ID: 957831333

View in Genome Browser
Species Human (GRCh38)
Location 3:85524592-85524614
Sequence ATGTATAATCTACTGCTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1289
Summary {0: 1, 1: 1, 2: 18, 3: 221, 4: 1048}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957831333 Original CRISPR ATGTATAATCTACTGCTGTT GGG Intronic
900699571 1:4036639-4036661 ATGTATATTCTGCAGTTGTTGGG - Intergenic
901172808 1:7274615-7274637 ATGTATATTCTGCCACTGTTGGG - Intronic
901176832 1:7308785-7308807 ATGTGTATTCTGCTGATGTTGGG + Intronic
902660515 1:17898038-17898060 ATGTATATTCTGTGGCTGTTGGG - Intergenic
902968233 1:20027776-20027798 ATGTATATTCCTCAGCTGTTGGG + Intergenic
902971724 1:20058088-20058110 ATGTGTATTCTACTGTTGTTGGG + Intronic
904346313 1:29872797-29872819 ATATATATTCTACTGTTGTTGGG - Intergenic
904668780 1:32146063-32146085 ATGTATATTCTGCTGTTATTGGG + Intronic
905052574 1:35064481-35064503 ATGTATGTTCTACTGTTGTTGGG - Intronic
905722270 1:40215312-40215334 ATGTATATTTAGCTGCTGTTGGG - Intronic
905859266 1:41337470-41337492 ATGTGTATTCTTCTGTTGTTGGG + Intergenic
905903943 1:41603786-41603808 ATGTGTATTCTGCTGCTATTTGG + Intronic
906018030 1:42600476-42600498 ATGTGTAATCTGCTGTTGTTGGG - Intronic
906896740 1:49781666-49781688 TTGTATACTCTGCTGCTGTTGGG - Intronic
906909621 1:49934321-49934343 ATTTATATTCTGCTGCTGTTGGG - Intronic
907001443 1:50863041-50863063 ATGTATATTCTGCAGTTGTTGGG - Intronic
907019829 1:51056057-51056079 GTGGATAATCTTCTGTTGTTGGG + Intergenic
907887170 1:58603714-58603736 ATGTATATTCTGCAGTTGTTGGG + Intergenic
908372607 1:63498234-63498256 ATGTGTATTCTGCTGTTGTTGGG - Intronic
908819684 1:68071852-68071874 ATGTGTATTCTGCTGTTGTTGGG + Intergenic
908862159 1:68501292-68501314 ATGTATATTCTGCGGTTGTTGGG - Intergenic
908929855 1:69305705-69305727 ATTTATATTCTACTGCTGATGGG - Intergenic
909005128 1:70266897-70266919 ATGTGTATTCTGCTGTTGTTGGG + Intronic
909048779 1:70743458-70743480 ATGTATATTCTATGGTTGTTGGG + Intergenic
909235038 1:73142103-73142125 ATGTATATTCTGCAGTTGTTGGG + Intergenic
909312313 1:74168046-74168068 ATGTATATTTTGCTGTTGTTGGG + Intronic
909320066 1:74274061-74274083 ATTTATAGCCTACTGCTGATTGG + Intronic
909348802 1:74624422-74624444 ATGTGTAATGTAGTGCTGTGAGG - Intronic
909411425 1:75356900-75356922 TGGTATAATCTACTGCTCATAGG - Intronic
909454165 1:75831462-75831484 ATGTATATTCTGCTGCTTTGGGG - Intronic
909486156 1:76176565-76176587 ATCTATAAGCTAATGCTGGTGGG - Intronic
909536602 1:76743455-76743477 TTGTATATTCTGCTGCTGTTGGG + Intergenic
909546121 1:76849433-76849455 ATGTATATTCCCCTGCTGTTGGG + Intergenic
909712679 1:78670099-78670121 CTGTATAATCTAATACTATTGGG + Intergenic
909828134 1:80151921-80151943 ATGTATATTCTGCAGTTGTTGGG + Intergenic
910165048 1:84318564-84318586 ATGTATATTCTGCAGTTGTTAGG + Intronic
910224165 1:84919251-84919273 ATGAGTAATTTACTGCTGCTAGG + Intergenic
910919354 1:92327059-92327081 ATGTATATCCTGCTGTTGTTGGG + Intronic
910927786 1:92413905-92413927 ATGTTTAATCCACTGTTTTTAGG + Intergenic
911669759 1:100594272-100594294 ATGTGTATTCTGCTGCTGTTAGG + Intergenic
911806531 1:102215728-102215750 ATGTATATTACATTGCTGTTGGG - Intergenic
911929738 1:103886728-103886750 ATGTATATTCCACTGGTTTTGGG - Intergenic
911970315 1:104426621-104426643 ATGTGTATTCTACTGTTGTTGGG - Intergenic
912037878 1:105344793-105344815 TGGTATAATCTATTGCTCTTTGG - Intergenic
912180884 1:107217909-107217931 ATGTATATTCTCCAGTTGTTGGG + Intronic
912588567 1:110789904-110789926 ATGTGTATTCTTCAGCTGTTGGG - Intergenic
912659859 1:111517797-111517819 ATGGATTATCTATTTCTGTTTGG + Intronic
912805209 1:112751345-112751367 ATATGTATTCTACTGTTGTTGGG + Intergenic
912882186 1:113426359-113426381 AGGTATATTCTGCTGTTGTTGGG + Intronic
912892991 1:113555495-113555517 ATGTGTATTCTGCTGCTGTTGGG - Intronic
913035547 1:114961803-114961825 ATGTATATTCTGCAGTTGTTAGG + Intronic
913177032 1:116283994-116284016 ATGTGTATTCTGCAGCTGTTGGG + Intergenic
913193963 1:116439023-116439045 ATGCATATTCTGCTGTTGTTAGG + Intergenic
913429231 1:118771470-118771492 ATGTATATTCTTCAGTTGTTGGG - Intergenic
913463964 1:119119588-119119610 ATGTATATTCTGCAGTTGTTGGG - Intronic
914696258 1:150083373-150083395 ATGTATATACTACTGCTGTGAGG + Intronic
914906133 1:151746466-151746488 ATGTGTACTCTGCTGTTGTTGGG + Intergenic
914968580 1:152284993-152285015 ATGTATATTCTATTGGTTTTGGG - Intergenic
915001235 1:152594675-152594697 AAGTATATTCTGTTGCTGTTTGG + Intronic
915821424 1:159028476-159028498 ATGTATATTCTGCAGTTGTTGGG + Intronic
916392746 1:164348789-164348811 ATGTATATTCTGCTGTTGTTGGG - Intergenic
916453631 1:164947085-164947107 ATGTCTACTCTGCTGCAGTTGGG + Intergenic
916566140 1:165980067-165980089 ATGTATATTCTGCAGTTGTTGGG + Intergenic
916594760 1:166233489-166233511 ATGTATATTCTATTGGTTTTGGG - Intergenic
916637281 1:166686249-166686271 ATGTATATTCTGCTGTTTTTGGG - Intergenic
917251613 1:173068861-173068883 ATGTATATTCTGCTATTGTTGGG - Intergenic
917272287 1:173290758-173290780 ATGTATATTCTGTTGTTGTTGGG - Intergenic
917351426 1:174082304-174082326 ATGTATATTCTGCAGTTGTTGGG - Intergenic
917428647 1:174942248-174942270 ATGTATTTCATACTGCTGTTCGG + Intronic
917664064 1:177206928-177206950 ATGTATTATCTATTGCTCTGGGG - Intronic
917673374 1:177295824-177295846 ATGTATATTCTGGTGTTGTTGGG + Intergenic
918172126 1:182007897-182007919 ATGTATATTCTGCAGTTGTTAGG - Intergenic
918206908 1:182317581-182317603 ATGTTGAATCTACTGTTGGTTGG - Intergenic
918529982 1:185508281-185508303 ATGTATATTCTGCAGTTGTTGGG + Intergenic
918620670 1:186601389-186601411 ATGCCTACTCTACTGCTCTTAGG + Intergenic
918888018 1:190222096-190222118 ATGTATATTCTGCAGCAGTTGGG - Intronic
918942014 1:191012743-191012765 ATGTTTATTCTGTTGCTGTTGGG - Intergenic
918969074 1:191390101-191390123 ATGTATACTTTATTACTGTTGGG - Intergenic
919420998 1:197370355-197370377 ATGTATATTCTGCAGTTGTTGGG - Intronic
919430907 1:197490197-197490219 ATGTATATTCTGCAGTTGTTGGG - Intergenic
919485459 1:198141006-198141028 ATGTATATTCTGCAGTTGTTGGG + Intergenic
919618565 1:199837966-199837988 ATGTATATTCTTCTGTTGTTGGG - Intergenic
919730469 1:200910735-200910757 ATATAAAATCTATTGCTGTGTGG - Intronic
920616762 1:207500656-207500678 AATTATAATATACTGCTATTTGG + Intronic
920633261 1:207673696-207673718 AATTATAATATACTGCTATTCGG + Intronic
920790964 1:209091685-209091707 ATGGGTACTATACTGCTGTTGGG - Intergenic
921116495 1:212096840-212096862 ATGTATATTCTGCAGTTGTTGGG + Intronic
921140931 1:212305482-212305504 ATATATATTCTCCTGTTGTTGGG + Intronic
921196652 1:212763956-212763978 ATGTATATTCTGCAGTTGTTGGG - Intronic
921532673 1:216304978-216305000 ATGTATATTCTGCAGTTGTTGGG + Intronic
921999902 1:221466482-221466504 ATGTATATTCTGCAGTTGTTGGG + Intergenic
922380153 1:225014758-225014780 ATGTGTATTCTGCAGCTGTTGGG + Intronic
922630815 1:227108562-227108584 ATGTATATTTTGCTGTTGTTGGG + Intronic
922732479 1:227958260-227958282 ATGTATGTTCTGCTGTTGTTGGG - Intergenic
922861621 1:228822861-228822883 ATGTATAATCTGAAGCAGTTGGG + Intergenic
923239870 1:232072931-232072953 ATGTATATTCTGCAGTTGTTGGG + Intergenic
923477749 1:234351840-234351862 ATGTTTATTCTTCTGTTGTTGGG - Intergenic
923691714 1:236200313-236200335 ATGTATATTCTGCAGTTGTTGGG + Intronic
923707751 1:236358836-236358858 ATGTATATTCTATTGTTTTTGGG + Intronic
923960901 1:239082643-239082665 ATGTATATTCTGCAGTTGTTGGG + Intergenic
924331972 1:242948839-242948861 ATGTATATTCTGTTGCTTTTGGG - Intergenic
924575056 1:245272980-245273002 ATGTGTATTCTGCTGCTTTTGGG + Intronic
924829838 1:247581850-247581872 ATGCATATTCTACAGTTGTTGGG - Intergenic
924877953 1:248126498-248126520 ATGTATATTCTGCAGTTGTTGGG + Intergenic
924879916 1:248149773-248149795 ATGTATATTCTACAGTTGTTGGG + Intergenic
1063359318 10:5437784-5437806 ATGTATAATCTACTGTTGTTGGG - Intronic
1063420405 10:5907971-5907993 ATGTATATTTTGCTGTTGTTGGG + Intronic
1063869003 10:10398060-10398082 ATGTATCATCTCATGCTGTAAGG + Intergenic
1064777703 10:18797465-18797487 ATGTATATTCTGTTGTTGTTGGG - Intergenic
1065075014 10:22069377-22069399 GTGTGTATTCTGCTGCTGTTGGG + Intergenic
1065085330 10:22169070-22169092 ATGCATATTCTCCTGTTGTTGGG - Intergenic
1065478009 10:26161884-26161906 ATGTATAATGTGCTGTTGCTGGG - Intronic
1065980662 10:30892781-30892803 ATGTATAATCTGCTTCAGTATGG - Intronic
1066007701 10:31162197-31162219 ATGTGTATTCTTCTGCTGTTGGG + Intergenic
1066141047 10:32504866-32504888 ACGTATGTTCTGCTGCTGTTGGG + Intronic
1066153141 10:32646483-32646505 ATGTATATTCTCTAGCTGTTGGG + Intronic
