
1194553505 X:95330434-95330456 AGGGGAGCCCATTGCCCTGAAGG - Intergenic
1194558241 X:95388973-95388995 AAGGGTACCCATTGCCTTGAAGG - Intergenic
1194574596 X:95596517-95596539 AGGGGAGCCCACTGCCCTGAAGG + Intergenic
1194586127 X:95736464-95736486 AGGGGAGCCCACTGTCCTGAAGG + Intergenic
1194591508 X:95805271-95805293 AAGGGAACTCAATGCCTTGAAGG + Intergenic
1194623630 X:96202450-96202472 AGGGGAGCCCACTGCCCTGAAGG + Intergenic
1194788690 X:98118803-98118825 AAGGGAACCCAGTGCCTTGAAGG + Intergenic
1194791821 X:98160071-98160093 AGGGGAGCCCACTGCCTTGAAGG + Intergenic
1194823433 X:98532367-98532389 AGGGGAGACCACTGCCATGAAGG + Intergenic
1194831828 X:98632452-98632474 AGGGGAGCCCACTGCCCTGAAGG + Intergenic
1194835037 X:98671849-98671871 AGGGGAGCCCACTGCCCTGAAGG - Intergenic
1194841945 X:98753895-98753917 AGAGGAGCCCACTGCCCTGAAGG - Intergenic
1194877580 X:99208441-99208463 AAGGGAACCAGCTGCCTTGAAGG - Intergenic
1194937600 X:99970231-99970253 AGGAGAGCCCATTACCCTGAAGG - Intergenic
1195014629 X:100766210-100766232 AGGGGAGCCCACTGCCCTGAAGG - Intergenic
1195014695 X:100766579-100766601 AAGGGAACTCACTGCCTTAAAGG - Intergenic
1195090152 X:101450808-101450830 AAGGGACCCCACTCCCTTAAAGG - Intronic
1195122921 X:101774954-101774976 AGGGGAGCCCACTGCCCTGAAGG - Intergenic
1195122979 X:101775312-101775334 AAGAGAACCCACTGCCTTGAAGG - Intergenic
1195172250 X:102281079-102281101 AGGGGAGCCCACTGCCCCGAAGG - Intergenic
1195172317 X:102281439-102281461 AAGGGAACCCACTGCCTTGAAGG - Intergenic
1195186543 X:102405654-102405676 AAGGGAACCCACTGCCTTGAAGG + Intronic
1195186610 X:102406014-102406036 AGGGGAGCCCACTGCCCCGAAGG + Intronic
1195199319 X:102532694-102532716 ATGGGAACCCACTGCTTTGAAGG + Intergenic
1195396169 X:104412581-104412603 AGGGGAGCCCACTTCCCTGAAGG + Intergenic
1195502053 X:105613229-105613251 AAGAGAACCCAGTGCCTTGAAGG + Intronic
1195543346 X:106087713-106087735 AAGAGAACATACTGCTTTGAAGG - Intergenic
1195594489 X:106673016-106673038 AGGGGAGCCCACTGCCCTGAAGG - Intronic
1195594551 X:106673371-106673393 GAGGGAACCCAGTGCCTTGAAGG - Intronic
1195807872 X:108795884-108795906 AAGGGAACCCACTGACTTGAAGG - Intergenic
1195821213 X:108946894-108946916 AAGGGAGCCCAGTGCCTTGGAGG - Intergenic
1195823297 X:108970310-108970332 AAGAGAACCCACTGCCTTGAAGG + Intergenic
1195823355 X:108970670-108970692 GAGGGAGCCAACTGCCCTGAAGG + Intergenic
1195828757 X:109032670-109032692 AGGGGAGCCCATTGCCCTGAAGG - Intergenic
1195834869 X:109102819-109102841 AGGGGAGTCCACTGCCCTGAAGG - Intergenic
1195849173 X:109264547-109264569 AAGGGAACACACTGCCTCGAAGG - Intergenic
1195852086 X:109294672-109294694 AAGAGACCTCACTGACCTGAAGG - Intergenic
