ID: 957813275

View in Genome Browser
Species Human (GRCh38)
Location 3:85256162-85256184
Sequence GCTGCTAACCAGGAGCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 189}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957813275_957813278 -6 Left 957813275 3:85256162-85256184 CCCTGCAGCTCCTGGTTAGCAGC 0: 1
1: 0
2: 1
3: 20
4: 189
Right 957813278 3:85256179-85256201 AGCAGCTTCCTCTCTCCCTGTGG 0: 1
1: 0
2: 13
3: 65
4: 395
957813275_957813282 21 Left 957813275 3:85256162-85256184 CCCTGCAGCTCCTGGTTAGCAGC 0: 1
1: 0
2: 1
3: 20
4: 189
Right 957813282 3:85256206-85256228 CTACTTCACAGTTCCTTTCCTGG 0: 1
1: 0
2: 2
3: 21
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957813275 Original CRISPR GCTGCTAACCAGGAGCTGCA GGG (reversed) Intronic
900678096 1:3900944-3900966 GCTGTTAGCCAGGGGATGCAAGG - Intergenic
903262548 1:22139220-22139242 GCTGCTGTCAGGGAGCTGCAGGG - Intronic
905242539 1:36590122-36590144 GTTCCTAACCCGGAGCTGGAGGG + Intergenic
905957952 1:42015015-42015037 GCTGCTGACCACCAGCAGCACGG - Intronic
906169477 1:43712223-43712245 GCTTCTAACCAGCTGCAGCAAGG + Intronic
908577882 1:65480378-65480400 TCTATGAACCAGGAGCTGCATGG + Intronic
913065647 1:115251479-115251501 GGTGGTTACCAGGAGCTGTAGGG + Intergenic
916560500 1:165930755-165930777 ACTGTTCACCAGGGGCTGCAGGG - Intergenic
920033790 1:203052642-203052664 GCAGCTATCCAGGAGCTGAGAGG + Intronic
920393433 1:205626155-205626177 GCTGCTACCCCTGAGCTGGAAGG + Intronic
920659105 1:207900106-207900128 GCTGCCAACAAGGGGCAGCAGGG - Intronic
920690848 1:208145326-208145348 GCTGCGTCCCAGCAGCTGCAGGG + Intronic
921157652 1:212450728-212450750 GCTGCAAACCGGCAGGTGCAAGG + Intergenic
921159892 1:212465299-212465321 GCTGTCAACCAGGGGCTGGAGGG + Intergenic
923653121 1:235892250-235892272 GCTGAGCAACAGGAGCTGCAGGG - Intergenic
923791874 1:237118543-237118565 GGTGGTCACCAGGAGCTGCTGGG + Intronic
1063928089 10:11000502-11000524 GCTGTTTACCAGGAGGAGCAGGG - Intergenic
1065666940 10:28072995-28073017 ACTGCTGTCCAGGGGCTGCATGG - Intronic
1067034952 10:42907830-42907852 ACTGATAACCAGAATCTGCAAGG + Intergenic
1067683526 10:48454532-48454554 GCTGCAGACCAGCACCTGCACGG + Intronic
1072415560 10:95243927-95243949 GGTGGTTACCAGGAGCTGGAAGG + Intronic
1072788191 10:98298862-98298884 GCTGTAAACTAGGAGCTGTAAGG - Intergenic
1073183776 10:101602970-101602992 GCTGTTGGCCAGGAGCTCCATGG + Intronic
1073868305 10:107830654-107830676 GGTGGTAGCCAGCAGCTGCAGGG + Intergenic
1074299745 10:112223001-112223023 GCTGCTGACCAGGAGTGGCCTGG - Intergenic
1075608980 10:123836349-123836371 GCTGATTACCTGGAGGTGCAGGG - Intronic