1066510143 10:36086578-36086600 ATGTATAATGAACTTTTGTTAGG + Intergenic
1066578446 10:36852413-36852435 ATGTATAATCTACCTATGTTGGG + Intergenic
1067200215 10:44163266-44163288 ATGTATATTCTGCTGTTCTTGGG + Intergenic
1067206397 10:44218026-44218048 ATGTATATTCTGCAGCAGTTGGG - Intergenic
1067537993 10:47129951-47129973 AAGTATATTCTGCTGCTATTGGG - Intergenic
1067570300 10:47366703-47366725 ATTTATTATCTACTGCGTTTCGG - Exonic
1067827668 10:49590535-49590557 ATGTGTATTCTTCTGTTGTTGGG + Intergenic
1068055503 10:52007802-52007824 ATGTATATTCTGTTGCTTTTAGG - Intronic
1068184009 10:53562367-53562389 GTGTATATTCTGCTGTTGTTGGG - Intergenic
1068262757 10:54604239-54604261 ATGTACAATCTTCTGTTGTTGGG + Intronic
1068428436 10:56898868-56898890 ATGTGTATTTTTCTGCTGTTGGG + Intergenic
1069113150 10:64471135-64471157 ATGTATATTCTGCAGTTGTTAGG - Intergenic
1069155077 10:65018952-65018974 ATGTATATTCTGTTGCTGTTGGG - Intergenic
1069285262 10:66706517-66706539 TTTTTTAATCCACTGCTGTTTGG - Intronic
1069645723 10:69995092-69995114 AGGGATAAGTTACTGCTGTTTGG - Intergenic
1069648390 10:70022214-70022236 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1070060509 10:72978586-72978608 ATGTATATTCTGCCGCTGTTTGG + Intergenic
1070080517 10:73181707-73181729 ATGTGTATTCTGCAGCTGTTAGG + Intronic
1070499526 10:77058438-77058460 ATGTATATTCTGCTATTGTTGGG - Intronic
1071004807 10:80870856-80870878 ATGTGTATTCTACAGGTGTTGGG - Intergenic
1071045770 10:81374550-81374572 ATGTATATTCTTCAGTTGTTGGG + Intergenic
1071410753 10:85391954-85391976 ATGAATATTTTACTGCTGTGGGG - Intergenic
1071454561 10:85835713-85835735 ATGTATATTCTGCTGATATTGGG - Intronic
1071812105 10:89194044-89194066 ATGTATATTCTTCAGTTGTTGGG + Intergenic
1071881936 10:89908864-89908886 ATGTATAATCTATTGTTTTTGGG + Intergenic
1071956460 10:90765982-90766004 ATGTATATTCTGCTGCTGCCAGG + Intronic
1071989474 10:91087386-91087408 ATGTATATTCTGCAGCTGTTAGG + Intergenic
1072071016 10:91917499-91917521 ATGTGTATTCTGCTGCTGTTGGG + Intergenic
1072148136 10:92661501-92661523 ATGTATCTTATACTGTTGTTTGG + Intergenic
1072769044 10:98121762-98121784 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1073782458 10:106853915-106853937 ATGTGTAATCTGTTGGTGTTAGG + Intronic
1073820451 10:107256806-107256828 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1073924104 10:108494655-108494677 ATATTTATTCTACTGCTATTGGG - Intergenic
1074022550 10:109598529-109598551 ATGTATATTCTTCTGTTTTTAGG - Intergenic
1074174915 10:110989154-110989176 ATGTGTATTCTACTTTTGTTGGG + Intronic
1074181006 10:111063069-111063091 ATGTGTATTCTGCAGCTGTTGGG - Intergenic
1074244350 10:111672893-111672915 ATGTATATTCTGCTGTCGTTGGG - Intergenic
1075974430 10:126683503-126683525 CTGTATTATCTGCTGCTGTTAGG - Intergenic
1075975849 10:126694038-126694060 ATGTGTATTCTGATGCTGTTAGG + Intergenic
1076376138 10:129986978-129987000 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1077619399 11:3706670-3706692 ATTTAGAATCTATTTCTGTTTGG - Intronic
1077830531 11:5864627-5864649 ATGTATATTCTGCGGTTGTTGGG + Intronic
1077834019 11:5908056-5908078 ATGTATATTCTGCAGTTGTTGGG + Intronic
1077964168 11:7109770-7109792 ATGTATATTCTGCAGTTGTTAGG + Intergenic
1077990329 11:7403777-7403799 ATGTATATTCTATTACTGTTTGG + Intronic
1078503723 11:11911783-11911805 ATGTGTATTCTGCTGCTGTTGGG - Intronic
1078687060 11:13543179-13543201 ATGTATAGTCTGCAGTTGTTGGG + Intergenic
1079119080 11:17666542-17666564 ATGAATATTCTGCTGTTGTTGGG - Intergenic
1079178339 11:18164701-18164723 ATGTATATTCTGCAGTTGTTGGG - Intronic
1079255734 11:18827867-18827889 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1079523775 11:21360452-21360474 ATGTATATTATACAGTTGTTGGG + Intronic
1079970972 11:27034484-27034506 ATGTATATTCTGTTGCTTTTGGG - Intergenic
1080203128 11:29697240-29697262 ATGTATATTCTCCAGTTGTTGGG + Intergenic
1080377685 11:31733087-31733109 ATGTATATTCTGCAGCTGTTGGG - Intronic
1080585651 11:33680310-33680332 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1080714445 11:34785199-34785221 ATGTGTACTTTACTGCTGTTGGG - Intergenic
1080956409 11:37101429-37101451 ATGAGTAGTCTGCTGCTGTTGGG + Intergenic
1081326468 11:41751681-41751703 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1082044922 11:47717651-47717673 ATGAAGAATATACTGATGTTTGG - Intronic
1082111632 11:48282976-48282998 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1082132324 11:48506062-48506084 ATGTATATTCTGCAGCTTTTGGG + Intergenic
1082244489 11:49905378-49905400 ATGTATATTCTGCGGCTTTTGGG - Intergenic
1082253171 11:50004422-50004444 ATGTATATTCTGCAGTTGTTTGG - Intergenic
1082565789 11:54676682-54676704 ATGTATATTCTGCAGCTTTTGGG + Intergenic
1082907720 11:58329437-58329459 ATGTATATTCTGTTGCTTTTGGG + Intergenic
1083526998 11:63377225-63377247 ACGTATATTCTGCTGTTGTTGGG - Intronic
1084136736 11:67189091-67189113 ATGTGTATGCTATTGCTGTTAGG - Intronic
1085140582 11:74137290-74137312 ATATATAAACTCCTGCTGTATGG - Intronic
1085195342 11:74668230-74668252 ATGTATGTTTTACTGCTTTTGGG - Intronic
1085676972 11:78531254-78531276 ACGTATATTCTGCTGCTGTTGGG - Intronic
1085860843 11:80233411-80233433 ATGTATATTCTATTGTTTTTAGG - Intergenic
1086026274 11:82295939-82295961 ACGTGTATTCTGCTGCTGTTGGG + Intergenic
1086293177 11:85334888-85334910 ATGTATATTCTGTTGTTGTTGGG + Intronic
1086349136 11:85927278-85927300 ATGTATATTCTGCTGATTTTGGG - Intergenic
1086563445 11:88196152-88196174 ATATATATTCTATTGCTTTTGGG + Intergenic
1086563830 11:88201159-88201181 ATGTATACTCTGCTGATGTTTGG + Intergenic
1086731435 11:90255317-90255339 ATTTGTATTCTGCTGCTGTTGGG + Intergenic
1086734486 11:90288972-90288994 ATGTATAATGAGCTCCTGTTGGG - Intergenic
1086813467 11:91339116-91339138 ATGTATATTCTGCTGTTCTTAGG - Intergenic
1086844631 11:91733325-91733347 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1086864421 11:91962315-91962337 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1086982281 11:93211439-93211461 ATGTGTATTCTGCTGCTGTTGGG - Intergenic
1087469094 11:98548213-98548235 ATGTGTATTCTGCAGCTGTTGGG - Intergenic
1087817142 11:102672007-102672029 ATGTATATTCTGTTGTTGTTGGG + Intergenic
1087907975 11:103721623-103721645 ATGTATATTCAGCTGTTGTTGGG - Intergenic
1088066724 11:105728530-105728552 ATGTATATTCTATTGCTTTGGGG - Intronic
1088240333 11:107767661-107767683 ATGTATATTCTGTGGCTGTTGGG - Intergenic
1088342617 11:108786315-108786337 ATGTATATTCTATGGTTGTTAGG + Intronic
1088413295 11:109560585-109560607 ATGTATATTGTACAGTTGTTGGG + Intergenic
1088413576 11:109564818-109564840 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1088444129 11:109904645-109904667 ATGTCTATTCTGCTGCTATTGGG - Intergenic
1088552672 11:111029414-111029436 ATGTATATTCTGCAGCTCTTGGG - Intergenic
1089569956 11:119399634-119399656 ATGTATATTCTGCAGCTGTTCGG - Intergenic
1089816347 11:121179496-121179518 ATGTGTATTCTGCAGCTGTTGGG + Intronic
1090114983 11:123960022-123960044 ATGTATATTCTGTTACTGTTTGG + Intergenic
1090322121 11:125855909-125855931 ATGTGTATTCTGCTGCTATTAGG - Intergenic
1090682898 11:129080279-129080301 ATGTATATTCTGCAGTTGTTGGG - Intronic
1090742337 11:129676060-129676082 ATGTATATTCTGCTGTTGATGGG - Intergenic
1090895397 11:130968722-130968744 ATGTTTATTCTGCTGTTGTTTGG + Intergenic
1091882023 12:3987237-3987259 ATGTGTATTCTGCTGTTGTTGGG - Intergenic
1092116065 12:6007255-6007277 ATGTATAATTTGCTGTTGTTGGG - Intronic
1092661779 12:10746732-10746754 ATGTATATTCTATTGATGTGTGG + Intergenic
1093012215 12:14119719-14119741 ATGTACATTCTGCTGCTGTTGGG - Intergenic
1093105169 12:15077553-15077575 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1093251965 12:16817124-16817146 ATGTATATTCCGCTGTTGTTGGG - Intergenic
1093546209 12:20352155-20352177 GTGTATATTCTACTGCTTTTTGG - Intergenic
1093940195 12:25044935-25044957 ATGTATATTCTACTGCAGTTGGG - Intronic
1093963979 12:25305711-25305733 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1094233928 12:28140886-28140908 ATGGATGGTCTATTGCTGTTAGG - Intronic
1094296962 12:28917610-28917632 ATGTATATTCTATGGTTGTTGGG - Intergenic
1094297413 12:28923389-28923411 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1094749914 12:33394037-33394059 ATGTATAATCTACTTATATAGGG - Intronic
1094758862 12:33504373-33504395 ATGTATATTCTACTGCTGGTAGG + Intergenic
1095176545 12:39098446-39098468 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1095687647 12:45053153-45053175 ATGTATATTCTGCGGTTGTTGGG + Intergenic
