ID: 957814889

View in Genome Browser
Species Human (GRCh38)
Location 3:85284653-85284675
Sequence CCTCCCATGCATAGGCAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 153}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957814889_957814893 8 Left 957814889 3:85284653-85284675 CCTGCCTGCCTATGCATGGGAGG 0: 1
1: 0
2: 3
3: 11
4: 153
Right 957814893 3:85284684-85284706 GATCAAGTGAGTGATATATGAGG 0: 1
1: 0
2: 2
3: 14
4: 172
957814889_957814894 16 Left 957814889 3:85284653-85284675 CCTGCCTGCCTATGCATGGGAGG 0: 1
1: 0
2: 3
3: 11
4: 153
Right 957814894 3:85284692-85284714 GAGTGATATATGAGGAAAAAAGG 0: 1
1: 0
2: 1
3: 60
4: 688
957814889_957814897 28 Left 957814889 3:85284653-85284675 CCTGCCTGCCTATGCATGGGAGG 0: 1
1: 0
2: 3
3: 11
4: 153
Right 957814897 3:85284704-85284726 AGGAAAAAAGGTAGGAATCAGGG 0: 1
1: 0
2: 11
3: 278
4: 4623
957814889_957814895 20 Left 957814889 3:85284653-85284675 CCTGCCTGCCTATGCATGGGAGG 0: 1
1: 0
2: 3
3: 11
4: 153
Right 957814895 3:85284696-85284718 GATATATGAGGAAAAAAGGTAGG 0: 1
1: 1
2: 1
3: 24
4: 344
957814889_957814896 27 Left 957814889 3:85284653-85284675 CCTGCCTGCCTATGCATGGGAGG 0: 1
1: 0
2: 3
3: 11
4: 153
Right 957814896 3:85284703-85284725 GAGGAAAAAAGGTAGGAATCAGG 0: 1
1: 0
2: 1
3: 48
4: 562

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957814889 Original CRISPR CCTCCCATGCATAGGCAGGC AGG (reversed) Intronic
900576458 1:3384964-3384986 ACTCCCGGGCATGGGCAGGCTGG + Intronic
900639300 1:3681238-3681260 CCTGCAATGCTCAGGCAGGCAGG - Intronic
903340799 1:22653150-22653172 CCTCCCATGGACCAGCAGGCTGG - Intronic
903657110 1:24956230-24956252 CCTCCCAGGAACAGGCAAGCTGG - Intronic
904443610 1:30550373-30550395 CCACCCTTGCATGGCCAGGCAGG + Intergenic
904584784 1:31574152-31574174 CCTCTTATGCACAGACAGGCAGG + Intergenic
905436193 1:37956878-37956900 CATCCCATGCAGAGGCAGGCTGG - Intergenic
906212913 1:44022117-44022139 ATTCCCATCCATAGACAGGCTGG + Intronic
906757305 1:48330590-48330612 CCTGCCAATCATAGCCAGGCAGG + Intronic
907419353 1:54336457-54336479 GCTCCCATGCACACGCAGGTGGG + Intronic
909523072 1:76591732-76591754 CCTCCCAGGTAGAGGCAGCCAGG - Intronic
909839591 1:80302501-80302523 CCTCCCATGCATAGGAAACATGG - Intergenic
921116187 1:212093618-212093640 ACTGACAGGCATAGGCAGGCCGG - Intronic
921500646 1:215898470-215898492 CCTGCCATCTATAGGCAGGGAGG - Intronic
922155738 1:223038693-223038715 ACACTCATGCAGAGGCAGGCGGG - Intergenic
923040473 1:230316695-230316717 CCTCACATGGATCGTCAGGCTGG + Intergenic
923511465 1:234657243-234657265 TTTCACATGCATAGGCACGCAGG + Intergenic
924606356 1:245538784-245538806 CCTCTGAGACATAGGCAGGCTGG + Intronic
