ID: 957816636

View in Genome Browser
Species Human (GRCh38)
Location 3:85308623-85308645
Sequence CTATTTCCACAGGTGGTATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 152}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957816636 Original CRISPR CTATTTCCACAGGTGGTATT GGG (reversed) Intronic
902409408 1:16204352-16204374 CTATTTCCCAGGGAGGTATTTGG + Intronic
904956764 1:34291086-34291108 GTTTTTCCACAAGTGGGATTGGG + Intergenic
905461684 1:38126477-38126499 CTATTTCCAGAAGAAGTATTGGG - Intergenic
905578612 1:39066223-39066245 CTATTTCTAGAAGTGGTCTTTGG - Intergenic
908025682 1:59949365-59949387 CTGCTTCCTCATGTGGTATTTGG + Intergenic
908156490 1:61358792-61358814 CTATCTCCACAGGTGGTGGCTGG - Intronic
910556299 1:88537694-88537716 CAATTTTCACAGGTTTTATTAGG + Intergenic
911418893 1:97614050-97614072 GTAGTTCCACACATGGTATTGGG + Intronic
913557831 1:119986745-119986767 ATATTTTCACAGGTATTATTGGG - Intronic
915609566 1:156980392-156980414 CTATTTCCACTGCTGGGAGTGGG + Intronic
918085178 1:181239006-181239028 CTATATCCACAGGTACTATCTGG + Intergenic
922340981 1:224655030-224655052 CTATTTACAGAGGAGGTATAGGG + Intronic
922371963 1:224920220-224920242 TTATTTCCACAGCTGGCATAGGG + Intronic
922879986 1:228973616-228973638 CAAATTCCACAGGTGGAATTTGG - Intergenic
924196965 1:241618264-241618286 CTATTTCAAAAGCTGGCATTTGG - Intronic
1063111129 10:3038344-3038366 CTATTTAAACAGAAGGTATTTGG - Intergenic
1063320004 10:5044000-5044022 CTGTTCCCACAGGTGCTTTTGGG - Intronic
1068378720 10:56218653-56218675 CTATTCACACTGGTGTTATTGGG + Intergenic
1069649409 10:70033946-70033968 CTAGTTCCACAAGAGGCATTGGG + Intergenic
1075950230 10:126470916-126470938 CTATTTCCTCACGTGGGATTGGG + Intronic
1078351449 11:10598082-10598104 CTATATCCTCAGATGGAATTTGG - Intronic
1080322123 11:31022460-31022482 CTATTTCCACATGAGGTACTGGG + Intronic
1080695002 11:34595838-34595860 CTATTTCAGTAGGTGGTAGTGGG + Intergenic
1084148895 11:67278951-67278973 CTGTTTCCCCAGGTGGTAGCTGG - Intronic
1085075799 11:73590822-73590844 CTATTTAGACAGGTAGTATCTGG - Intronic
1086084659 11:82942668-82942690 CTACTTCCACAGCTGACATTGGG + Intronic
1087082192 11:94182028-94182050 CTATTTACATAGTTGGAATTGGG - Intergenic
1088123041 11:106392186-106392208 CTGTTTCCACAGGAGTTATGAGG - Intergenic
1088277283 11:108101213-108101235 CTATTTGCATAGGTGGCATCTGG + Intronic
1088847471 11:113680515-113680537 CTATTTAGACATGTGGTATACGG + Intergenic
1088903476 11:114136323-114136345 CTGTTTCCACAGTTGCTTTTGGG - Intronic
1088919762 11:114252357-114252379 CTATTTTCACGGCTGGTCTTTGG + Intergenic
1089772215 11:120811508-120811530 CTATTTCCTCAGTTTGTTTTGGG + Intronic
1089916509 11:122162088-122162110 CTATTTCCAACAGGGGTATTGGG + Intergenic
1091508215 12:1094785-1094807 CTATTACCAGAGATGGTAATGGG + Intronic
1094256161 12:28429043-28429065 CTATTTCCCAAGGTGGTTTTGGG + Intronic
1103492193 12:121330361-121330383 GAATTTCCACAGATGTTATTAGG + Intronic
1103602879 12:122065244-122065266 CTCTCTCCACAGGTGGGGTTGGG + Intergenic