1076385793 10:130054186-130054208 GATGCTTGCCAGGAGCTGGAGGG - Intergenic
1076548516 10:131261991-131262013 GGTGCCTTCCAGGAGCTGCAAGG + Intronic
1076776898 10:132702972-132702994 GCTCCTAACCAGCACCGGCAGGG - Intronic
1077135367 11:995503-995525 GCTGCTACCCAGTATCGGCAGGG + Intronic
1077613598 11:3660001-3660023 GCCGCTGCCCAGGAGCTGCAGGG - Exonic
1079348443 11:19672812-19672834 GCTGCTAGCTAGTAGCTGCATGG - Intronic
1080611353 11:33906713-33906735 GCTGGTGACCCGGAGCTCCACGG - Intergenic
1081911722 11:46704345-46704367 ACTGGGAACCAGGATCTGCAAGG - Exonic
1084789393 11:71463786-71463808 GCTGGTGACCAGGCGCTCCAAGG - Intronic
1086022561 11:82248902-82248924 GCTGGTTACCAGGAGCTGGGGGG + Intergenic
1086515739 11:87611117-87611139 GGTGGTTACCAGGAGATGCAGGG + Intergenic
1087275693 11:96158446-96158468 GCAGCTCATGAGGAGCTGCAAGG + Intronic
1090081324 11:123614808-123614830 GCTGATAACCAGCAGCAGCTTGG - Exonic
1090471309 11:126983704-126983726 GCTGGCATCCAGGTGCTGCAGGG - Intronic
1090648470 11:128785819-128785841 GGTGGTTACCAGGAGCGGCAAGG + Intronic
1091890834 12:4053001-4053023 GCTGCTGACAAGGAGCTGAAGGG + Intergenic
1096772503 12:53945009-53945031 GCTGCTCACCTCGGGCTGCAGGG - Exonic
1097569498 12:61315407-61315429 GATGCTTACCAGGGGCTGCAGGG + Intergenic
1099486462 12:83234216-83234238 GCTGCTATCCAGAATCTACAAGG - Intergenic
1101591582 12:106129891-106129913 CCTGCTACCCAGGAGCTAGATGG - Intronic
1101670278 12:106864832-106864854 GGTGCTTACCAGGAGCTAGAAGG - Intronic
1104418209 12:128613204-128613226 GGTGCTGTCCAGGAGCTGCATGG - Intronic
1105385344 13:19924184-19924206 GGTGATAACCAGGAGCTGAAGGG - Intergenic
1105439458 13:20403202-20403224 GCTGGGCACCAGAAGCTGCAAGG + Intergenic
1106430241 13:29674031-29674053 GGTGGTCACCAGGAGCTGGAGGG - Intergenic
1106699084 13:32209673-32209695 GAGGCTAATCAGGAACTGCAAGG - Exonic
1107176373 13:37404290-37404312 GCAGCTAACCAGTCGCTTCAGGG + Intergenic
1108303134 13:49101223-49101245 GCAACTAACCAGGTGCTCCATGG - Intronic
1112006794 13:95260436-95260458 GCTGATAACCAGGATGTGCTGGG - Intronic
1112029874 13:95447385-95447407 GCTGACCACCAGGAGCTGGAAGG - Intronic
1113548636 13:111174808-111174830 ACTGCTTCCTAGGAGCTGCAAGG - Intronic
1113816552 13:113175677-113175699 GCTGCTCCCCAGCAGCAGCAAGG - Intergenic
1114567118 14:23640807-23640829 GCTGCTCAGCAGGGGCTGCAGGG - Intronic
1116992052 14:51286978-51287000 GCTGGTTCCCAGGAGCTGCAGGG - Intergenic
1117283206 14:54260714-54260736 GGTGGTTACCGGGAGCTGCAGGG - Intergenic
1118505396 14:66405345-66405367 GCTGCTTATCAAGAGCTGCCTGG - Intergenic
1118506445 14:66418183-66418205 GATGGTTACCAGGAGCTACAGGG + Intergenic
