ID: 957824836

View in Genome Browser
Species Human (GRCh38)
Location 3:85427291-85427313
Sequence AGTCCAATAATTAAACTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 90}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957824830_957824836 26 Left 957824830 3:85427242-85427264 CCAACATTTATGAGAAAACACAT 0: 1
1: 0
2: 9
3: 22
4: 379
Right 957824836 3:85427291-85427313 AGTCCAATAATTAAACTGGGTGG 0: 1
1: 0
2: 0
3: 6
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957824836 Original CRISPR AGTCCAATAATTAAACTGGG TGG Intronic
902980246 1:20117591-20117613 AGTCCATGAATTCAAGTGGGAGG + Intronic
903786930 1:25867523-25867545 AGTCCAATAAGTAAGCTTGGAGG - Intronic
906075083 1:43046252-43046274 AATCCAAAAAATAAAATGGGAGG + Intergenic
908038248 1:60079370-60079392 ACTCCAACAAATAAATTGGGAGG + Intergenic
912120089 1:106460874-106460896 AGTCAAACATTTAAACTGGTTGG - Intergenic
918555503 1:185794669-185794691 AGACCCATACTTAATCTGGGTGG - Intronic
918784543 1:188748951-188748973 AGTCCAATATTTAAATTGTTTGG - Intergenic
920875715 1:209833594-209833616 ACTCCAATAATGAAAATGTGAGG - Intronic
923646899 1:235831615-235831637 AATCAAAGAATTAAACTGTGAGG - Intronic
924553745 1:245101247-245101269 CCTCCAATAATTAAACTGCAAGG - Intronic
1063513568 10:6671437-6671459 AGGCCTAAAATTTAACTGGGAGG + Intergenic
1064649902 10:17498746-17498768 AGTCAATTAATTAAATTGGTGGG + Intergenic
1064786900 10:18907851-18907873 AGTCCAATAAGAAAAGTGGTTGG + Intergenic
1066054597 10:31668660-31668682 AGTCCTATAATTACTCTGTGTGG - Intergenic
1071325045 10:84506495-84506517 ATGGCAATAATTAAACTGGCCGG + Intronic
1081339449 11:41908570-41908592 AATCCCATAGTGAAACTGGGAGG + Intergenic
1081970696 11:47196559-47196581 AGTGTAAGAATTAAACTGGCTGG + Intergenic
1082093927 11:48111586-48111608 AGTTTAATAAATAAACTGGTGGG + Intronic
1084099584 11:66937253-66937275 AGTCCAATAATTACAGTTGAAGG + Intronic
1090886025 11:130877660-130877682 AAGCCAATAAATAAAATGGGTGG + Exonic
1091699687 12:2651465-2651487 TGTCCACTCATTAAAGTGGGCGG + Intronic
1093715246 12:22374555-22374577 AGTCTGCTAATTAATCTGGGTGG - Intronic
1102484080 12:113244310-113244332 AGGCCAGCAATTCAACTGGGAGG + Intronic
1104275415 12:127322771-127322793 AGTCCATTAATGAAACAGAGAGG - Intergenic
1105561149 13:21492043-21492065 ATTTCAATCATTAAACTGTGAGG + Intergenic
1107030491 13:35847518-35847540 AGTCCAAGAATTAAAATATGTGG + Intronic
1113610117 13:111638573-111638595 TGTCTCATAATTAAACTGGCAGG + Intronic
1119362356 14:74061902-74061924 TTTATAATAATTAAACTGGGGGG + Intronic
1120201275 14:81540566-81540588 AGTTCAAGCACTAAACTGGGTGG + Intergenic
1129286283 15:74527719-74527741 AGTCCAATACTTACACAGGTAGG + Intergenic
1130880929 15:88055260-88055282 ACTTAAAAAATTAAACTGGGAGG + Intronic
1131998626 15:98157881-98157903 AGTCTCATAATAAAACTGTGAGG - Intergenic
1134888838 16:17820238-17820260 AGTCCAATCAAGAAGCTGGGAGG + Intergenic
1143408089 17:6691265-6691287 AGTCCATTCACCAAACTGGGAGG - Intronic
1144415247 17:15040395-15040417 ATTCCTAAAGTTAAACTGGGAGG + Intergenic
1148679418 17:49465175-49465197 AGTTTGATAATTTAACTGGGAGG + Intronic
1151504445 17:74517353-74517375 AGTCCAAGATTTTATCTGGGAGG - Intergenic
1153274445 18:3354135-3354157 AGTTCTATTATTAAACTGGAAGG - Intergenic
1156238023 18:35222729-35222751 AGTACAATATTAAAACTAGGAGG - Intergenic
1159709371 18:71735949-71735971 AGTAGAATAATAAAACTGGCAGG + Intronic
1164673815 19:30088871-30088893 AGTCCAATCAATTACCTGGGAGG + Intergenic
929091436 2:38221557-38221579 AGTCCAATGAGTATAATGGGTGG - Intergenic
930003817 2:46880562-46880584 AACCCAATAAATAAACTGGTGGG + Intergenic
931710590 2:64986813-64986835 ACTCCAATTTTTTAACTGGGTGG + Intergenic
932687858 2:73888452-73888474 AGGCAAATGTTTAAACTGGGGGG + Intergenic