1104452281 12:128879806-128879828 TTATTCCCACAAGTGGGATTAGG + Intronic
1105405784 13:20131503-20131525 CTATTTCCTTATTTGGTATTTGG + Intergenic
1105926972 13:25017644-25017666 ATATTTCAACTTGTGGTATTTGG - Intergenic
1106594045 13:31122044-31122066 CTATTCCCAAAGATGTTATTAGG - Intergenic
1108872501 13:55004620-55004642 CAATTTCCACATGTTGTAGTAGG - Intergenic
1111317133 13:86577817-86577839 CTATTTCCACATGGGGCCTTTGG + Intergenic
1112388744 13:98963582-98963604 CTATTTCAAGAAGTGGCATTTGG - Intronic
1114267854 14:21083141-21083163 CTATTTCCACAGCTGGTAAATGG + Intronic
1115053297 14:29091388-29091410 ATATTTCCACAGCTGGTGTGGGG - Intergenic
1116233503 14:42248264-42248286 CTATTTCCTCAAGGGGTATTGGG + Intergenic
1116668330 14:47807765-47807787 CTATTTCCAGAGGTAGGGTTAGG - Intergenic
1117242099 14:53844363-53844385 CTATTTTCACATGTGGTAGAGGG + Intergenic
1120000511 14:79297750-79297772 GAATTTGCACAGGTGTTATTGGG + Intronic
1121888646 14:97568346-97568368 CTAATTCCTCAGGTGATATAGGG - Intergenic
1125450701 15:39803766-39803788 CTATTTTCCCAGGTGGCTTTAGG - Intronic
1127333453 15:57961090-57961112 CAAATTCCACTGGTGGTATAGGG - Intronic
1127572694 15:60259913-60259935 TTATTTCCCCAGGGGGGATTAGG - Intergenic
1128010011 15:64284070-64284092 TTATTTTGACAAGTGGTATTGGG - Intronic
1139146992 16:64337370-64337392 CCATTTCTCCAGGTGGCATTCGG - Intergenic
1144959343 17:19036070-19036092 CTCTCTCCGCAGGTGGTACTCGG - Exonic
1144975816 17:19138454-19138476 CTCTCTCCGCAGGTGGTACTCGG + Exonic
1145781103 17:27563955-27563977 TTATTTGTACAGTTGGTATTCGG + Intronic
1146839021 17:36136668-36136690 CTATTTCAAAAGGTTGTTTTAGG - Intergenic
1151615338 17:75206481-75206503 CTTTTTCCAAAGATGGTTTTGGG + Intronic
1153708630 18:7774169-7774191 CTATATCCACATGTGCTATACGG - Exonic
1156530191 18:37807647-37807669 ATTTTTCCACAAGTGGAATTGGG + Intergenic
1159894902 18:73987333-73987355 CTTTTTGCAAAGGTGGTTTTGGG - Intergenic
1164074052 19:21796895-21796917 CTATTTCCACAAATATTATTTGG + Intergenic
1164958654 19:32407510-32407532 CTACTTCCATAGGCGGTAGTAGG - Intronic
928960148 2:36916127-36916149 GTATTTCAACTTGTGGTATTTGG + Exonic
929106925 2:38374758-38374780 CTTTTTCCACAGTTGGTATTAGG - Intronic
930752389 2:54945924-54945946 CTGTTTCCACAGGGGGTACAGGG + Intronic
931183662 2:59928959-59928981 CTATTTTTTCAGGAGGTATTTGG - Intergenic
931641104 2:64381926-64381948 CTACTTCCACAGGTGCAATGGGG + Intergenic
932916616 2:75865932-75865954 CTGTTTCCACAGGTCGGAGTCGG - Intergenic
940209044 2:151237527-151237549 CCACTTCCACAGGTTCTATTTGG - Intergenic
942590352 2:177538160-177538182 CTGTTTCCAAAGATGTTATTGGG - Exonic
945111480 2:206364507-206364529 CTCTTTCCACAGGAGTTATATGG - Intergenic
946534619 2:220612811-220612833 CTATCTCCACGGGTGATAGTTGG + Intergenic
947071250 2:226290434-226290456 TCATTTTAACAGGTGGTATTTGG - Intergenic
947470859 2:230400216-230400238 CACTTTCCACAGGTGGGATGTGG - Exonic
947558024 2:231115367-231115389 CTGTTTCCAGAGTTGGTATGTGG + Intronic