1066044891 10:31586406-31586428 CCTCCCAGGAATAGCCAAGCAGG + Intergenic
1067048577 10:42999586-42999608 TCACCAATGCATAGCCAGGCAGG - Intergenic
1073037366 10:100573504-100573526 ACTGACATGAATAGGCAGGCAGG + Intergenic
1076501686 10:130942149-130942171 CCTCCAAGGCATAGACAGGGCGG + Intergenic
1077077916 11:709541-709563 CCTCCCCTGCAGTGGCAGCCTGG + Exonic
1077300208 11:1843237-1843259 CGTCCCATGCAGAGCCAGGCAGG + Intergenic
1077970639 11:7185892-7185914 TCTCCCATGCATATAAAGGCAGG - Intergenic
1078087808 11:8244693-8244715 CCTCTCAGGCATCTGCAGGCTGG + Intronic
1078654732 11:13227849-13227871 CCTGACATGCATAGACAGCCAGG + Intergenic
1078840938 11:15074990-15075012 CCTCCCCAGGATAGGCAGCCAGG - Intronic
1079003969 11:16779670-16779692 CCTCTCATGCTCAGGCTGGCGGG + Intronic
1083624610 11:64065833-64065855 CTCTCCATGCACAGGCAGGCAGG + Intronic
1084531214 11:69728946-69728968 CCTCCCAGGCCTGGGCTGGCCGG - Intergenic
1084547644 11:69822334-69822356 CCTCCCATTCGGAGCCAGGCGGG + Intergenic
1086863386 11:91951262-91951284 CCTCCCATGGGTAAGCAGGGAGG + Intergenic
1088972643 11:114787261-114787283 CCTCCCAAGCTCATGCAGGCAGG + Intergenic
1094498614 12:31004743-31004765 CCTCCCATGCAGTGGAGGGCAGG + Intergenic
1097284061 12:57864376-57864398 CCTCTCATGGAAAGGCAGGGTGG - Intergenic
1097859797 12:64507403-64507425 CCTCCCTCGCATGGGCAGGGAGG + Intergenic
1098090683 12:66897554-66897576 CCTCCCATGCATTTGTAGGTTGG - Intergenic
1104419929 12:128626937-128626959 CCTCCCTTGACTCGGCAGGCTGG - Intronic
1104805245 12:131585858-131585880 CCACCCTTGCACAGCCAGGCAGG + Intergenic
1106758638 13:32846651-32846673 CTTCCCAGGCATGGACAGGCAGG + Intergenic
1106839937 13:33676209-33676231 CCTCCCATGCCTAAGCAAGCAGG + Intergenic
1107052448 13:36066215-36066237 CTTCCCATGTTTAGGCAGCCAGG + Intronic
1108577168 13:51800491-51800513 CTGCCCACGCACAGGCAGGCTGG + Intronic
1118601185 14:67472442-67472464 CCTCCAATGCACAGGCAGGCTGG - Exonic
1119749423 14:77066966-77066988 CTTGCCATGCACAGGCAGACTGG - Intergenic
1119909008 14:78332916-78332938 CCTCCATTTTATAGGCAGGCTGG - Intronic
1121006121 14:90491732-90491754 CCGCCCACGCACAGGCAGGCGGG - Intergenic
1121217438 14:92259447-92259469 CCTCCCAGTCAGAGGGAGGCTGG - Intergenic
1121613034 14:95294134-95294156 CCACCCATTCTTTGGCAGGCAGG - Intronic
1122924742 14:104894418-104894440 CCAGCCAGGCAAAGGCAGGCTGG - Intronic
1122985119 14:105208358-105208380 CCGCTCATGCACAGGCAGCCTGG + Intergenic
1202922170 14_KI270723v1_random:35999-36021 ACTCCCCTCCATAGGCAGCCAGG - Intergenic
1126110128 15:45170067-45170089 CCTCCCAGGCTAAGGCAGGCTGG + Intronic
1129396113 15:75247966-75247988 CCTCCCATCCATCGGCAAGATGG - Intergenic