1096035203 12:48461414-48461436 ATGTGTATTATACTGTTGTTGGG - Intergenic
1096957717 12:55543833-55543855 ATGTATATTCTGCTGCTTTGGGG + Intergenic
1097547493 12:61023129-61023151 ATGTATATTCTATGGTTGTTGGG + Intergenic
1097658872 12:62405075-62405097 AAGTATTATTTACTGCTATTGGG + Exonic
1097668529 12:62509573-62509595 ATGTGTATTCTGCTGATGTTAGG - Intronic
1097694374 12:62762490-62762512 ATGCATAAGTTACTGCTGTCAGG - Intronic
1097906752 12:64928148-64928170 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1097933872 12:65223097-65223119 ATGTGTATTCTACTCCTGTTGGG + Intronic
1098145402 12:67492338-67492360 ATGTATATTCTGCTGCTTTGGGG - Intergenic
1098223899 12:68300840-68300862 ATGTATATTCTACAATTGTTGGG - Intronic
1098491763 12:71090082-71090104 ATGTGTATTCTGCAGCTGTTGGG + Intronic
1098546065 12:71712228-71712250 ATGTATATTCTACTGTTGTTAGG - Intergenic
1098913174 12:76231198-76231220 ATGTATATTCTGCTGCTGTTGGG + Intergenic
1098983154 12:76981628-76981650 ATGTATATACTGCTGCTGTTAGG + Intergenic
1099042204 12:77669873-77669895 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1099430697 12:82581464-82581486 ATGTGTATTCTTCTGCTATTGGG - Intergenic
1099768224 12:87018352-87018374 ATGTGTAATCTGCTGTTGGTTGG - Intergenic
1100127010 12:91439456-91439478 ACATATATTCTACAGCTGTTAGG + Intergenic
1100359603 12:93863893-93863915 ATTTCTAGTATACTGCTGTTTGG - Intronic
1100918759 12:99457953-99457975 ATGTATATTCTGCAGTTGTTGGG - Intronic
1100928352 12:99576412-99576434 ATGTATATTCTTGTGTTGTTGGG - Intronic
1101275479 12:103196399-103196421 ATGTATATTCTGTTGTTGTTGGG + Intergenic
1101290611 12:103364022-103364044 ATGTATATTCTGCAGTTGTTGGG - Intronic
1101562538 12:105871708-105871730 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1101745059 12:107533803-107533825 ATGTGTATTCTATGGCTGTTGGG - Intronic
1102090293 12:110181572-110181594 ATGTATATTCTGCAGTTGTTGGG + Intronic
1103574422 12:121866566-121866588 ATTTGGAATCTTCTGCTGTTGGG + Intergenic
1104704935 12:130936691-130936713 ATGTGTATTCTGCTGTTGTTGGG + Intergenic
1105337199 13:19484423-19484445 ATGTGTATTCTGCAGCTGTTAGG + Intronic
1105466685 13:20649194-20649216 ATGTACAATCTCCTGTTGTTGGG - Intronic
1105697762 13:22906770-22906792 AGGTATTTTCTTCTGCTGTTGGG - Intergenic
1106060190 13:26283225-26283247 ATGTATATTCTGCAGTTGTTGGG - Intronic
1106395532 13:29377277-29377299 ATGTGTATTCTGCTGTTGTTGGG - Intronic
1106460954 13:29967878-29967900 ATGTGTATTCTACTGGTATTAGG - Intergenic
1106894404 13:34282817-34282839 ATGTATATTTTTCAGCTGTTGGG + Intergenic
1107070928 13:36268149-36268171 ATGTATACTCTGCAGTTGTTGGG - Intronic
1107253094 13:38389816-38389838 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1107342943 13:39429096-39429118 ATGTGTATTCTGCTGTTGTTTGG + Intronic
1107389396 13:39947507-39947529 ATGTATATTCTATTGTTTTTAGG - Intergenic
1107422223 13:40258092-40258114 ATGTAAAATTTACTGCACTTTGG - Intergenic
1107745410 13:43501438-43501460 ATGTTTGCTCTACTGCTGCTGGG - Intronic
1107797860 13:44072768-44072790 ATGTATATTCTGCTGTTGTTGGG - Intergenic
1108132106 13:47312750-47312772 ATGTATATTCTGCAGGTGTTGGG - Intergenic
1108189253 13:47920329-47920351 ATGTATATTCTGCTGTTGTTGGG - Intergenic
1108298507 13:49050605-49050627 ATGTATATTCTGCAGTTGTTGGG + Intronic
1108654284 13:52513023-52513045 ATGTATATTCTACAGCTGTTAGG - Intergenic
1108884914 13:55167850-55167872 ATGTATATTCTGCTTTTGTTGGG - Intergenic
1108952208 13:56109151-56109173 ATATATATTCTGCTGCTGCTGGG + Intergenic
1109058106 13:57578805-57578827 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1109083217 13:57934448-57934470 ATGTTTAATCTGCTACTTTTGGG + Intergenic
1109204895 13:59471145-59471167 ATGTGTATTCTGCTGCTGTTGGG - Intergenic
1109596872 13:64567990-64568012 ATGTATAGTCTTCAGTTGTTGGG + Intergenic
1109617998 13:64862433-64862455 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1109631497 13:65054936-65054958 ATGTATATTCTATGGTTGTTGGG - Intergenic
1109824434 13:67699133-67699155 ACGTATATTCTGCTGCTGTTTGG - Intergenic
1109913393 13:68946697-68946719 ATGTGTATTCTACTGTTATTAGG - Intergenic
1109975857 13:69830625-69830647 ATGTATATTCTGCAGCTGTTGGG - Intronic
1110214128 13:73007406-73007428 ATGTATAATTAACTGATTTTTGG - Intronic
1110628789 13:77681819-77681841 ATGTATATTCTACAATTGTTGGG - Intergenic
1110664223 13:78097072-78097094 ATGTATATTCTATTGGTTTTGGG - Intergenic
1110793433 13:79610707-79610729 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1110821571 13:79923695-79923717 ATGTATATTCTGTTGCTTTTGGG + Intergenic
1111145041 13:84168269-84168291 ATGTATATTCTACTGTTTTGGGG + Intergenic
1111225809 13:85269156-85269178 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1111632809 13:90864736-90864758 ATGTATAAACTGCTTCTGTATGG + Intergenic
1111817726 13:93174902-93174924 ATGTATATTCTATTGTTTTTGGG - Intergenic
1111819770 13:93198128-93198150 ATGTATATTCTGCAGTTGTTAGG + Intergenic
1111842773 13:93471837-93471859 ATGTATATTCTGCTGTTGTTGGG + Intronic
1112048901 13:95625468-95625490 ATGTATATTCTGCTATTGTTGGG - Intronic
1112060331 13:95733096-95733118 ATGTATATTCTACTGTTTTAGGG + Intronic
1112068675 13:95823236-95823258 ATGTATATTCTGCAGTTGTTGGG + Intronic
1112270867 13:97968343-97968365 ATGTTTACTCTGCTGCTTTTGGG + Intronic
1113534813 13:111057290-111057312 ATGTATATTCTACAGTTGTTGGG + Intergenic
1114132239 14:19804662-19804684 ATGTATATTCTAATGTTCTTGGG + Intronic
1114134983 14:19837209-19837231 ATGTATATTCTGTTGCTTTTTGG - Intergenic
1114138901 14:19889230-19889252 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1114337163 14:21702153-21702175 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1114389679 14:22293662-22293684 CTGTATAATCTACTGAAATTAGG + Intergenic
1114511643 14:23266786-23266808 ATGTATATTCTACTCTTTTTGGG + Intronic
1115023703 14:28714831-28714853 ATGTGTATTCTATAGCTGTTGGG - Intergenic
1115091002 14:29575225-29575247 ATGGATAATCAACTTCTGTGTGG + Intergenic
1115103431 14:29731401-29731423 ATGTGTATTCTGCTGTTGTTGGG + Intronic
1115393003 14:32875101-32875123 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1115716285 14:36108000-36108022 ATGTCTATTCTGCTGCTCTTGGG - Intergenic
1115856608 14:37636299-37636321 ATGTGTATTCTCCTGTTGTTGGG - Intronic
1115937130 14:38564768-38564790 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1116009769 14:39337463-39337485 ACGTGTATTCTGCTGCTGTTGGG - Intronic
1116064091 14:39960585-39960607 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1116217777 14:42042434-42042456 ATGTATGCTCTTCTGCTATTGGG + Intergenic
1116324641 14:43516714-43516736 ATGTATATTCTGCAGTTGTTTGG - Intergenic
1116406296 14:44570339-44570361 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1117405506 14:55398720-55398742 ACGTGTATTCTACAGCTGTTGGG + Intronic
1117477379 14:56110159-56110181 ATGTGCATTCTGCTGCTGTTGGG - Intergenic
1117837547 14:59822966-59822988 ATGTATATTCTGTTGCTGTTGGG + Intronic
1118044936 14:61958714-61958736 ATGATTACTCTGCTGCTGTTGGG + Intergenic
1118080664 14:62355855-62355877 ATATGTATTCTGCTGCTGTTGGG + Intergenic
1118114817 14:62763069-62763091 TTGTATATTCTATTGTTGTTGGG - Intronic
1118165844 14:63335090-63335112 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1118499739 14:66348157-66348179 ATGTATATTCTGTTGCTGTTGGG - Intergenic
1118646296 14:67844316-67844338 ATGTATATTCTGCTGTTTTTGGG + Intronic
1119766328 14:77191418-77191440 ATGTATATTCTGCTGCTGTTTGG + Intronic
1119913919 14:78377947-78377969 ATATGTATTCTGCTGCTGTTGGG - Intronic
1120118701 14:80651882-80651904 ATGTATATTCTACTGATTTGGGG + Intronic
1120260944 14:82185053-82185075 ATGTGTATTCCTCTGCTGTTGGG + Intergenic
1120410300 14:84145684-84145706 ATGTATGATCTACTGCAGTAGGG + Intergenic
1120428662 14:84385364-84385386 ATGTATCTTCTGCTGCTGTTGGG - Intergenic
1120450711 14:84663692-84663714 ATGTATATTCCACGGTTGTTGGG + Intergenic
1120603577 14:86543306-86543328 ATGTATCATCTATTGCAGCTTGG - Intergenic
1120736132 14:88055210-88055232 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1120785501 14:88530965-88530987 ATGTATATTCTGCAGTTGTTGGG - Intronic
1121848217 14:97194200-97194222 AAGTATATTCTGCTGTTGTTGGG + Intergenic
1123183964 14:106496778-106496800 ATGTGCAATCTGCTGCTGTTTGG + Intergenic
1123475026 15:20583340-20583362 ATGTATATTCTGCTGTTTTTGGG - Intergenic
1123578042 15:21692798-21692820 ATGTATATTCTGTTGCTTTTTGG - Intergenic
1123614667 15:22135280-22135302 ATGTATATTCTGTTGCTTTTTGG - Intergenic