1121860574 14:97313968-97313990 GCTGCAGACCAGGAACTTCAAGG + Intergenic
1121864143 14:97346758-97346780 ACTGCTAACTTGGAGATGCAGGG + Intergenic
1124365172 15:29065951-29065973 GCTGCTCCCCAAGAGCTGCTCGG + Intronic
1127394214 15:58530418-58530440 CCTGCAAACCAGGAGCAGCCAGG + Intronic
1127879620 15:63145245-63145267 GCTGGTTACCAGGGGCTGGAAGG - Intronic
1128829247 15:70751632-70751654 GCTGGTTACCAGGAGTGGCAAGG + Intronic
1130408245 15:83622590-83622612 GCTGCCAAGGAGGAGATGCAAGG + Intergenic
1130722019 15:86397441-86397463 ACTGCTGACCAGGAACTCCAAGG - Exonic
1130743826 15:86629145-86629167 GGTGGTTACCAGGAGCTGGAGGG - Intronic
1132541936 16:514234-514256 GTTGCTGACCTGGGGCTGCAGGG - Intronic
1133099315 16:3469693-3469715 GCTGATAACAGGGAGCAGCAAGG - Intronic
1134208141 16:12254072-12254094 GCTGCTAACCAGGATGGGGATGG + Intronic
1134220495 16:12349956-12349978 GCTGTGAAACAGGAGCTTCAGGG - Intronic
1135821452 16:25690302-25690324 GGTGCTAGGCAGGAACTGCAAGG + Intergenic
1137726021 16:50657333-50657355 GCTGTGAGCCTGGAGCTGCAGGG - Intergenic
1137823898 16:51472725-51472747 ACTGCTTGCCAGGAGTTGCAGGG - Intergenic
1139215887 16:65123555-65123577 GCTGGTGACCAGGAGCTGGAGGG - Intronic
1139385300 16:66564946-66564968 GCTGTTGACAGGGAGCTGCATGG + Intronic
1139673666 16:68508805-68508827 GCTGCAAAGCAGGAGATGGAAGG - Intergenic
1140454807 16:75098793-75098815 GCTGCTGCCTCGGAGCTGCACGG + Intronic
1141255656 16:82400142-82400164 GCTGCTTACCAGCATCTCCAAGG - Intergenic
1142685839 17:1576530-1576552 TCTGCTAACTGCGAGCTGCAAGG - Intronic
1145957677 17:28865745-28865767 GCTTCAAACCAGGAGCTCCATGG + Intergenic
1147449736 17:40496496-40496518 CTTGCTAACCAGGAGCTCCCAGG + Exonic
1147934915 17:44005792-44005814 GCAGCTGGCCAAGAGCTGCAAGG + Exonic
1148002552 17:44398300-44398322 GCTGCTATCCAGGGACTCCAGGG + Exonic
1150522953 17:65888826-65888848 GCTTCCAACCACAAGCTGCATGG - Intronic
1151577277 17:74959092-74959114 GCTGGGAAACTGGAGCTGCAGGG - Intronic
1152407287 17:80104920-80104942 CCTGCAAAGCAGGGGCTGCAGGG + Intergenic
1152671850 17:81612949-81612971 GGTGTTAATCAGCAGCTGCAGGG - Intronic
1156302165 18:35845551-35845573 GCTGCTCACCAGGAGGAGCCAGG + Intergenic
1156846320 18:41669624-41669646 GCAGCTAAAGAAGAGCTGCAGGG - Intergenic
1158143611 18:54285130-54285152 GCAGCCAACAATGAGCTGCATGG - Intronic
1161263558 19:3351713-3351735 GTTGCTAAGACGGAGCTGCAGGG + Intergenic
1161515186 19:4692537-4692559 GCTGCTGTCTAGGAGATGCATGG + Intronic
1162430881 19:10627710-10627732 TCTGCTCCCCAGGGGCTGCACGG + Exonic
1166178785 19:41092685-41092707 TCTGCTAACCAGGACATGAACGG - Intronic