932802451 2:74753509-74753531 AGTTTAAAAATTAAACTGGCTGG + Intergenic
935850962 2:107218068-107218090 ACTCCAATAAATAAACTGACTGG + Intergenic
939441018 2:142249372-142249394 AATTCAACAATTAAAATGGGAGG - Intergenic
940585970 2:155650118-155650140 AGACCATTATTTAGACTGGGTGG - Intergenic
1169941680 20:10944733-10944755 AGTCCAAAAGTTAAGCTGTGGGG - Intergenic
1170899623 20:20449055-20449077 AGTTCATTAATTAAACAGTGCGG + Intronic
1177274572 21:18892480-18892502 AGTGAAATAATTATACTGGGAGG - Intergenic
1179204996 21:39268181-39268203 AGTTTAATAATTATATTGGGAGG + Intronic
1181691809 22:24566969-24566991 AGTCGAATAATGACACTGGACGG - Intronic
956167665 3:66408610-66408632 AGTCCAATTCTTAAAGTGAGGGG - Intronic
957824836 3:85427291-85427313 AGTCCAATAATTAAACTGGGTGG + Intronic
958521047 3:95185746-95185768 AATTCAATCATTAAACTGAGTGG + Intergenic
963646376 3:147919474-147919496 TGTGCAATAATTAAAATGGCTGG + Intergenic
968952781 4:3703273-3703295 AGTCCATTAATTAAGAGGGGGGG + Intergenic
970638959 4:18041973-18041995 AGTAGAAAAATTAAACAGGGAGG - Intergenic
971992940 4:33924751-33924773 AGTCTAATAAATAAAGTGTGAGG - Intergenic
972993648 4:44852547-44852569 AGTCCATTAAATCAGCTGGGAGG + Intergenic
973291765 4:48477864-48477886 ATTCCAATAAATATACTAGGTGG - Intergenic
974223924 4:59014016-59014038 AGACCCATACTTAATCTGGGTGG + Intergenic
977039586 4:92000115-92000137 AAGCCAATAAATAAAGTGGGGGG - Intergenic
977234304 4:94488809-94488831 AGTCCAATAAACAAAGAGGGTGG - Intronic
977727939 4:100319511-100319533 AGAGCAATAAATAAACTAGGAGG + Intergenic
980427056 4:132639388-132639410 AGACCAACACTTAATCTGGGTGG + Intergenic
986863101 5:11951166-11951188 AGTACAATTATTAATCTGGATGG + Intergenic
986953240 5:13117214-13117236 AGACCACTAATTAAAATGGCAGG - Intergenic
989280820 5:39641109-39641131 AGTCCAATAATTACACATAGTGG + Intergenic
990211483 5:53484336-53484358 AGTTCTATTATTAAACTGTGGGG + Intronic
991936874 5:71810809-71810831 AGCCTTATAATTAAACTGAGAGG - Intergenic
993788480 5:92175149-92175171 AGGCAAATAATTAAACTGTTTGG + Intergenic
995484543 5:112627111-112627133 AGTCCAGTAATTCAATTTGGTGG - Intergenic
999538237 5:152542198-152542220 AGACCAATAATTAAAATGAATGG - Intergenic
1003847765 6:10191202-10191224 AGTCCAGTAATTAGACTGGAGGG + Intronic
1005981753 6:30841988-30842010 GGTCCATTAAGTCAACTGGGGGG - Intergenic
1011417619 6:87139074-87139096 AGTCCAAAAATAAGTCTGGGAGG - Intergenic
1013374304 6:109499406-109499428 AATCCAATACTTAACCTGAGAGG + Intronic
1014849668 6:126326582-126326604 AGTCTCATAAAGAAACTGGGGGG + Intergenic
1022127377 7:27371667-27371689 AGTGCAATTATTAAACAGAGGGG - Intergenic
1030784413 7:113642035-113642057 ACTCCCATAATTCTACTGGGAGG - Intergenic
1033856843 7:145572545-145572567 AAACCAATAATTAGACTGGTAGG - Intergenic
1039332782 8:36557595-36557617 AGACTCATAATTAAATTGGGCGG - Intergenic
1040640730 8:49331700-49331722 ATTCCAATAAGTTTACTGGGTGG - Intergenic
1041172032 8:55153183-55153205 CGTCCAATTTTAAAACTGGGAGG - Intronic
1042346031 8:67728945-67728967 TGTCCAAGAATTAAATTGGGTGG - Intronic
1046486686 8:114896360-114896382 GGTCCTTTAAGTAAACTGGGTGG - Intergenic
1046592522 8:116223474-116223496 ATTTCAATAATTCAACTGGGAGG - Intergenic
1047109032 8:121768043-121768065 AATCCAATAATCAAATTGGCAGG + Intergenic
1047536960 8:125728748-125728770 AGTCCAAAAGTTCAACTGTGTGG + Intergenic
1048873701 8:138819848-138819870 AGCCCAATCATTAAACTTGAGGG + Intronic
1057734503 9:97642655-97642677 AATTCAATAATTAAACTGGTAGG + Intronic
1188970051 X:36604233-36604255 AGACAAATAATTTAACTAGGAGG - Intergenic
1195527246 X:105905463-105905485 AGTCTAATATCTTAACTGGGAGG + Intronic
1197409651 X:126099438-126099460 AGAACAACAATTAATCTGGGTGG - Intergenic