1123950131 15:25263487-25263509 ATGTGTCATCTGCTGTTGTTGGG - Intergenic
1124078081 15:26464775-26464797 ATGTATATTCTGTTGCTTTTGGG - Intergenic
1124127982 15:26955812-26955834 ATATGTATTCTGCTGCTGTTGGG - Intergenic
1124164353 15:27310958-27310980 ATCTATAATCTACTACAATTGGG - Intronic
1124164566 15:27313513-27313535 ATGTAGATTCTGCTGCCGTTGGG - Intronic
1124418901 15:29500271-29500293 ATGTGTATTCTGCTGCTGTTGGG - Intronic
1125055151 15:35350889-35350911 ATGTGTATTCTGCTGTTGTTGGG + Intronic
1125091176 15:35794622-35794644 ATGTGTATTCTGCTGTTGTTGGG + Intergenic
1125166670 15:36714310-36714332 ATGTATAATCTTATGTTGGTCGG + Intronic
1125330300 15:38575419-38575441 ATATTTAATCTACTGCTGAATGG - Intergenic
1125388207 15:39161639-39161661 ATGTATATTCTTCTGCTGTTGGG + Intergenic
1125418866 15:39482650-39482672 ATGTATTTTCTGCTGTTGTTGGG - Intergenic
1125455004 15:39848491-39848513 ATGTATATTCTCCTGTTGCTGGG - Intronic
1126184438 15:45817978-45818000 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1126282357 15:46969192-46969214 TTGTATATTCTATTGTTGTTGGG - Intergenic
1126445412 15:48738035-48738057 ATGTATAATCTGCTTTTGTGTGG - Exonic
1126496740 15:49299910-49299932 ATGTATATTCTGTTGTTGTTGGG + Intronic
1126611608 15:50535338-50535360 ATATATATTCTGCTGTTGTTGGG - Intronic
1126647451 15:50889202-50889224 ATGTGTACTCTGCTGCTGTTGGG - Intergenic
1126871451 15:52993000-52993022 ATGTATAGTCTACTGTTTTTTGG + Intergenic
1126924743 15:53571566-53571588 ATATATAATCAAATACTGTTCGG - Intronic
1126927136 15:53602016-53602038 ATGTATAATCTGTTGTTTTTGGG - Intronic
1126972925 15:54138250-54138272 ATATATATTCTGTTGCTGTTGGG + Intronic
1127014714 15:54671014-54671036 ATGTATATTCTTCAGTTGTTGGG - Intergenic
1127020467 15:54741380-54741402 ATGTATATTCTATTGCTCTTGGG - Intergenic
1127020548 15:54742750-54742772 ATGTATATTCTGCAGCTTTTGGG - Intergenic
1127097227 15:55524811-55524833 ATGTATATTCTGCTTTTGTTGGG + Intergenic
1127231306 15:56998717-56998739 ATGTATATTCTGCTGCTGTTGGG - Intronic
1127573738 15:60270130-60270152 ATGTATATTGTACAGTTGTTGGG + Intergenic
1127694448 15:61431215-61431237 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1127778741 15:62292347-62292369 ATGTATATTCTACTGATTTGGGG + Intergenic
1128139544 15:65288975-65288997 GTATATATTCTGCTGCTGTTAGG + Intronic
1128899382 15:71406320-71406342 ATGTGTATTCTGCTACTGTTGGG + Intronic
1129562572 15:76587746-76587768 ATGTATATTCTGTGGCTGTTGGG + Intronic
1129631924 15:77269668-77269690 ATGTATATTCTGCAGTTGTTGGG - Intronic
1130366024 15:83239634-83239656 ATGTATATTCTGTTGCTATTGGG - Intergenic
1130414360 15:83677237-83677259 ATGTGTATTCTGCTGTTGTTGGG + Intronic
1130580218 15:85130532-85130554 ATGTATACTCTACTGTTGTTGGG + Intronic
1131139648 15:89966771-89966793 ATGTATATTCTGCTGTTGTTGGG - Intergenic
1131321510 15:91397303-91397325 ATGTATATTCTATTGCTTTTGGG + Intergenic
1132245059 15:100288543-100288565 ATGTATACTCTGTTGCTTTTGGG - Intronic
1132253988 15:100358232-100358254 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1202986912 15_KI270727v1_random:427043-427065 ATGTATATTCTGTTGCTTTTTGG - Intergenic
1133754019 16:8748495-8748517 ATCTATATTCTGCTGTTGTTGGG + Intronic
1133952915 16:10412638-10412660 ATGTATATTCTGCAGTTGTTGGG + Intronic
1135834283 16:25810419-25810441 ATATATATTCTGCTGTTGTTGGG + Intronic
1136668233 16:31833153-31833175 ATGTGTATTCTTCTGCTGTTGGG - Intergenic
1136668976 16:31839226-31839248 ATATATATTCTTCTGCTGTTGGG - Intergenic
1137557528 16:49481399-49481421 ATGTGTATTCTGCTGTTGTTGGG - Intergenic
1138326913 16:56181103-56181125 ATGTATATTCCACTGCTGTCAGG + Intergenic
1138477479 16:57280372-57280394 AAGTATAAAGTAGTGCTGTTAGG - Intronic
1138753377 16:59451616-59451638 ATGTGTATTCTACTGCTGTTGGG + Intergenic
1138917312 16:61482035-61482057 AAGTGTATTCTGCTGCTGTTGGG - Intergenic
1138924454 16:61574162-61574184 ATGTATATTCTGTTGTTGTTGGG + Intergenic
1139716247 16:68815531-68815553 GTGTAGAATGTACTGCTGCTTGG - Exonic
1141210075 16:81970876-81970898 ATGTGTATTCTGCTACTGTTGGG + Intergenic
1142909701 17:3078545-3078567 ATGTGTTTTCTGCTGCTGTTGGG + Intergenic
1142924799 17:3225251-3225273 ATGTGTTTTCTGCTGCTGTTGGG - Intergenic
1142940106 17:3373258-3373280 ATGTATATTCTGCAGTTGTTAGG + Intergenic
1143035827 17:3997129-3997151 ATGTATATTCTGCTTTTGTTGGG + Intergenic
1143738255 17:8930117-8930139 ATGTGTATTCTGCTGTTGTTAGG - Intronic
1143815554 17:9510310-9510332 ATGTATATTCTGTAGCTGTTGGG - Intronic
1144380477 17:14691503-14691525 ATGTATATTCTGCTGTTGTTGGG + Intergenic
1144694607 17:17294066-17294088 ATGTCTATTCTGCTGCTGTATGG + Intergenic
1146410807 17:32582605-32582627 ATGTGTATTCTGATGCTGTTGGG + Intronic
1146612895 17:34323587-34323609 ATGTATACTCTGCAGTTGTTGGG + Intergenic
1146614300 17:34340752-34340774 ATGTCTATTCTATTGTTGTTGGG + Intergenic
1147049720 17:37784138-37784160 ATGTATATTCTGTTGCTTTTGGG + Intergenic
1149177879 17:53896290-53896312 GTATATAATCTACTGATGTTTGG - Intergenic
1149215958 17:54354586-54354608 ATGTATATTCTGATGTTGTTGGG + Intergenic
1149731299 17:58948972-58948994 ATGCATATTCTGCAGCTGTTGGG + Intronic
1150514513 17:65794171-65794193 ATGTATAGTCTTCTGTTGTAGGG + Intronic
1150528876 17:65956027-65956049 ATGTATATTCTGCAGTTGTTGGG - Intronic
1150896061 17:69212431-69212453 ATGTATATTCTGCAGTTGTTGGG + Intronic
1151410433 17:73923067-73923089 ATGTATATTCTTCTATTGTTGGG - Intergenic
1152501603 17:80714379-80714401 ATGTATATTCTACAGTTGTGTGG - Intronic
1152838070 17:82547873-82547895 ATGTAGAATATACTGGTGTTTGG + Intronic
1153071715 18:1113657-1113679 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1153176098 18:2375231-2375253 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1153451138 18:5230628-5230650 ATGTATAGTCTGCAGTTGTTGGG + Intergenic
1154003158 18:10503462-10503484 GTGTATATTCTGCTGTTGTTGGG + Intergenic
1154295926 18:13147924-13147946 ATGTGTATTCTGCTGTTGTTGGG + Intergenic
1154298100 18:13168194-13168216 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1155089871 18:22496437-22496459 ATGTGTATTCTTCTGCTGTTTGG - Intergenic
1155286824 18:24297852-24297874 ATGTATATTCTGCAGTTGTTGGG + Intronic
1155305022 18:24470404-24470426 ATATATCATCTATGGCTGTTTGG - Intronic
1155820912 18:30375088-30375110 ATGTCTAGTCTGCTGTTGTTAGG + Intergenic
1155886977 18:31219979-31220001 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1156081048 18:33336695-33336717 ATATATACTCTGCTGTTGTTGGG - Intronic
1156140827 18:34108872-34108894 ATGTGTATTCTGCTGCTGTTGGG - Intronic
1156289984 18:35739134-35739156 GTGTGTAATCTACTGTTGTTGGG + Intergenic
1156342745 18:36226009-36226031 ATGTGTATTCTTCTGCTGTTGGG + Intronic
1156344546 18:36244585-36244607 ATGTATACTCTGCAGTTGTTGGG + Intronic
1156418017 18:36919020-36919042 ATGTATATTTTACAGCTGTTGGG + Intronic
1156531163 18:37816825-37816847 ATGTTTAATCTATTATTGTTGGG - Intergenic
1156642738 18:39121898-39121920 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1156893141 18:42213226-42213248 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1157022491 18:43802864-43802886 ATCTATATTCTGCAGCTGTTGGG + Intergenic
1157205397 18:45693992-45694014 ATGTATATTCTGCTGTTTTTGGG - Intergenic
1157366370 18:47068226-47068248 TTCTGTAATCTCCTGCTGTTAGG + Intronic
1157524455 18:48369922-48369944 ATGCATATTCTGCTGTTGTTGGG - Intronic
1157703018 18:49776698-49776720 ATGTATATTCTGCAGTTGTTTGG + Intergenic
1158368184 18:56764714-56764736 ATGTGTATTCTGCTGTTGTTGGG + Intronic
1158735855 18:60078050-60078072 ATGTGTATTCTGCAGCTGTTGGG - Intergenic
1159360386 18:67394163-67394185 ATGTGTATTCTGTTGCTGTTGGG - Intergenic
1159453825 18:68636373-68636395 ATGTATATTCTACAGTTGTTGGG + Intergenic
1160214984 18:76920779-76920801 ATGTATCAGCCACTGCTGTTTGG - Intronic
1162612153 19:11765196-11765218 ATGTATAATCTGTTGGTTTTGGG + Intergenic
1162615397 19:11796874-11796896 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1163888086 19:19986693-19986715 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1164116234 19:22221829-22221851 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1165590054 19:36960983-36961005 ATGTATAGTCTGCATCTGTTGGG + Intronic
1165647148 19:37451078-37451100 ATATGTATTCTACAGCTGTTGGG + Intronic
1165983219 19:39744072-39744094 ATGTATATTCTGCAGCTGTTGGG + Intergenic
1166027214 19:40098091-40098113 ATGTGTATTCTGCTGCTGTTAGG - Intergenic
1168011093 19:53533451-53533473 ATATGTATTCTGCTGCTGTTGGG + Intronic
1168555512 19:57335859-57335881 ATGTATATTCTGGTGTTGTTTGG + Intergenic