1166209455 19:41296799-41296821 GCTGAGATCCAGGAACTGCAGGG - Intronic
1167810843 19:51828883-51828905 CCTGCCCTCCAGGAGCTGCAGGG - Intergenic
1168146497 19:54422313-54422335 GCTGCGGCCCAGCAGCTGCAGGG + Exonic
925615651 2:5742374-5742396 TTTGCCAAGCAGGAGCTGCAAGG + Intergenic
925863098 2:8199528-8199550 GCTGCTTAATAGGAGATGCAGGG - Intergenic
926308204 2:11655431-11655453 GCTGCTGCCCAGGAGCTGGATGG - Intergenic
926324376 2:11771655-11771677 GCTGCTCTCCAGCAGCTCCATGG - Exonic
926819210 2:16834418-16834440 GCTGCTAACCAGCAGAATCATGG - Intergenic
927147175 2:20173791-20173813 GTTGATGACCAGGAACTGCATGG + Intergenic
930261430 2:49151246-49151268 TCTGCCATCCAGGAGCTGCAGGG + Intronic
930714272 2:54577951-54577973 GATGGTAACAAGGAGCAGCATGG + Intronic
932316801 2:70790206-70790228 GCCGCCAACGAGCAGCTGCACGG + Intronic
933984449 2:87579007-87579029 GCTGCTTAGCAGCAGCAGCAGGG - Intergenic
935373331 2:102370161-102370183 CCTGCCATCCAGGAGCTCCAAGG - Intronic
935940109 2:108229157-108229179 GGTTCTAAGCAGAAGCTGCAAGG + Intergenic
936309404 2:111371792-111371814 GCTGCTTAGCAGCAGCAGCAGGG + Intergenic
937251906 2:120529228-120529250 GCAGCAAAGCAGGAGCTGCAGGG + Intergenic
937313393 2:120915851-120915873 GCTTCTGAGCAGCAGCTGCAAGG - Intronic
937462446 2:122101213-122101235 GCTGCTAACCAGGAGATGGAAGG + Intergenic
937469519 2:122163242-122163264 GCTGTTAACCAGGATCTCTATGG + Intergenic
937904676 2:127047154-127047176 GCAGCTTTCCAGGAGCTGCGGGG - Intergenic
938188219 2:129252252-129252274 GCTGATCACCAGGATCTGGATGG + Intergenic
942027277 2:171922659-171922681 GCCGCCAACAAGGAGCTGCTGGG - Intronic
945564488 2:211380216-211380238 GCAGAAAACCAGGAGCTGCTTGG + Exonic
947219271 2:227777638-227777660 TCTGCTCACCTGTAGCTGCACGG + Intergenic
947954036 2:234171930-234171952 GCTGCTAACCAGAGGCTCCACGG + Intergenic
1171322477 20:24258514-24258536 GCTGCTCACCGTGAGCTTCAAGG - Intergenic
1173765299 20:45602183-45602205 GGTGATAACCAGGAGCTGGAGGG - Intergenic
1174399378 20:50267709-50267731 GCTGCTGAGCAGGGGCGGCAGGG + Intergenic
1174533972 20:51236837-51236859 GCTCCTTACCAGGGCCTGCAAGG - Intergenic
1175705982 20:61177101-61177123 GTTGGTTACCAGGAGCTGGAGGG + Intergenic
1175891179 20:62316720-62316742 GCTGTTGGCCAGGAGCTGCTGGG + Exonic
1177357459 21:20028005-20028027 TCTGAGAACCAGGAGCTCCAAGG - Intergenic
1177357629 21:20030395-20030417 TCTGAGAACCAGGAGCTCCAAGG - Intergenic
1179242100 21:39601731-39601753 GCTGCTGACTGGGTGCTGCACGG - Intronic
1179384735 21:40931366-40931388 GCTGCTGACCTGGCCCTGCAGGG - Intergenic
1179778923 21:43687167-43687189 GCAGGGAAGCAGGAGCTGCAGGG + Intronic