1129920415 15:79314854-79314876 CTTCCCTTTCATATGCAGGCTGG + Intronic
1132883924 16:2174116-2174138 GGTCCCACCCATAGGCAGGCTGG - Intronic
1133272821 16:4618994-4619016 CTTGCCTTGCATAGGGAGGCAGG + Intronic
1133763403 16:8818257-8818279 CCTCCCTTGCAGAGGCACGTTGG + Intronic
1134248237 16:12555796-12555818 CCTTTCTTGCAGAGGCAGGCAGG - Intronic
1135165287 16:20133829-20133851 CCTCCCCACCATAGCCAGGCGGG + Intergenic
1138155841 16:54702189-54702211 CCTCCCAGGCAGAGGCCGTCAGG - Intergenic
1138561953 16:57806400-57806422 CCTCCCAGGCACCAGCAGGCGGG + Intronic
1138607199 16:58097005-58097027 CCTCCCCTGAAAAGCCAGGCAGG + Intergenic
1141773680 16:86107328-86107350 CGTCCCAGGCAAGGGCAGGCAGG - Intergenic
1141954196 16:87359305-87359327 CCATCCGGGCATAGGCAGGCAGG - Intronic
1142004013 16:87680481-87680503 CCTCGCATGCAGGGCCAGGCAGG + Intronic
1144024267 17:11263633-11263655 ACTCTCATGGACAGGCAGGCTGG + Intronic
1147678156 17:42221301-42221323 GGTCCCTTGCATAGGAAGGCTGG - Intronic
1147687793 17:42297637-42297659 GGTCCCTTGCATAGGAAGGCTGG + Intronic
1148739724 17:49885932-49885954 CCTCTAATGCTGAGGCAGGCAGG + Intergenic
1150069582 17:62139735-62139757 CCTCCAGTGCATGGGGAGGCAGG - Intergenic
1152029860 17:77835347-77835369 CCTCACATACATAGGCAGTAAGG - Intergenic
1152300831 17:79494679-79494701 CCTCCCATGCCCAGGCAAGGAGG + Intronic
1155109169 18:22697012-22697034 CCTTTCATCCATAGGCAGACTGG + Intergenic
1159065294 18:63562587-63562609 TCTCCCAAGGAAAGGCAGGCAGG - Intronic
1159593941 18:70364468-70364490 CCTCCATAGCATGGGCAGGCAGG + Intergenic
1160727775 19:625149-625171 CCTCCAGTGCATGGGGAGGCAGG - Exonic
1166777650 19:45322688-45322710 CCTCCTATACAAAGGCAGGTCGG - Intronic
1167635065 19:50649490-50649512 CCCACCATGCACAGGAAGGCAGG + Exonic
926057045 2:9779899-9779921 CATCACAGGCAGAGGCAGGCTGG - Intergenic
926342074 2:11911808-11911830 CCTCCAATGCATAGTCACTCTGG + Intergenic
928462644 2:31489409-31489431 CCTCCCATGCCTGGCCGGGCAGG + Intergenic
929413534 2:41724044-41724066 CCTTCCATTTATAGGCAGGGAGG - Intergenic
929882796 2:45851904-45851926 CCTGCCATGGAGAGGCAGGTGGG + Intronic
932105492 2:68937470-68937492 CCTCCAATGCACAGTCAGGCTGG - Intergenic
932774341 2:74518423-74518445 GCTCCATTCCATAGGCAGGCAGG + Exonic
934755880 2:96824583-96824605 CCTCCCAAGGACAGTCAGGCTGG + Intronic
935068527 2:99673849-99673871 CCCCACATGCATAGACAGGTGGG - Intronic
941424363 2:165323391-165323413 CTTCCCATTCATGGGCAGGATGG - Exonic
941648116 2:168063930-168063952 CCTGCAATGCAGAGGAAGGCGGG + Intronic
942059576 2:172215739-172215761 CATGCCATGCAGAGGCAGCCTGG - Intergenic
943030754 2:182682753-182682775 CCACACATGCCTAAGCAGGCTGG - Intergenic