1168697746 19:58414704-58414726 ATGTATATCCTGCTGTTGTTAGG + Intronic
924968905 2:105711-105733 ATGTATATTCTGCAGTTGTTAGG + Intergenic
924992633 2:326489-326511 ATGTATATTCTGCAGTTGTTGGG + Intergenic
925208230 2:2025428-2025450 AAGTATCATTTGCTGCTGTTTGG - Intronic
925486841 2:4344416-4344438 ATGTACATTCTACTGTTGCTTGG + Intergenic
926235302 2:11038077-11038099 ATGTATATTCTGCTGTTCTTGGG + Intergenic
926638450 2:15208581-15208603 AAGTATATTCTCCAGCTGTTGGG - Intronic
926865080 2:17347269-17347291 AGGTATAAAGTACTGCTTTTAGG - Intergenic
926866772 2:17368454-17368476 ATGTATATTCTGCAGTTGTTAGG + Intergenic
927069730 2:19514921-19514943 ATGTATATTCTTCAGTTGTTTGG + Intergenic
927176509 2:20412764-20412786 ATGTATATTCTGCAGTTGTTGGG + Intergenic
928271663 2:29860559-29860581 ATGTGTATTCTGCTGCTGTTAGG - Intronic
928356924 2:30624795-30624817 ATGTATATTCTGCAGTTGTTGGG - Intronic
928479912 2:31672610-31672632 ATGTATATTCTTCAGTTGTTGGG + Intergenic
928782858 2:34846300-34846322 ATGTATATTCTGCAGTTGTTGGG + Intergenic
928798645 2:35058087-35058109 ATGTATATTCTGCAGTTGTTGGG + Intergenic
928852338 2:35764617-35764639 ATGTATATTTTTCTGTTGTTGGG - Intergenic
928861800 2:35866968-35866990 ATGTATATTCTGCTGTTCTTTGG - Intergenic
929192264 2:39150443-39150465 ATGTTTAATCTTCTTCTGTCAGG + Intergenic
929372153 2:41238737-41238759 ATGTGTAATCTGTTGCTGGTTGG + Intergenic
929398925 2:41557074-41557096 ATGTATATTCTGCAGTTGTTGGG - Intergenic
929963373 2:46513380-46513402 ATGTGCATTCTGCTGCTGTTGGG + Intronic
929963625 2:46516207-46516229 ATGTGTATTGTGCTGCTGTTGGG - Intronic
930148876 2:48037294-48037316 ATGTGTATTCTGCTGTTGTTGGG + Intergenic
930433420 2:51310713-51310735 ATGTATAGTCTGTTGTTGTTTGG - Intergenic
930906732 2:56577726-56577748 ATGTATATTCTTCAGTTGTTAGG - Intergenic
931344861 2:61436716-61436738 ATGTGTATTCTGCTGCTATTAGG - Intronic
931536035 2:63277928-63277950 ATGTATATTCTGCAGTTGTTGGG - Intronic
932379902 2:71272613-71272635 ATGTATATTCTATTGTTTTTGGG - Intergenic
932515349 2:72341771-72341793 ATATATATTCTACTACTGTTGGG - Intronic
932637617 2:73405984-73406006 ATGTATATTGTGCTGTTGTTGGG + Intronic
932639922 2:73434546-73434568 ATGTGTATTCTGCTGTTGTTAGG + Intronic
932652793 2:73577846-73577868 ATGTGTATTCTGTTGCTGTTTGG + Intronic
932883875 2:75529425-75529447 ATGTATATTCTGTTGTTGTTGGG - Intronic
932925686 2:75971117-75971139 ATGTATATTCTGCAGTTGTTGGG - Intergenic
933056102 2:77667468-77667490 ATGTGTATTCTGCTGTTGTTGGG - Intergenic
933090768 2:78113155-78113177 ATGTATAATTTTCTCATGTTTGG + Intergenic
933564180 2:83929835-83929857 ATGTGTATTTTTCTGCTGTTGGG - Intergenic
933571299 2:84016319-84016341 ATGCGTATTCTACTGTTGTTGGG - Intergenic
933863617 2:86495777-86495799 ATGTATATTTTGCTGTTGTTGGG + Intergenic
933927600 2:87111451-87111473 ATGTGTATTCTGCTGTTGTTGGG - Intergenic
934012416 2:87837250-87837272 ATGTATATTCTGTTGTTGTTGGG - Intergenic
934911778 2:98264673-98264695 ATGTGTATTCTGCTGTTGTTTGG + Intronic
934959083 2:98652237-98652259 ATGTGTATTCTGCTGTTGTTGGG - Intronic
935067875 2:99667066-99667088 ATGTGTATTCTGCTGTTGTTGGG - Intronic
935075237 2:99736100-99736122 ATGCATATTCTGCAGCTGTTGGG + Intronic
935181861 2:100698612-100698634 ATGTACATTCTGCTGTTGTTGGG - Intergenic
935481651 2:103596704-103596726 ATGTATATTCTGTTGGTGTTGGG - Intergenic
935863182 2:107356646-107356668 ATGTATAAAATTCTGCTGGTAGG + Intergenic
936000400 2:108822479-108822501 ATGTATCATCTGCTGTTGTTGGG - Intronic
936135143 2:109885773-109885795 ATGTATATTCTGCAGTTGTTTGG + Intergenic
936209554 2:110485712-110485734 ATGTATATTCTGCAGTTGTTTGG - Intergenic
936340600 2:111628890-111628912 ATGTATATTCTGCTGTTGTTGGG - Intergenic
936428742 2:112440964-112440986 ATGTATATTCTGCAGTTGTTTGG - Intergenic
936439392 2:112537896-112537918 ATGTGTATTTTGCTGCTGTTGGG - Exonic
936796434 2:116210936-116210958 ATGTATATTCTGCTGTTCTTCGG + Intergenic
936803221 2:116291928-116291950 ATGTATATTCTGATACTGTTGGG + Intergenic
936815307 2:116453542-116453564 ATGTATACTCTGCAGCTCTTGGG + Intergenic
936879192 2:117229583-117229605 ATGTATATTCTGCAGTTGTTGGG + Intergenic
936899090 2:117463911-117463933 ATGTATATTCTGCAGCTGTTGGG + Intergenic
936969131 2:118159462-118159484 ATGTGTATTCTGCTGCTGCTGGG - Intergenic
936990606 2:118360987-118361009 ATGTATATTCTGCTGTTGTTGGG + Intergenic
937129691 2:119499395-119499417 ATGTGTATTCTGCTGTTGTTGGG - Intronic
937154940 2:119712272-119712294 AAATATACTCTGCTGCTGTTGGG - Intergenic
937372050 2:121305423-121305445 ATGTGCATTCTACTGTTGTTGGG - Intergenic
937716111 2:125035273-125035295 ATGTATATTCCACAGTTGTTGGG + Intergenic
937772617 2:125738671-125738693 ATGTATATTCTGCAGCAGTTGGG - Intergenic
938216327 2:129520294-129520316 ATGTATAGTCTGCAGTTGTTGGG + Intergenic
938674765 2:133620798-133620820 ATGTATATTCTGCAGTTGTTAGG - Intergenic
939149719 2:138458692-138458714 ATGTATATTCTGCAGTTGTTGGG - Intergenic
939206462 2:139110962-139110984 ATGTATGTTCTGCTGTTGTTGGG + Intergenic
939217245 2:139254330-139254352 ATGTGTATTCTGATGCTGTTCGG - Intergenic
939219552 2:139283949-139283971 ATGTATATTCTGCAGTTGTTGGG - Intergenic
939305494 2:140404903-140404925 ATGTATATTCTCCAGTTGTTGGG - Intronic
939379765 2:141419973-141419995 GTGTGTATTCTGCTGCTGTTGGG + Intronic
939834863 2:147117400-147117422 ATGTATATTCTGCTGCTATTGGG + Intergenic
940437564 2:153672228-153672250 ATGTATATTCTACTGATTTGGGG - Intergenic
940664499 2:156591370-156591392 ATGAATAATTTGCTGCTATTAGG + Intronic
940668865 2:156642813-156642835 ATGCTTATTCTACAGCTGTTGGG - Intergenic
940796593 2:158086954-158086976 ATGTATATTCTGCAGTTGTTGGG + Intronic
941138795 2:161750691-161750713 ATGTGTATTCTTCTGCTGTTGGG + Intronic
941196303 2:162456471-162456493 ATGTATATTCTACTGATTTGGGG + Intronic
941358201 2:164518046-164518068 ATGTATATTCTGCAGTTGTTGGG - Intronic
941484635 2:166064900-166064922 ATGTAGAATATACTACTGGTTGG + Intronic
941678868 2:168374151-168374173 ATGTGTATTCTGCAGCTGTTGGG - Intergenic
942207496 2:173634876-173634898 GTGCATATTCTGCTGCTGTTGGG - Intergenic
942258509 2:174132799-174132821 ATGTACATTCTACTGTTGTTGGG + Intronic
942336328 2:174890759-174890781 ATGTGCATTCTTCTGCTGTTTGG - Intronic
942395564 2:175544440-175544462 ATGTGTAGTCTACCGTTGTTGGG + Intergenic
942585868 2:177476629-177476651 ATGTACATTCTTCTGTTGTTGGG + Intronic
942831841 2:180245945-180245967 ATATGTAAACTACTGCAGTTTGG + Intergenic
942851352 2:180491576-180491598 ATGTATATTCTATAGTTGTTGGG + Intergenic
943087960 2:183336622-183336644 ATGTGTCTTCTGCTGCTGTTTGG + Intergenic
943149714 2:184096883-184096905 ATGTATATTCTGCAGTTGTTGGG + Intergenic
943253478 2:185562405-185562427 ATGTGTAATCTTCAGCTGTTAGG - Intergenic
943357840 2:186880019-186880041 ATGTGTATTCTGGTGCTGTTGGG + Intergenic
943512154 2:188839635-188839657 ATGTGCATTCTGCTGCTGTTGGG - Intergenic
943518300 2:188914125-188914147 ATGTATATTCTGCAGCTGTTGGG - Intergenic
943943725 2:194031505-194031527 ATGTATATTCTGCAGTTGTTGGG - Intergenic
943970332 2:194396695-194396717 ATGTATAGTCAGCTGATGTTGGG - Intergenic
944027563 2:195189916-195189938 ATGTATATTCTTCAGTTGTTTGG - Intergenic
944072967 2:195694262-195694284 ATGTATATTCTGCAGTTGTTGGG + Intronic
944183163 2:196918245-196918267 AGGTAAAATATACTGCTTTTAGG + Intronic
944330466 2:198459635-198459657 ATGTGTATTCTGCTGCTGTTAGG + Intronic
944363971 2:198894342-198894364 ATGTATATTCTGTTGCTTTTAGG - Intergenic
944593584 2:201240707-201240729 ATGTGTGTTCTACTGCTGTAGGG - Intronic
944621483 2:201520346-201520368 ATGTATTTTCTGCAGCTGTTAGG - Intronic
944693797 2:202182778-202182800 AACTCTCATCTACTGCTGTTTGG - Intronic
945337855 2:208614488-208614510 ATGTATATTCTACAGTTGTTGGG + Intronic
945362609 2:208909535-208909557 ATGTATATTCCACAGTTGTTGGG - Intergenic
945536342 2:211022842-211022864 ATGTATATTCTGCAGTTGTTGGG + Intergenic
945739050 2:213638706-213638728 ATGTATATTCTACAGTTGCTAGG + Intronic
945766625 2:213988279-213988301 AAGTATATTCTACTGTTGTTGGG - Intronic
945861838 2:215132200-215132222 ATGTATATTCTGCAGTTGTTGGG + Intronic
946379768 2:219338776-219338798 ATGTGTACTCTGCTGTTGTTGGG - Intergenic
946824218 2:223659898-223659920 ATGTATATTCTGCAGTTGTTAGG - Intergenic
946920076 2:224570545-224570567 ATGTAAAAACTACTGATGTTTGG + Intronic
947376118 2:229496980-229497002 ATGTATATGCTGCTGCTGTTGGG - Intronic
947798770 2:232913432-232913454 ATGTGTAATCTGCTACTGTTGGG + Intronic
948235882 2:236389949-236389971 ATGTGTATTCTGGTGCTGTTGGG + Intronic
948451464 2:238076924-238076946 ATGTATATTCTGCTGTTGTTGGG + Intronic