1195872131 X:109497610-109497632 AAGGGAACCTGCTGCCTTGAAGG - Intergenic
1195971494 X:110478170-110478192 AGGGGATCCCACTGCCCTGAAGG - Intergenic
1195984534 X:110614850-110614872 AGGGGAGCCCACTGCTCTGAAGG - Intergenic
1195984590 X:110615201-110615223 AAGAGAACCTACTGCCTTGAAGG - Intergenic
1196096788 X:111808893-111808915 AAGAGAACCTGCTGCTTTGAAGG - Intronic
1196182106 X:112703736-112703758 AGGGGAGCCCACTTCCCTGATGG - Intergenic
1196215829 X:113050595-113050617 AAGGGAACCCACTGCCCTGAAGG + Intergenic
1196215885 X:113050951-113050973 AGGGGAGCCCACTTCCCTGAAGG + Intergenic
1196226285 X:113171127-113171149 AAGGGAGCCCACTGCCCTGAAGG - Intergenic
1196232446 X:113239912-113239934 AGGGAAGCCCACTGCCCTGAAGG - Intergenic
1196233481 X:113252858-113252880 AGGAGAGCCTACTGCCTTAAAGG - Intergenic
1196234481 X:113262474-113262496 ACGGGAATCCACTGCCTTGAAGG - Intergenic
1196247417 X:113415856-113415878 AGGAAAGCCCACTGCCCTGAAGG + Intergenic
1196248455 X:113428875-113428897 AGGAGAACCCACTGCCTTGAAGG + Intergenic
1196270042 X:113699532-113699554 AGGGGAGCCCACTGCCCTGAAGG - Intergenic
1196357382 X:114810020-114810042 AAGAGAACCCACTGCCTTGAAGG - Intronic
1196385058 X:115140264-115140286 AAGGGAACCCACTGCCTTGAAGG + Intronic
1196399561 X:115299933-115299955 AAGGGAACCGACTGCCTTGAAGG - Intronic
1196466199 X:115973609-115973631 AGGGGAGCCCACTGCCCTGAAGG + Intergenic
1196494325 X:116306811-116306833 AGGGGAGCCCACTGCCCTTAAGG - Intergenic
1196508395 X:116476476-116476498 AGGAGAGCCCAATGCCTGGAAGG - Intergenic
1196512119 X:116524037-116524059 AAGTGAACCCACTGCATTGACGG - Intergenic
1196523811 X:116707539-116707561 AAGGGAGACCAGTGCCTTGAAGG - Intergenic
1196523859 X:116707883-116707905 AAGGGAATGCACTGCCTTGAAGG - Intergenic
1196532515 X:116805886-116805908 AGGGGAGCCCACTGCCCAGAAGG - Intergenic
1196552478 X:117045569-117045591 AAGGAAACCCACTGCCTTGAAGG + Intergenic
1196609539 X:117695631-117695653 AAGGGAACCCACTGCCTTGAAGG + Intergenic
1196619570 X:117806890-117806912 AAAGGAACCCATTGCCTTGAAGG + Intergenic
1196625268 X:117870877-117870899 AAGGGAGCCTGCTGTCTTGAGGG + Intergenic
1196660549 X:118264451-118264473 AGGGGAGCCCATTGCCCTGAAGG + Intergenic
1196865333 X:120065979-120066001 AAGGGAACCCACTGCCTTGAAGG + Intergenic
1196865382 X:120066225-120066247 AGGGGAGCCCACTGCCCTGAAGG + Intergenic
1196877711 X:120170055-120170077 AGGGGAGCCCACTGCCCTGAAGG - Intergenic
1196877760 X:120170301-120170323 AAGGGAACCCACTGCCTTGAAGG - Intergenic
1196922093 X:120594967-120594989 AAGAGAACCCACTTCCTTGAAGG + Intronic
1196962152 X:121014817-121014839 AAGGGAACCCATTGCCCTGAAGG - Intergenic