1180993745 22:19954145-19954167 GCTTCAAGCCAGGTGCTGCAGGG - Intronic
1182803584 22:33051965-33051987 TGTGCTCACCAGGAGCTACAAGG - Intronic
950526808 3:13529090-13529112 GCTGCACAGCAGGAGCTGCGTGG - Intergenic
950540823 3:13611438-13611460 GGTGGTTACCAGGAGCTACAGGG - Intronic
950560972 3:13724109-13724131 GCTCCTGACTAGGAGCTGGAAGG + Intergenic
952260197 3:31732705-31732727 GCTGATCACCAGGATCTGCAAGG + Intronic
953766752 3:45748805-45748827 GCTCCCAACCAGGGACTGCAGGG + Intergenic
953879269 3:46683277-46683299 GCTGTTCACCAGGCCCTGCATGG - Exonic
954291996 3:49654685-49654707 GTTGATAACCAAGGGCTGCACGG - Exonic
954404701 3:50338923-50338945 GGAGCTGAGCAGGAGCTGCAGGG - Intronic
956206144 3:66756732-66756754 GCTGCTAACCTGCAGTTGCATGG + Intergenic
956378912 3:68645134-68645156 GATGCAAACCCTGAGCTGCAGGG - Intergenic
956406843 3:68936846-68936868 GCTTCAAACTAGGAACTGCAGGG + Intergenic
956587873 3:70883387-70883409 TCTGCAAATCAGAAGCTGCAAGG + Intergenic
957813275 3:85256162-85256184 GCTGCTAACCAGGAGCTGCAGGG - Intronic
958433645 3:94071892-94071914 GTTGCTAACCTGGGGCTGGAGGG - Intronic
960151459 3:114252863-114252885 GTTGCTGACCAGCATCTGCAAGG - Intergenic
961381985 3:126501128-126501150 AATGCTGACCAGGAGCTGCCAGG - Intronic
962877883 3:139549811-139549833 GCTCTTAACCAGGTGCTTCAAGG - Intergenic
965435326 3:168643615-168643637 GCTGCTCCTCAGTAGCTGCAGGG + Intergenic
965743853 3:171904622-171904644 GCTGCAGACTAGGAGCTCCAAGG - Intronic
966103275 3:176302529-176302551 GGTGCTTGCCAGGAGCTGGAGGG - Intergenic
968169591 3:196499269-196499291 GCTGCAAACCAGGAACACCATGG + Intronic
970477193 4:16435595-16435617 CCTGAGAACCAGGAGCTCCAAGG + Intergenic
973771770 4:54213428-54213450 GCTGCGATGCTGGAGCTGCAGGG + Intronic
978298984 4:107243506-107243528 GCAGCCAACCTGGAGCTGCAGGG + Intronic
980985475 4:139690828-139690850 TCTGGTAACCAGGAGCAGTAAGG - Intronic
984213590 4:176880304-176880326 CATGGTAACCAGGAGCTGCAAGG - Intergenic
985543952 5:500003-500025 GCTGTTGGGCAGGAGCTGCAGGG + Intronic
993332200 5:86614848-86614870 GTTGCTAAAGAGAAGCTGCAAGG + Intergenic
993637490 5:90362764-90362786 GCTAATATCCAGGACCTGCAAGG + Intergenic
994286714 5:97977882-97977904 TCTGTTAACAAGGAGCTGAAGGG - Intergenic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
999204290 5:149837033-149837055 GCTGGTGACCAGGAGTGGCAGGG - Exonic
1006566582 6:34963286-34963308 GGTGGTTACCAGGAGCTGGAGGG - Intronic
1008775898 6:55037268-55037290 GCTACTATCCAGAATCTGCAAGG - Intergenic
1011310009 6:85971450-85971472 TATGCTAAGCAGCAGCTGCAAGG + Intergenic