948719199 2:239886993-239887015 ATGTATGGTTTACTGTTGTTGGG - Intergenic
1169397694 20:5248788-5248810 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1169835871 20:9878161-9878183 ATGTATAGTCTACTGTTGTTAGG - Intergenic
1170054427 20:12184442-12184464 ATATTTATTCCACTGCTGTTGGG + Intergenic
1170086458 20:12537896-12537918 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1170241497 20:14171798-14171820 ATGTATATTCTGCAGTTGTTGGG + Intronic
1170380577 20:15755443-15755465 ATGTAAAATCTACTCATTTTTGG - Intronic
1170660995 20:18339763-18339785 ATGTGTAATCTGCTGTTGTTGGG - Intergenic
1170741269 20:19059108-19059130 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1170766793 20:19296772-19296794 ATGTATAATCTGTTGTTTTTAGG - Intronic
1170865593 20:20152899-20152921 ATGTATATTCTGCAGTTGTTGGG - Intronic
1171066733 20:22024442-22024464 ATGTATATTCTACAGTTGTTGGG + Intergenic
1171137163 20:22706250-22706272 ATGTGTATTCTCCAGCTGTTGGG + Intergenic
1171198324 20:23220579-23220601 ATGTATATTCTACAGTTGTTGGG + Intergenic
1172086958 20:32392932-32392954 ATGTGTATTCTACTGTTGTTAGG + Intronic
1172586678 20:36090308-36090330 AAGTATAAACTCCTGCTCTTAGG - Intergenic
1172734107 20:37112954-37112976 ATGTAGAAACCACTGGTGTTGGG + Intronic
1173568574 20:44060430-44060452 ATGTATATTCTGCAGTTGTTGGG - Intronic
1174227930 20:49019505-49019527 ACTTATAATCTTTTGCTGTTAGG + Intronic
1174897352 20:54464322-54464344 ATGTATATTCTACTGTAATTGGG - Intergenic
1175590501 20:60186638-60186660 ATGCAAATTCTACAGCTGTTGGG + Intergenic
1176043233 20:63078183-63078205 ATGTGTAAGCTGTTGCTGTTGGG + Intergenic
1176736366 21:10550780-10550802 ATGTGTATTCTGCAGCTGTTAGG - Intronic
1177364326 21:20114866-20114888 ATGTATACTCTGCAGTTGTTGGG + Intergenic
1177662290 21:24100850-24100872 ATGTATATTCTGCTGTTTTTGGG + Intergenic
1177679525 21:24347808-24347830 ATGTATATTCTGTTGCTGTTGGG + Intergenic
1177715682 21:24837373-24837395 TTATCTAATCTACTGCTGATGGG + Intergenic
1177732764 21:25049562-25049584 ATGTATATTCTGTTGCTGTTGGG - Intergenic
1177749886 21:25267742-25267764 ATGTATATTCTGCAGTTGTTTGG - Intergenic
1178324781 21:31635578-31635600 ATGTGGATTCTGCTGCTGTTGGG + Intergenic
1178733088 21:35122984-35123006 ATGTATATTCTGCAGTTGTTGGG - Intronic
1178999301 21:37440862-37440884 ATGTATATTCTGCTGTTCTTTGG + Intronic
1179087613 21:38232913-38232935 ATGTATATTCTACTGTTTGTGGG + Intronic
1179260446 21:39753438-39753460 ATTTATACTCTACAGTTGTTGGG + Intronic
1180567474 22:16685779-16685801 ATGTATAATTTGCTGTTGTTGGG - Intergenic
1180896598 22:19338980-19339002 ATGTATATTCTGCAGTTGTTGGG - Intronic
1180916240 22:19489744-19489766 ATGCATAGTCTGCTGTTGTTGGG + Intronic
1182400166 22:30069546-30069568 ATGTATAGTCTGCTGGTTTTGGG - Intergenic
1182767470 22:32768533-32768555 ATGTATAATCAACTGCTTCCTGG + Intronic
1182925351 22:34117608-34117630 ATGCTTATTCTACTGTTGTTGGG + Intergenic
1182936889 22:34231652-34231674 ATGTATATTCTGCAGCAGTTGGG - Intergenic
1183532775 22:38371912-38371934 ATGTGTATTCTGCAGCTGTTAGG + Intronic
1183657554 22:39197057-39197079 ATGTATATTCTGCTACTGTTGGG - Intergenic
1183847820 22:40557434-40557456 AAGTAAAATCTTCTGCTATTTGG + Intronic
1184056632 22:42055562-42055584 ATGTATATTCTGCTGCTATTGGG + Intronic
1184121898 22:42456658-42456680 ATGTGTATTCTGCTGTTGTTGGG - Intergenic
1184217714 22:43078730-43078752 CTGTATAAAGGACTGCTGTTAGG + Intronic
1184307977 22:43620903-43620925 ATGTGTATTCTGGTGCTGTTGGG - Intronic
1184446326 22:44549286-44549308 ATCTCTAATTTACTGCTGTGGGG - Intergenic
1184905285 22:47480088-47480110 ATGTGTATTTCACTGCTGTTGGG + Intronic
949145820 3:698830-698852 ATGTATATTCTGCAGTTGTTTGG + Intergenic
949216229 3:1571313-1571335 ATGTATATTCTACTGTTTGTTGG + Intergenic
949218898 3:1605948-1605970 TTGTATAATGTACCTCTGTTGGG - Intergenic
949569754 3:5281694-5281716 ATGTGTATTCTGCTCCTGTTGGG + Intergenic
949898415 3:8789598-8789620 ATGTGTATTCTTCTGCTGGTGGG + Intronic
950561362 3:13729486-13729508 ATGTATAGTCTGCTGTTGTTGGG + Intergenic
950944730 3:16933444-16933466 CTGTATAATCTTTTACTGTTTGG - Intronic
951260443 3:20501669-20501691 ATGTATATTCTGCAGTTGTTGGG + Intergenic
951267082 3:20580444-20580466 ATGTGTATTCTGCTGCTGTTTGG - Intergenic
951294711 3:20919839-20919861 ATGTATATTCTGCAGTTGTTGGG - Intergenic
951302472 3:21015359-21015381 ATGTATATTCTGCAGTTGTTGGG + Intergenic
951404845 3:22283359-22283381 ATGTATATTCTGCAGTTGTTGGG - Intronic
951655013 3:24996919-24996941 ATGTATATTCTGTAGCTGTTGGG + Intergenic
951746764 3:25986941-25986963 ATTTATATTCTACTTCTGGTTGG + Intergenic
951859112 3:27231040-27231062 ATGTATATTCTGCAGTTGTTGGG - Intronic
951924579 3:27894452-27894474 ATGTATATTTTGCTGTTGTTTGG - Intergenic
952083095 3:29784224-29784246 ATGTATATTCTGCAGTTGTTCGG - Intronic
952195439 3:31070803-31070825 GTGTATATTCTATTGTTGTTGGG + Intergenic
952435013 3:33264804-33264826 ATGTATATTCTGCAGTTGTTAGG + Intergenic
952679238 3:36072481-36072503 ATGTATATTCTATTGTTTTTAGG + Intergenic
952984623 3:38767702-38767724 ATGTATATTCTGCAGTTGTTTGG + Intronic
952993930 3:38858689-38858711 ATGTATATTCTGCAGTTGTTGGG - Intronic
953195953 3:40733355-40733377 ATGTATATTCTGCAGATGTTAGG + Intergenic
953382414 3:42482621-42482643 ATGTATATTCTGCAGTTGTTGGG - Intergenic
953560795 3:43990940-43990962 ATGTATATTCTGCTGTTGTTGGG - Intergenic
953639363 3:44691638-44691660 ATATATATTCTACAGTTGTTGGG - Intergenic
953764543 3:45727472-45727494 ATGTGTATTCTGCTGCTGTTGGG + Intronic
954479929 3:50789439-50789461 ATGTATATTCTGCAGTTGTTGGG + Intronic
954481032 3:50801661-50801683 ATGTGTATTCTATAGCTGTTGGG + Intronic
954547352 3:51448853-51448875 CTGTGTAATCTACTGTTGTTGGG - Intronic
954588496 3:51758760-51758782 ATGTATATTCTTCTGCTGTTGGG + Intergenic
955691708 3:61597415-61597437 ATGTGGAACCTGCTGCTGTTAGG + Intronic
955932327 3:64069738-64069760 ATGTGTAATCTGTAGCTGTTGGG + Intergenic
956898814 3:73692417-73692439 ATGTGTATTCTGCTGTTGTTGGG + Intergenic
957177947 3:76836843-76836865 ATATGTATTCTTCTGCTGTTGGG + Intronic
957304868 3:78444212-78444234 ATGTGTATTCTGCAGCTGTTGGG - Intergenic
957433150 3:80139836-80139858 ATGTATATTCTGCAGTTGTTGGG - Intergenic
957668278 3:83265799-83265821 ATGTATATTCTTCTGTTGTTGGG - Intergenic
957671592 3:83311932-83311954 ATGTGTATTCTGCTGTTGTTGGG + Intergenic
957721370 3:84004523-84004545 ATGTATATTCTGCAGTTGTTGGG + Intergenic
957831333 3:85524592-85524614 ATGTATAATCTACTGCTGTTGGG + Intronic
957889844 3:86342705-86342727 ATGTGTACTCTGCTGCTGTTGGG + Intergenic
957971921 3:87392941-87392963 ATGTATATTCTGCTGTTTTTGGG - Intergenic
958444665 3:94200710-94200732 ATGTATATTCTGCAGTTGTTGGG + Intergenic
958512663 3:95068431-95068453 ATGTATATTCAGCTGCTGTTGGG - Intergenic
958615704 3:96491346-96491368 ATGTATATTCTATTGTTTTTGGG + Intergenic
958646913 3:96886137-96886159 ATGTGTATTCTTCAGCTGTTGGG + Intronic
958817786 3:98935321-98935343 ATGTATATTCTGTTGTTGTTGGG - Intergenic
958818783 3:98948914-98948936 ATGTATATTCTGCTGTTGTTGGG + Intergenic
958852414 3:99344969-99344991 ATGTAAAATATACTTCTTTTGGG - Intergenic
959009518 3:101059019-101059041 ATGTATATTCTGCAGTTGTTGGG + Intergenic
959147161 3:102562289-102562311 ATGTATATTTTTCTGCTGCTGGG + Intergenic
959291265 3:104477149-104477171 ATGTATATTCTGTTGCTTTTAGG - Intergenic
959330564 3:104999430-104999452 ATGTATATTCTGCAGTTGTTAGG - Intergenic
959362051 3:105405581-105405603 ATGTATATTCTGCAGTTGTTGGG - Intronic
959424042 3:106163934-106163956 ATGTATATTCTGCAGTTGTTGGG - Intergenic
959639259 3:108613668-108613690 ATGCATAATCTGCCACTGTTGGG - Intronic
959643330 3:108666569-108666591 ATGTGTATTCTACTGTTGTCGGG - Intronic
959666264 3:108925585-108925607 ATGTATATTCTATAGGTGTTGGG + Intronic
959974156 3:112438957-112438979 ATGTATATTCTGTGGCTGTTGGG - Intergenic
960114862 3:113884132-113884154 ATATATATTCTGCTACTGTTTGG - Intronic
960294039 3:115920654-115920676 ATGTGTATTCTGTTGCTGTTGGG + Intronic
960296256 3:115948307-115948329 ATGTATATTCTGCAGTTGTTGGG - Intronic
960491898 3:118326293-118326315 ATGTGTATTCTGCTGTTGTTGGG - Intergenic
960560143 3:119074193-119074215 ATGTATATTCTGTTGTTGTTGGG - Intronic
960566693 3:119140646-119140668 ATGTATATTCTGCTGCGGTTGGG - Intronic
960581793 3:119286528-119286550 ATGTGTATTCTGCAGCTGTTTGG + Intergenic
960766961 3:121142431-121142453 ATGTATATCTTGCTGCTGTTGGG - Intronic
960778452 3:121289579-121289601 ATGTATATTCTGCAGTTGTTGGG - Intronic
960866594 3:122207348-122207370 ATGTGTATTCTACAGCAGTTGGG - Intronic