943783169 2:191846918-191846940 TCTCCCATGGCTAGGCAGGTGGG + Exonic
947767303 2:232645968-232645990 CATCCCCTGCATAGCCAGGCAGG + Intronic
948134176 2:235623602-235623624 CCTACCATGCATCTCCAGGCTGG - Intronic
948310282 2:236980469-236980491 CCTTCCATGCATATGCATCCAGG - Intergenic
948460276 2:238125690-238125712 CCTCGCATGCATGGGCTAGCAGG + Intronic
948589518 2:239040163-239040185 CCTCCCATGCGAAGGAAGGGAGG + Intergenic
1169456100 20:5753877-5753899 TCTCCCATGCAGAGGGAGGGGGG - Intronic
1171131718 20:22660168-22660190 CCTTTCTTTCATAGGCAGGCAGG + Intergenic
1171852049 20:30316013-30316035 CCTCCCATACACATGCAGCCTGG - Intergenic
1175173050 20:57093147-57093169 CCTCCCACGCCTGGGCAGCCGGG - Intergenic
1175480951 20:59310481-59310503 CCTCCCAAGAATAGACAGACAGG + Intronic
1179990772 21:44947252-44947274 CCTCACCTCCATAGCCAGGCGGG - Intronic
1181618033 22:24068321-24068343 CCTCCCACACATAGCCATGCTGG - Intronic
1184550914 22:45203736-45203758 GCTACCATGCACAAGCAGGCTGG + Intronic
1185336288 22:50272101-50272123 CCTCTAATGCCTGGGCAGGCAGG - Intergenic
950646228 3:14378435-14378457 CCTCCCAGACAAAGGCAGGGAGG + Intergenic
950665251 3:14491436-14491458 CCCAAAATGCATAGGCAGGCAGG + Exonic
954610464 3:51942270-51942292 CCTCCCCTCCATGGGCAGCCCGG + Intergenic
954746333 3:52789592-52789614 CCTGCTAAGCAAAGGCAGGCAGG + Intronic
957814889 3:85284653-85284675 CCTCCCATGCATAGGCAGGCAGG - Intronic
962702241 3:138010785-138010807 GCTCCCATGTATGTGCAGGCAGG - Intronic
963271465 3:143289810-143289832 CCTCCCATTCATAGCCAGAGAGG + Intronic
966184551 3:177216182-177216204 CCTCCAATGCCTTGCCAGGCAGG + Intergenic
968130711 3:196191352-196191374 CCTGCCAGGAAAAGGCAGGCAGG + Intergenic
968913702 4:3488086-3488108 CCTCCCAGGCACAGGCAGGGAGG + Intronic
969027274 4:4183579-4183601 CCTCCCGCGCATGGGCAGGTAGG + Intergenic
969515972 4:7648464-7648486 ACTCCCAGGCAGAGGAAGGCGGG - Intronic
973613127 4:52656485-52656507 CCTCCCATGTATAGGAAGGCTGG - Intronic
976437045 4:85030052-85030074 TCTCTCATGCATGGGGAGGCTGG + Intergenic
976469003 4:85405198-85405220 CCTTCCAAACATAGACAGGCTGG - Intergenic
978349949 4:107811196-107811218 CCTCATATGCCAAGGCAGGCTGG - Intergenic
980413752 4:132458325-132458347 CCTACCCTACAGAGGCAGGCAGG - Intergenic
985972285 5:3388035-3388057 CCTCCCTTGGAGAGGCTGGCAGG + Intergenic
991221696 5:64225780-64225802 CCTCCCAGCCAAAGGGAGGCTGG - Intronic
999104475 5:149058708-149058730 CCTCCCCAGCATGCGCAGGCTGG - Intronic
1000072631 5:157755033-157755055 CCTCCCTTGCAGAGGCCTGCAGG - Exonic
1002655195 5:180740505-180740527 CCCCCCATGCCTAACCAGGCTGG + Intergenic