1013943920 6:115699390-115699412 GGTGGTATCCAGGAGCTGGAAGG - Intergenic
1014605022 6:123462915-123462937 GCTGCTAACCCTGAGCAGCTCGG - Intronic
1018206863 6:161444525-161444547 CCCACTAACCAGGGGCTGCAGGG - Intronic
1020988839 7:15170177-15170199 GCTGATGGCCAGGAGCTGAAAGG + Intergenic
1021541498 7:21764014-21764036 GGTGGTTACCAGGAGCTGGAGGG + Intronic
1021839269 7:24709291-24709313 TCTGCTACCCAGTGGCTGCAGGG + Intronic
1024005067 7:45219397-45219419 GGTGCCCACAAGGAGCTGCACGG - Intergenic
1024576334 7:50767630-50767652 CCTGCTGGCCAGGAGCCGCAGGG - Intronic
1024852164 7:53731525-53731547 ACTGCTAACCAGGGGGTGAAAGG - Intergenic
1026234610 7:68515826-68515848 GCTGGTTGCCAGGAGCTGGAGGG + Intergenic
1026369060 7:69680613-69680635 GGTGCTTACCAGGGGCTGGAGGG - Intronic
1029083346 7:97992331-97992353 GATGCTTACCAGGAGCTGGGAGG - Intergenic
1029503061 7:100945776-100945798 GCTCCTACCCAGGCTCTGCAGGG + Intergenic
1031134594 7:117872429-117872451 GCAGCTTCGCAGGAGCTGCAAGG - Intronic
1034385424 7:150737074-150737096 TCTGCTAACCAGGATCAGAAAGG - Intronic
1035705744 8:1673031-1673053 GCTGCTAGCCTGGGACTGCATGG + Intronic
1036803323 8:11808860-11808882 GCTGTTATCCAGGCGCTGGATGG + Exonic
1037310387 8:17549417-17549439 GCTGGGAACCAGCAGCTGCATGG - Intronic
1038380184 8:27085513-27085535 GGTGCTTGCCAGGAGCTGGAGGG + Intergenic
1044604236 8:94035050-94035072 GCTGTTAACCACCAGCAGCACGG + Intergenic
1046137455 8:110047945-110047967 GTTGCAAACCATTAGCTGCATGG + Intergenic
1049013731 8:139905491-139905513 TCTGCTTCCCCGGAGCTGCACGG - Intronic
1049171028 8:141160760-141160782 GATGCTCACGAGCAGCTGCAGGG - Exonic
1049608150 8:143539246-143539268 GCTGCCACCCAGAAGCTGCTGGG + Exonic
1049700295 8:144008081-144008103 GTTGCTGACGAGGAGCTGCCGGG - Intronic
1050066188 9:1761851-1761873 GGTGGTTACCAGGAACTGCAGGG - Intergenic
1054766546 9:69047150-69047172 CCTGCCAACCAGTATCTGCATGG + Intronic
1057792751 9:98134907-98134929 GCTGCTGACCAGGAACCTCACGG - Exonic
1059840864 9:118214190-118214212 AGTGCTAAGAAGGAGCTGCAAGG + Intergenic
1060025184 9:120164781-120164803 GCTGCTTACCAGGTACTGAAGGG - Intergenic
1062534303 9:137014796-137014818 GCTGCGCTCCAGGTGCTGCAGGG + Exonic
1202804328 9_KI270720v1_random:37020-37042 GTTGCTAACAAGGATCTGAAGGG - Intergenic
1192188342 X:68973230-68973252 GGTGGTAACCAGGGGCTGGAGGG + Intergenic
1197118913 X:122867118-122867140 GGTTCTATCCAGCAGCTGCAAGG - Intergenic
1197287106 X:124608579-124608601 GCTGCTTCCCAAGAGCTGAATGG + Intronic
1198490437 X:137134723-137134745 GCTGATATCCAGAATCTGCAAGG + Intergenic
1199709463 X:150458832-150458854 GCTGGTTACCAAGAGTTGCAGGG + Intronic