1181902256 22:26166267-26166289 TTATCTCCCCAGGTGGCATTGGG + Intergenic
1182699588 22:32224837-32224859 CAATTTCCAGAGCTGATATTAGG + Intronic
955353273 3:58209708-58209730 CCAGTGCTACAGGTGGTATTTGG + Intronic
957152981 3:76510360-76510382 CCATTTCCTCAGGTTGTATATGG - Intronic
957816636 3:85308623-85308645 CTATTTCCACAGGTGGTATTGGG - Intronic
958122169 3:89304927-89304949 GTATTTCCAGAGGTGTCATTAGG + Intronic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
960306356 3:116066265-116066287 CTATTTGGAAATGTGGTATTTGG - Intronic
960728621 3:120698521-120698543 CTATTACCAACAGTGGTATTTGG + Exonic
963206835 3:142644868-142644890 CAATTTCCAGAGTTGGTAGTGGG + Intronic
967843083 3:194022625-194022647 CTATTTCCACAAGAGATGTTAGG - Intergenic
971298049 4:25417539-25417561 GTTTTACTACAGGTGGTATTAGG - Intronic
971696113 4:29905527-29905549 CAATTTCCACATGTGCCATTTGG + Intergenic
971921766 4:32949655-32949677 ACATACCCACAGGTGGTATTTGG - Intergenic
971956286 4:33423658-33423680 CTATGTCCCCATGTTGTATTTGG - Intergenic
975029047 4:69591003-69591025 GTGTTCCCAGAGGTGGTATTTGG + Intronic
977094348 4:92720442-92720464 TTATTCCCAAAGGTAGTATTTGG - Intronic
979607204 4:122651168-122651190 CAATAGCCACAGGTGGTAATTGG - Intergenic
980150690 4:129043781-129043803 CTGTTTCCCCAGGAGATATTTGG - Intronic
980206188 4:129721690-129721712 GCATTTCTACAGGTGATATTTGG - Intergenic
980851426 4:138387771-138387793 CTATTTAGACATGTGGTATGTGG - Intergenic
981091646 4:140738505-140738527 CTTTTTCCAAAGATGGTTTTGGG - Intronic
981830231 4:148991352-148991374 CTATTCACAATGGTGGTATTAGG + Intergenic
983552626 4:169032989-169033011 CTGTTTCCACAGGTGTAAATTGG - Intergenic
983631406 4:169853187-169853209 CTTTTTCCAAAGGGGGTTTTTGG - Intergenic
983662520 4:170144170-170144192 TTATTTCCATAGGTGTTTTTGGG + Intergenic
986516707 5:8572033-8572055 CTATTTGCTCAGGTGGTGCTGGG + Intergenic
988263932 5:28927135-28927157 ATATTTCAACTTGTGGTATTTGG - Intergenic
992421732 5:76613113-76613135 CCCATTCCACAGGTGGTATGAGG - Intronic
994933903 5:106226711-106226733 CTATTGCCACAGATGGGTTTTGG - Intergenic
994981028 5:106875353-106875375 CTAATTCCACATGTGGCCTTTGG + Intergenic
996559735 5:124815809-124815831 CTATTTCTCCAGGTGTTATAAGG + Intergenic
998178596 5:139918663-139918685 CTATTTAGACAGGTTGGATTTGG + Intronic
998997941 5:147886964-147886986 CCATTTCCAAAGATGGGATTAGG + Intronic
1000606294 5:163331119-163331141 ATTTTTGCACAGGTGGTGTTAGG + Intergenic
1002009275 5:176264147-176264169 CTACTCCCACAGGTGGGAGTTGG + Intronic
1002142259 5:177149596-177149618 GTTTTTCCACAGGTGGGAGTGGG + Intronic
1002217448 5:177648136-177648158 CTACTCCCACAGGTGGGAGTTGG - Intergenic
1004282413 6:14292315-14292337 CTATTTACACAGGTGGTAGCAGG - Intergenic
1010939581 6:81900505-81900527 ACATTTCCACATGTGGAATTGGG - Intergenic
1011527625 6:88282360-88282382 CTATTTTCACAGCTGCTATGAGG + Intergenic
1011536864 6:88384949-88384971 ATTTTTGCACAGGTGGTATGTGG - Intergenic
1011900713 6:92292370-92292392 CTATTTACAAAGGTGGGATTGGG - Intergenic