961407398 3:126690921-126690943 ATGTATATTCTGCAGTTGTTGGG - Intergenic
962034663 3:131638697-131638719 ATGTATATTCTGCAGTTGTTGGG - Intronic
962147211 3:132853014-132853036 ATGTATATTCTGCAGTTGTTGGG + Intergenic
962182217 3:133219788-133219810 ATGTGTATTCTGCTGCTCTTAGG + Intronic
962503145 3:136016280-136016302 ATGTATATTCTGCAGTTGTTGGG + Intronic
962530208 3:136273277-136273299 ATGTATATTCTGCAGTTGTTTGG + Intronic
962764862 3:138552352-138552374 ATGTATATTCTACAGTTGTTGGG - Intronic
963031444 3:140982264-140982286 ATGTCTAATGTACTTCTGATCGG + Intergenic
963050876 3:141142505-141142527 ATGTATATTCTGCAGTTGTTGGG + Intronic
963213441 3:142719408-142719430 ATGTATATTCTGCAGTTGTTTGG - Intergenic
963288166 3:143457899-143457921 ATGTGTATTATGCTGCTGTTGGG + Intronic
963365748 3:144332279-144332301 AGGTATAATCTCCAGATGTTGGG - Intergenic
963371818 3:144411058-144411080 ATGTGTATTCTATAGCTGTTGGG + Intergenic
963510476 3:146241694-146241716 ATGGTTATTCTAATGCTGTTGGG - Intronic
963531761 3:146479762-146479784 ATGTATATTCTACTGATTTGGGG - Intronic
963550031 3:146708566-146708588 ATGTAATATCTACTCCAGTTGGG - Intergenic
964017698 3:151967272-151967294 ATGTATATTCTGCAGTTGTTGGG - Intergenic
964053974 3:152429122-152429144 ATTTATACTCTACTGTTGTAAGG + Intronic
964075878 3:152690966-152690988 ATGTATATTCTACAGTTGTTGGG - Intergenic
964225292 3:154392184-154392206 AGGTATATTCTGCTGCTCTTTGG - Intronic
964258587 3:154808109-154808131 ATGTGTATTCTGCAGCTGTTGGG + Intergenic
964393583 3:156222607-156222629 ATGTATATTCTACAGTTGTTGGG - Intronic
964435583 3:156648628-156648650 ATGTGTATTCTGCTGTTGTTGGG - Intergenic
964466959 3:157004497-157004519 ATGTGTATTCTGCTGTTGTTGGG - Intronic
964644067 3:158939140-158939162 ATGTATATTCTGCAGTTGTTGGG - Intergenic
964772858 3:160242543-160242565 ATGTATATTCTACAGTTGTTGGG - Intronic
964992504 3:162831392-162831414 ATGTATATTCTACAGCTTTTGGG - Intergenic
965085905 3:164097779-164097801 ATGTATATTCTCCTGCTATTGGG - Intergenic
965182108 3:165417098-165417120 ATGTATATTCTGTTGCTTTTGGG - Intergenic
965296401 3:166952964-166952986 ATGTATATTCTGCAGTTGTTGGG + Intergenic
965345379 3:167542314-167542336 ATGTATATTCTGCAGTTGTTGGG - Intronic
965892002 3:173526063-173526085 ATGTATATTCTGTTGTTGTTGGG + Intronic
966319290 3:178683093-178683115 ATGTACCATCTACTGTTGATGGG - Intronic
966352850 3:179049345-179049367 ATGTATATTCTGCAGTTGTTGGG - Intronic
966364602 3:179170969-179170991 ATGTGTTTTCTACTGTTGTTGGG - Intronic
966514063 3:180797398-180797420 ATGTGTATTCTACAGCAGTTGGG + Intronic
966515062 3:180810442-180810464 ATGTGTATTCTGCTGTTGTTGGG + Intronic
966547270 3:181164010-181164032 ATGTGTATTCTGCTGCTATTAGG + Intergenic
967030758 3:185604390-185604412 ATGCATATTCTGCTGTTGTTGGG + Intronic
967236329 3:187387337-187387359 ATGTATATTCTGCAGTTGTTGGG - Intergenic
967651624 3:191992853-191992875 ATGTATATTCTGCAGTTGTTGGG - Intergenic
968353778 3:198083344-198083366 ATGTGTATTCTGCTGTTGTTGGG - Intergenic
970338325 4:15077230-15077252 ATGTGTATTCTTCTGCTGTTTGG - Intergenic
970392094 4:15622960-15622982 GTGGATAATTTACTGCTGTTGGG - Intronic
970957424 4:21830835-21830857 ATGTGTATTCTGCTGCAGTTGGG - Intronic
971447817 4:26770642-26770664 ATGTATAGTTTGCTGTTGTTGGG - Intergenic
971472047 4:27037755-27037777 ATGTATATTCTGCAGTTGTTAGG + Intergenic
971554752 4:27999904-27999926 ATGTATATTCTGCAGTTGTTGGG + Intergenic
971557450 4:28032249-28032271 ATGTATATTCTATTGTTGTTGGG + Intergenic
971855047 4:32032242-32032264 ATGTATAATCTACTAGTAATAGG - Intergenic
972232483 4:37091377-37091399 ATGTATATTCTGCAGTTGTTGGG + Intergenic
972846342 4:42995550-42995572 AGGTATAATCTCCTGCAGTGAGG - Intronic
973034390 4:45388252-45388274 ATGTATACTCTGTTGTTGTTGGG + Intergenic
973037304 4:45421908-45421930 ATGTATATTCTGCAGTTGTTGGG + Intergenic
973342841 4:49023812-49023834 ATGTATATTCTGCAGTTGTTGGG + Intronic
973346109 4:49057578-49057600 ATGTATACTCTGCGGCTGTTGGG + Intronic
973902478 4:55490870-55490892 ATGTGTATTCTGCTGTTGTTGGG - Intronic
974127340 4:57712415-57712437 ATGTATATTCTGAAGCTGTTTGG - Intergenic
974218018 4:58926241-58926263 ATGTATATTCTGCCGCTGTTTGG - Intergenic
974248404 4:59353377-59353399 ATATACAATTTACTGCTGTTTGG + Intergenic
974410561 4:61536345-61536367 ATGTATATTCTACATTTGTTGGG + Intronic
974561071 4:63519214-63519236 ATGTGTATTCTGCTGTTGTTGGG - Intergenic
974780604 4:66547771-66547793 ATGTATATTCTGTTGCTTTTGGG - Intergenic
975204299 4:71626553-71626575 ATGTATATTCTGCAGTTGTTGGG - Intergenic
975436523 4:74359456-74359478 GTGTATAAATTACTGCTGTGTGG + Intergenic
975509999 4:75183577-75183599 ATGTATATTCTGCAGTTGTTGGG - Intergenic
975534807 4:75438096-75438118 ATGTATATTCTGCAGTTGTTGGG - Intergenic
975623452 4:76317685-76317707 ATGTATATTCTGCAGTTGTTGGG - Intronic
975790309 4:77942326-77942348 ATGTATATTCTGCAGTTGTTGGG + Intronic
975960313 4:79896076-79896098 ATGTATATTCTGTTGCTATTTGG + Intergenic
975967270 4:79988671-79988693 ATGTATATTCTGTTGTTGTTGGG - Intronic
975981595 4:80166778-80166800 ATGTATATTTTGCTGTTGTTTGG + Intergenic
976362921 4:84201679-84201701 ATGTATATTCTGCAGTTGTTGGG - Intergenic
976460953 4:85312043-85312065 ATGTATATTCTATTGTTGTTGGG + Intergenic
976562565 4:86519077-86519099 ATGTATATTCTGCAGCTGTTGGG + Intronic
976631738 4:87245136-87245158 ATGTATATTCTACTGTGGTTGGG - Intergenic
976641595 4:87344674-87344696 ATGTGTATTCTGCTGTTGTTGGG - Intronic
976716195 4:88124833-88124855 ATGTATATTCTATTGCTTTGGGG - Intronic
976794996 4:88922227-88922249 ATGTATATTCTGCTGATGTGGGG - Intronic
977026425 4:91823860-91823882 ATGTGTAGTATATTGCTGTTAGG + Intergenic
977037459 4:91973162-91973184 ATGCATATTCTGCAGCTGTTGGG + Intergenic
977040049 4:92004324-92004346 ATGTATATTCTATTGTTTTTGGG - Intergenic
977076972 4:92466206-92466228 ATTTATAATTTACTTGTGTTGGG + Intronic
977460835 4:97322858-97322880 AAGTTTAATCTCCTGCTTTTAGG + Intronic
977552257 4:98454572-98454594 ATGTATATTCTGCAGCTGTTGGG + Intergenic
977635741 4:99295992-99296014 ATGTATATTCTGCAGTTGTTGGG - Intergenic
977762984 4:100761560-100761582 ATGTATATTCTACAGTTGTTGGG - Intronic
977773653 4:100891108-100891130 ATGCATATTCTACAACTGTTGGG + Intergenic
977826280 4:101535676-101535698 ATGTATATTCTGCAGTTGTTGGG - Intronic
977872537 4:102109422-102109444 ATATATAATCTGCTGCAGTTGGG - Intergenic
978025346 4:103866897-103866919 ATGTATATTCTATTGTTTTTGGG + Intergenic
978087680 4:104674069-104674091 ATGTATATTCTGCAGCTTTTGGG + Intergenic
978201779 4:106030840-106030862 ATGTATATTCTGCAGTTGTTGGG + Intergenic
978626838 4:110694872-110694894 ATGTGTGTTCTACTGTTGTTGGG + Intergenic
978916350 4:114130041-114130063 ATGTATATTCTGCAGTTGTTGGG - Intergenic
979004691 4:115277823-115277845 ATGTGTATTTTACTGCTATTTGG - Intergenic
979202041 4:117990161-117990183 ATGTATATTCTTCAGTTGTTGGG - Intergenic
979461055 4:120984625-120984647 ATGTATATTCTGCTGTTGTTGGG + Intergenic
979503409 4:121466338-121466360 ATGTAGAATGTCCTTCTGTTTGG - Intergenic
979984690 4:127299079-127299101 ATGTATATTCTGCAGTTGTTGGG - Intergenic
980159992 4:129149395-129149417 ATGTATTATATACTGCTTTGTGG + Intergenic
980391884 4:132157315-132157337 ATGTATATTCTGCAGTTGTTGGG + Intergenic
980475419 4:133308283-133308305 ATGTATAATCTTCCATTGTTTGG + Intergenic
980527413 4:134010252-134010274 ATGTATATTTTAATGCTTTTAGG + Intergenic
980536423 4:134129352-134129374 ATGTATATTCTGCAGCTGTTGGG - Intergenic
980545195 4:134252384-134252406 ATGTGTATTCTGCAGCTGTTGGG + Intergenic
980580859 4:134748045-134748067 ATGTATACTCTGTTGTTGTTGGG - Intergenic
980644877 4:135630829-135630851 ATGTATATTCTGCAGTTGTTGGG + Intergenic
980648494 4:135677790-135677812 ATGTATATTCTGCTGATATTCGG - Intergenic
980672059 4:136022705-136022727 ATGTATATTCTGCAGTTGTTGGG - Intergenic
980747963 4:137045397-137045419 ATGTGTATTTTGCTGCTGTTTGG + Intergenic
981106055 4:140882393-140882415 ATGTGTATTCTGCTACTGTTGGG + Intronic
981167908 4:141583724-141583746 ATGTATATTCTGCAGTTGTTGGG - Intergenic
981179564 4:141724016-141724038 AAGTATATTCTGCTGTTGTTGGG - Intronic
981283451 4:142987979-142988001 AAGTGTATTCTCCTGCTGTTGGG + Intergenic
981600223 4:146480371-146480393 TTGTATAATCTACTGTTATTTGG - Intronic
981939506 4:150267218-150267240 ATGTATATTCTATTGTTGTTGGG - Intronic
982050093 4:151492180-151492202 ATGTATATTCTGCAGTTGTTGGG - Intronic
982388047 4:154834291-154834313 ATGTGCATTCTACTGTTGTTGGG - Intergenic
982394958 4:154906361-154906383 CTGTATAATATTCTGCTGTATGG + Intergenic
982804242 4:159743628-159743650 ATGTATATTCTGCAGTTGTTGGG + Intergenic