1004806145 6:19205640-19205662 CCAAGCATGCATAGCCAGGCTGG + Intergenic
1011839997 6:91485447-91485469 CCTCCCATGGATAGACACACCGG - Intergenic
1013053264 6:106558270-106558292 TCTCCATTGCATAGGAAGGCAGG - Intronic
1016045131 6:139473262-139473284 GCTCCTAACCATAGGCAGGCTGG - Intergenic
1017947044 6:159104341-159104363 CCTCCCAGGCATGGGCAGGAGGG - Intergenic
1020033953 7:4952464-4952486 CCCCCCAGGCATAGGCCGGGCGG + Intronic
1021799959 7:24295380-24295402 TCTCCCATGCAGAGGGAGACAGG + Intergenic
1022508868 7:30922778-30922800 CCTGCCATGTAGAGGCAGGCTGG + Intronic
1024000227 7:45184810-45184832 CCTTCAATGCCCAGGCAGGCAGG + Intronic
1024151200 7:46573017-46573039 CCTCACATGCATGGATAGGCTGG + Intergenic
1026877359 7:73887233-73887255 TCACCCACGCAGAGGCAGGCAGG + Intergenic
1027183133 7:75953374-75953396 ACTCCCAGGCATAGGAAAGCAGG + Intronic
1034640441 7:152597819-152597841 CCTCCCAGGCATGTGCAGGCCGG - Intergenic
1034887017 7:154805836-154805858 CATCCCATGCAGAGGCACGGGGG - Intronic
1035777015 8:2196084-2196106 CCGGCCATGCAGAGGCTGGCGGG - Intergenic
1036696817 8:10980200-10980222 CCTTCCAGGCAGAGGCAGGAAGG + Intronic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1039583537 8:38686193-38686215 CCACCCCTGCAGAGGCATGCAGG + Intergenic
1039958232 8:42223501-42223523 CCTCCCTTGCCATGGCAGGCAGG + Intergenic
1049620021 8:143593850-143593872 CCTCCCATGCTTGGGAATGCGGG - Intronic
1050855816 9:10353512-10353534 TCTCCCATGCAGAGGTTGGCAGG - Intronic
1051434531 9:17016880-17016902 CTTCCCATGCACAGGCCGGTTGG + Intergenic
1053202973 9:36165238-36165260 GCTCCCATGGACATGCAGGCTGG - Intergenic
1053517211 9:38740820-38740842 CCTCCTATACATTGGCAGTCAGG - Intergenic
1053789831 9:41679269-41679291 CCTCCCATACACATGCAGCCTGG - Intergenic
1054155309 9:61635487-61635509 CCTCCCATACACATGCAGCCTGG + Intergenic
1054178171 9:61890959-61890981 CCTCCCATACACATGCAGCCTGG - Intergenic
1054659358 9:67689865-67689887 CCTCCCATACACATGCAGCCTGG + Intergenic
1056495570 9:87151639-87151661 AAGCCCATGCATAGGAAGGCAGG + Intronic
1059562691 9:115350761-115350783 CCACCCATGCAAAGGATGGCTGG - Intronic
1060848653 9:126857431-126857453 CCTCCTCTGCAGAGGCAGCCAGG + Intergenic
1061605198 9:131704814-131704836 CCTCCCAGAGGTAGGCAGGCAGG - Intronic
1062269734 9:135702923-135702945 CCTCCCAGGGATAGGCCAGCGGG - Intronic
1062278848 9:135743110-135743132 CCTCCCAGGGACAGGCAGGCAGG + Intronic
1185599473 X:1329123-1329145 CATCCCAGGCAAATGCAGGCTGG + Intergenic
1192147343 X:68690412-68690434 ACTCCCATTCCCAGGCAGGCAGG + Intronic
1202180107 Y:22132525-22132547 CCTACAATGTCTAGGCAGGCTGG + Intergenic
1202211253 Y:22453874-22453896 CCTACAATGTCTAGGCAGGCTGG - Intergenic