1012127400 6:95448189-95448211 CTGTTTCTTCAGGTGGTATACGG + Intergenic
1013586453 6:111582977-111582999 CTCTTTGGACAGGTGATATTTGG - Intronic
1016612633 6:146009729-146009751 CTCTTGCCTCAGGTGGTAGTAGG + Intergenic
1020625349 7:10571239-10571261 ACATGTCCATAGGTGGTATTTGG + Intergenic
1021373292 7:19877223-19877245 ATTTTTCCATAGGTGGTATTTGG + Intergenic
1021976055 7:26012185-26012207 CTATTTCCAGAGGTGGAGTTTGG + Intergenic
1022057912 7:26759120-26759142 TCATTTCCCCAGGTGGAATTTGG - Intronic
1023187534 7:37547814-37547836 CTTTTTCCAAAGGTGGTTTTGGG + Intergenic
1025161745 7:56667183-56667205 CTGTCTCCACAGTTGGAATTGGG + Intergenic
1025223915 7:57140105-57140127 CTCTCTCCACAGTTGGAATTGGG + Intergenic
1025927241 7:65969994-65970016 CTGTTTTCACAGATGGTCTTTGG - Intronic
1029908459 7:104118409-104118431 CTATTTCCTCACGTGGTAGAAGG + Intergenic
1030906524 7:115190270-115190292 CTATTTCCACAGATAAAATTTGG - Intergenic
1034433419 7:151051971-151051993 CTGTCTCCACAGGTGACATTGGG + Exonic
1036053852 8:5228777-5228799 CTCCTACCACAGGAGGTATTGGG + Intergenic
1039515785 8:38132431-38132453 CTGTTCCCACAGGTGGTCTCTGG - Intronic
1039788691 8:40856672-40856694 ATATTTCCCCAGGTGACATTGGG + Intronic
1041944131 8:63423054-63423076 CTCTTTTCCCAGGTGGTCTTTGG + Intergenic
1042102391 8:65287339-65287361 CGATTTTCACAAGTTGTATTTGG + Intergenic
1044250365 8:89998914-89998936 CTTTTTCCAAAGGGGGTTTTGGG - Intronic
1046476373 8:114749930-114749952 CTTTTTCCAAAGATGGTTTTGGG - Intergenic
1046549058 8:115689421-115689443 CTAATTCAACAAGTGTTATTTGG + Intronic
1046567463 8:115919485-115919507 CACTCTCCACAGGTGGGATTAGG - Intergenic
1047543267 8:125791357-125791379 CTAATACCTAAGGTGGTATTAGG + Intergenic
1047921649 8:129640630-129640652 CTATCTCTAAAGATGGTATTAGG + Intergenic
1048406634 8:134129126-134129148 CTCTTTCCACATGTGGGATGCGG + Intergenic
1050236836 9:3590604-3590626 CTATTTCCAAACGTGACATTTGG - Intergenic
1050875848 9:10634815-10634837 TTATTTCCACAAATGATATTGGG - Intergenic
1053444001 9:38137511-38137533 CTCTTTCCCCAGGTCCTATTGGG + Intergenic
1056050590 9:82764410-82764432 CTGTTTCCGCATGTGGTGTTTGG + Intergenic
1058181416 9:101804857-101804879 CTTTATCCAGAGGTGGTATCTGG + Intergenic
1058786335 9:108392513-108392535 CCATTTCTACAAGTCGTATTTGG - Intergenic
1060333344 9:122696806-122696828 TTATTTTTACAGATGGTATTAGG + Intergenic
1190509601 X:51162204-51162226 CTAATTCTACTGCTGGTATTTGG + Intergenic
1190861471 X:54348813-54348835 TTATTTCCTCAGTTGGTAGTAGG - Intronic
1191736031 X:64388695-64388717 CTAGTTCCACAGATGTTAATAGG + Intronic
1194012400 X:88578655-88578677 TTATTTCCACAGGTGTTTTGAGG - Intergenic
1194332908 X:92606432-92606454 GTCTTTCCACAAGTGGCATTGGG + Intronic
1197169217 X:123412507-123412529 CTATTCCCACAGGCAGTTTTTGG - Intronic
1198115319 X:133539234-133539256 ATATTTACACAGCTGGTATGGGG + Intronic
1198580294 X:138056527-138056549 CCCTTTCCTCAGGTGTTATTAGG + Intergenic
1200641604 Y:5725458-5725480 GTCTTTCCACAAGTGGCATTGGG + Intronic