1197028032 X:121779236-121779258 AAGGAAAACCACTGCCTTGAAGG - Intergenic
1197053931 X:122094381-122094403 AGCAGAGCCCACTGGCATGAAGG + Intergenic
1197068654 X:122266769-122266791 AGGGGAGCCCACTGTCCTGAAGG - Intergenic
1197096655 X:122604384-122604406 AAGGGAACCTGCTGCCTTGAAGG + Intergenic
1197099539 X:122636495-122636517 AGGGGAGCCCACTGCCTTGAAGG - Intergenic
1197099594 X:122636851-122636873 AAGAGAACCCACTGCCTTCAAGG - Intergenic
1197348297 X:125350683-125350705 AGGGGAGCCCACTGCCCTGAAGG + Intergenic
1197399666 X:125974633-125974655 AAGGAAACCCGCTGCCTTGAAGG + Intergenic
1197429461 X:126342645-126342667 AGGGGAGCCCACTGCCTTGAAGG + Intergenic
1197438003 X:126456211-126456233 AAGACAACCCACTACCCTGAAGG + Intergenic
1197487762 X:127074896-127074918 AAGGGATTCCACTGCCCTGAAGG - Intergenic
1197491973 X:127128926-127128948 AAAGGAACCAACTGCCTTGAAGG + Intergenic
1197502601 X:127260306-127260328 AAGGAAACCCACTGTCTTGAAGG + Intergenic
1197527714 X:127582876-127582898 GGGGGAGCCCACTGCCCTGAAGG - Intergenic
1197558888 X:127992707-127992729 AGGGGAGCCCACTTCCCTGAAGG + Intergenic
1197581350 X:128288152-128288174 GAGGGTCCCCACTGCCTTGAAGG + Intergenic
1197876564 X:131114935-131114957 AAGGGAACCCACTGCCTTAAAGG - Intergenic
1197987192 X:132278880-132278902 GAGGGAACCCGCTGCCTTGAAGG - Intergenic
1198292985 X:135256936-135256958 AAGGGAGCCCATTGCCTTGAAGG + Intronic
1198389480 X:136159823-136159845 AAGAGGGCCCACTGGGTTGTAGG - Intronic
1198430853 X:136564965-136564987 AAGAGAACCCACTGCCTTGAAGG - Intergenic
1198537594 X:137601590-137601612 AGGGGAGCCCACTGCTCTGAAGG + Intergenic
1198611949 X:138411532-138411554 AAGAGAACCCAATGTCTTGAAGG + Intergenic
1198694846 X:139324852-139324874 AAGGGAACCCACTGCCTTGAAGG + Intergenic
1198697275 X:139355192-139355214 AAGAGAACCCACTGCCTTGAAGG - Intergenic
1198724705 X:139664917-139664939 AAGGGAACCTACTGCCTTGAAGG - Intronic
1198785507 X:140283595-140283617 AAGAGGACCTGCTGCCTTGAAGG - Intergenic
1198788162 X:140313741-140313763 AAGGGAACCCACTGCCTTGAAGG + Intergenic
1198818105 X:140614589-140614611 AAGGGAACCCACTCCCTTGAAGG - Intergenic
1198925572 X:141788197-141788219 AGGGGAGCCCACTGCCCTGAAGG - Intergenic
1198956446 X:142136650-142136672 AGGGGAGCCCAATGCCCTGAAGG + Intergenic
1198995256 X:142566978-142567000 AAAGGAACCCTCTGCCTTGAAGG - Intergenic
1199036195 X:143053511-143053533 AAGAGAGTCCACTGCTTTTAAGG - Intergenic
1199058696 X:143328254-143328276 AAGGGAATGCACTGCCTTGAAGG + Intergenic
1199115243 X:143984830-143984852 AAGGGAACCCACTGCCTTGAAGG - Intergenic
1199135359 X:144243848-144243870 AAGAGAATCCACTGCCCTGAAGG + Intergenic
1199138927 X:144287390-144287412 AAGAGAGCCTACCGCGTTGAAGG - Intergenic
1199148319 X:144397614-144397636 AGGGGAGCCCATTGCCCTGAAGG + Intergenic
1199156112 X:144550922-144550944 AAGGGAGACCCATGCCTTGAAGG + Intergenic
1199197455 X:145048045-145048067 AAGGGAGCCTGCTGCCTTGAAGG + Intergenic
1199197509 X:145048402-145048424 ATGGGAGCCCACTGCTCTGAAGG + Intergenic
1199258522 X:145744625-145744647 AAGGCAACCCGCTGCCTTGAAGG + Intergenic
1199274655 X:145926740-145926762 AGGAGAGCCCACTGCCCTGAAGG + Intergenic
1199277656 X:145964831-145964853 AAGAGAGCCCACTTCTCTGAAGG + Intergenic
1199303907 X:146244921-146244943 ATGGGAACCCACTGCATTGAAGG + Intergenic
1199316043 X:146379414-146379436 AAGGGACCCCACTGCCTTGAAGG + Intergenic
1199317304 X:146395690-146395712 AGGGGAGCTCACTGCCCTGAAGG - Intergenic
1199358339 X:146886858-146886880 CAGGGAGCCCACTGCGCTGAAGG + Intergenic
1199374283 X:147088658-147088680 AAGAAAACGCACTGCCTTGAAGG - Intergenic
1199393266 X:147306295-147306317 AAGGGAACCTACTGCCTTGAAGG + Intergenic
1199393708 X:147309815-147309837 AGGGGAGCGCACTGCCTTCAAGG + Intergenic
1199439625 X:147853994-147854016 AGGGGAGCCCACTGCTCTGAAGG - Intergenic
1199439683 X:147854353-147854375 AAGAGAACCTGATGCCTTGAAGG - Intergenic
1199455167 X:148020284-148020306 AGGGGAGCCCACTGCCCTGAAGG - Intronic
1199485063 X:148338303-148338325 AAGGGAATCTACTGCCTTGAAGG + Intergenic
1199568750 X:149246339-149246361 AGGGGAGCCCACTGTCCTGAAGG - Intergenic
1199845290 X:151688467-151688489 AGGGGAGCCCACTGCCCTGAAGG + Intergenic
1199850391 X:151721741-151721763 AAGAGGGCCTAGGGCCTTGAGGG - Intronic
1200315891 X:155132847-155132869 AGGGGAGCCCCCTGCCCTGAAGG + Intronic
1200465261 Y:3508761-3508783 AAGAGAACCGACTCCCTTGAAGG + Intergenic
1200511358 Y:4083784-4083806 AGGGGAGCCCATTGCCCTGAAGG + Intergenic
1200542529 Y:4477376-4477398 AGGGGAGCCCACTGCCCTGAAGG - Intergenic
1200560070 Y:4690689-4690711 GAGGGAACCCACTGCCTTCAAGG + Intergenic
1200603224 Y:5232034-5232056 AGGAGAGGCCATTGCCCTGAAGG - Intronic
1200603283 Y:5232428-5232450 AAGGGAACCTGCTGCCTTGAAGG - Intronic
1200606030 Y:5264166-5264188 AGGGGAGCCCACTTCCCTGAAGG - Intronic
1200608601 Y:5297109-5297131 AAGGGAACCTTCTGCCTTGAAGG - Intronic
1200647126 Y:5799337-5799359 AAGGAAACCCACTGCCTTGAAGG - Intergenic
1200649042 Y:5817926-5817948 AAGAAAACCTGCTGCCTTGAAGG - Intergenic
1200666720 Y:6034274-6034296 AAGGAAACCCACTGCCTTGAAGG - Intergenic
1200678644 Y:6181625-6181647 AGGAGAGCCTACTGTCCTGAAGG + Intergenic
1200719426 Y:6587231-6587253 AAGGGAACCTGCTGCCTTGAAGG + Intergenic
1201980226 Y:19899241-19899263 AGAGGAGCCCACTTCCTTGAAGG + Intergenic