982833157 4:160088757-160088779 ATGTGTATTCTGCTACTGTTGGG - Intergenic
982960185 4:161826339-161826361 ATGTATATTCTGCAGTTGTTTGG + Intronic
983046700 4:162995807-162995829 ATCTAACATCTACTGCTGTTTGG + Intergenic
983314164 4:166106235-166106257 ATGTGTATTCTACTGCCATTTGG + Intergenic
983329341 4:166304205-166304227 ATGTATATTCTGCAGTTGTTTGG - Intergenic
983395695 4:167193055-167193077 ATGTGTATTCTGCTGCTGCTGGG + Intronic
983402887 4:167287728-167287750 ATGTATATTCTATTGATTTTTGG + Intergenic
983543088 4:168933691-168933713 ATGTGTATTCTATTGCTGTTGGG - Intronic
983663053 4:170151087-170151109 ATGTGTATTCTCCTGCTATTGGG + Intergenic
983665553 4:170177549-170177571 ATGTGTATTCTACTTCTGATGGG + Intergenic
983807617 4:172015015-172015037 ATGTATAATCTGCAATTGTTGGG + Intronic
983894337 4:173065912-173065934 ATGGATATTCTACAGTTGTTGGG + Intergenic
983962858 4:173775778-173775800 ATGTATATTCTACATTTGTTGGG + Intergenic
984107542 4:175568199-175568221 ATATGTATTCTACTGCTGTTGGG + Intergenic
984787214 4:183578981-183579003 ATGTATACTTTGCTGTTGTTGGG + Intergenic
985586161 5:736497-736519 ATGTACATTCTGCAGCTGTTGGG - Intronic
986595671 5:9419331-9419353 ATGTATATTCTGCGGTTGTTGGG + Intronic
986617650 5:9636401-9636423 ATGCATATTCTGCTGTTGTTTGG + Intronic
986901249 5:12436736-12436758 ATTTATAATCTAATTCTGTCAGG + Intergenic
987030192 5:13969770-13969792 ATGTATAATCTGTAGTTGTTGGG + Intergenic
987269933 5:16296682-16296704 ATGTATATTCCATTGGTGTTGGG + Intergenic
987415836 5:17661343-17661365 ATGTATATTCTATTGTTTTTGGG + Intergenic
987455155 5:18135252-18135274 ATGAATAATCTACTGTTGACTGG - Intergenic
988306087 5:29496181-29496203 ATGTATATTCTGCTGGTTTTGGG + Intergenic
988319801 5:29679650-29679672 ATATGTAATCTAGTGGTGTTGGG + Intergenic
988420894 5:31005070-31005092 ATGTATATTCTGCAGTTGTTGGG + Intergenic
988652146 5:33164584-33164606 ATGTATATTCTGCAGTTGTTGGG + Intergenic
988828413 5:34964133-34964155 ATGTATATTCTGCAGTTGTTGGG + Intergenic
988936257 5:36085906-36085928 ATGTATATTCTGTTGCTTTTGGG - Intergenic
989185225 5:38617913-38617935 ATGTGTATTCTTCTGTTGTTAGG + Intergenic
989495299 5:42105019-42105041 ATGTATATTCTATTGTTGTTGGG + Intergenic
989505829 5:42226545-42226567 ATGTATATTCTGCTGTTTTTGGG + Intergenic
990005601 5:50940623-50940645 ATGTATATTCTGCAGTTGTTGGG - Intergenic
990113039 5:52351553-52351575 ATGTATCATTTACAACTGTTAGG - Intergenic
990230659 5:53710151-53710173 ATGTATATTCTTTTGCTTTTTGG + Intergenic
990351435 5:54920646-54920668 ATGTATATTCTACTGATTTGGGG - Intergenic
990835850 5:60019010-60019032 ATGTATATTCTATTGTTTTTGGG - Intronic
990857287 5:60282977-60282999 ATGTATATTCTGCTGTTGTTGGG + Intronic
991230494 5:64327733-64327755 GTGTGTAATCTACTGCTGTTGGG + Intronic
991504579 5:67310825-67310847 ATGTATATTCTACTGGGTTTGGG - Intergenic
991623198 5:68567849-68567871 ATGTATATTCTGCAGTTGTTGGG - Intergenic
991938348 5:71825930-71825952 ATGTATATTTTGCAGCTGTTGGG + Intergenic
992092487 5:73330048-73330070 ATGTGTATTCTGCTGTTGTTGGG + Intergenic
992503267 5:77362502-77362524 ATGTATAATAAACTTATGTTCGG + Intronic
992945577 5:81805664-81805686 ATGTATATTCTGCCACTGTTGGG - Intergenic
993075319 5:83223140-83223162 ATGTGTATTCTGCAGCTGTTGGG + Intronic
993241620 5:85395674-85395696 ATGTGTATTCTGCAGCTGTTGGG + Intergenic
993380594 5:87202656-87202678 ATGTATATTCTGCTGATTTTGGG + Intergenic
993796871 5:92278172-92278194 ATGTATATTCTGCAGTTGTTGGG - Intergenic
994220627 5:97191056-97191078 ATGTATATTCTGCAGTTGTTGGG + Intergenic
994318135 5:98358409-98358431 ATGTATATTCTGTTGTTGTTGGG + Intergenic
994496772 5:100522571-100522593 ATGTATATTCTACAGTTGTTGGG - Intergenic
994500020 5:100563669-100563691 ATGTGAATTCTTCTGCTGTTGGG - Intronic
994887573 5:105583995-105584017 ACGTATATTCTACAGTTGTTGGG - Intergenic
995180065 5:109222758-109222780 ATGTTAAATCTACTGTGGTTGGG + Intergenic
995258057 5:110070417-110070439 ATGTATATTCTCCTGTTTTTGGG + Intergenic
995594923 5:113737766-113737788 ATGTATATTCTAATCTTGTTGGG - Intergenic
995695074 5:114869430-114869452 ATGTATATTCTGTTGCTTTTGGG - Intergenic
995999001 5:118335087-118335109 ATGTATATTCTATGGTTGTTGGG - Intergenic
996025445 5:118640120-118640142 ATGTATATTCTGCAGTTGTTGGG - Intergenic
996066716 5:119087617-119087639 ATGTATATTCTGCAGCGGTTAGG + Intronic
996110384 5:119559048-119559070 ATGTATATTCTGCAGTTGTTGGG - Intronic
996195665 5:120604017-120604039 ATGTATAATCTGTTGTTGTTGGG + Intronic
996219016 5:120905888-120905910 ATGTATATTCTGCTGCTGTTGGG + Intergenic
996489513 5:124077479-124077501 ATGTGTATTCTGCAGCTGTTGGG + Intergenic
996608791 5:125355261-125355283 ATGTATATTCTACAGTTGTTGGG + Intergenic
996616097 5:125442613-125442635 ATGTATATTCTACAGTTGTTAGG - Intergenic
996632056 5:125644930-125644952 ATGTATATTCTGCAGTTGTTGGG - Intergenic
996663428 5:126029968-126029990 ATGTATATTCTGTTGCTTTTGGG - Intergenic
996807009 5:127467367-127467389 CTGTATGGTTTACTGCTGTTTGG + Intergenic
996953943 5:129161503-129161525 ATGTATATTCTGTTGCTTTTAGG + Intergenic
996985825 5:129563096-129563118 ATGAAGAATGTACTGATGTTTGG - Intronic
997322004 5:132985625-132985647 ATGTATATTCTGCTATTGTTGGG + Intergenic
997403829 5:133626846-133626868 ATGTGTATTCTGCTGTTGTTGGG + Intergenic
997798087 5:136831553-136831575 ATGTATATTCTGCAGTTGTTGGG + Intergenic
997958353 5:138298384-138298406 ATGTGTATTCTACGGTTGTTGGG - Intronic
998435126 5:142101562-142101584 ATATATATTCTGCTGTTGTTGGG - Intergenic
998635227 5:143947060-143947082 ATGCATATTCTATTGTTGTTGGG + Intergenic
998705786 5:144758542-144758564 ATGTATGTTCTGCTGCTGTTGGG + Intergenic
998721513 5:144956765-144956787 ATGTGTATTCTGCAGCTGTTGGG + Intergenic
998741848 5:145212387-145212409 ATGTATATTCTGCAGTTGTTGGG - Intergenic
999106952 5:149080964-149080986 ATGTATATTCTCCCGCTGTTAGG - Intergenic
999839143 5:155405533-155405555 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1000033848 5:157426980-157427002 ATGTATATTCTGCTGATTTTTGG - Intronic
1000430406 5:161144732-161144754 ATGTTTATTCTACTGCTGCTGGG + Intergenic
1000653926 5:163853134-163853156 ATGTATATTCTGCTGCTTTGGGG + Intergenic
1000765137 5:165279144-165279166 ATGAAGAAACTACAGCTGTTTGG + Intergenic
1001418545 5:171567769-171567791 TTGTATATTCTGCTGTTGTTGGG + Intergenic
1001733534 5:173979271-173979293 GTGTATATTCTGCAGCTGTTGGG + Intronic
1001943649 5:175759648-175759670 ATGTGTATTCTGCTGTTGTTGGG - Intergenic
1002149947 5:177220020-177220042 ATGTGTATTCTGCTGCTGTTTGG + Intronic
1002299736 5:178250572-178250594 ATGTATATTTAGCTGCTGTTGGG - Intronic
1002533957 5:179865916-179865938 ATGAATAACATTCTGCTGTTGGG + Intronic
1002681912 5:180971443-180971465 ATGTGTATTCTTCTGCTGTTGGG - Intergenic
1003301607 6:4889039-4889061 ATGTATATTCTGCTGTTGTTGGG + Intronic
1003562448 6:7193293-7193315 ATGTGTATTCTGCTGTTGTTGGG + Intronic
1003699800 6:8449182-8449204 AATTCTCATCTACTGCTGTTGGG - Intergenic
1003992772 6:11503117-11503139 ATGTATATTCCACTGTTATTGGG + Intergenic
1004152007 6:13129834-13129856 ATGTATATTCTACAGTTGTTGGG - Intronic
1005038941 6:21584504-21584526 ATGAATATTCTGCTGTTGTTGGG + Intergenic
1005061030 6:21777285-21777307 ATGTATTATCTTCAGCTGCTGGG + Intergenic
1005244318 6:23864348-23864370 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1005259252 6:24040314-24040336 ATGTATACTCTGCAGTTGTTGGG + Intergenic
1005431245 6:25759261-25759283 ATGTATATTCTGCAGTTGTTGGG + Intronic
1005635650 6:27750914-27750936 ATGTATGTTCTGCTGCTGTTGGG + Intergenic
1006062753 6:31437184-31437206 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1006864313 6:37196524-37196546 ATGTATATTCTATTGTTGTTGGG - Intergenic
1007334660 6:41145976-41145998 ATATGTATTCTACTGCTGTTGGG + Intergenic
1007439854 6:41849476-41849498 ATGTATATTCTGCTGTTGTTAGG - Intronic
1007879209 6:45143231-45143253 ATGTATATTCTGCAGTTGTTGGG - Intronic
1008190454 6:48450214-48450236 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1008431494 6:51422862-51422884 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1008528394 6:52431665-52431687 ATGTATATTCTGCGGTTGTTGGG + Intronic
1008863020 6:56173871-56173893 ATGTGTATTCTGCTGCTGTTTGG - Intronic
1009281474 6:61757129-61757151 ATGTATATTCTGCTGCTGCTTGG + Intronic
1009300992 6:62020405-62020427 ATGTATATTCTGCTATTGTTTGG + Intronic
1009389490 6:63128699-63128721 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1009644549 6:66381143-66381165 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1009946206 6:70344645-70344667 ATGTATAGTCTATTGTTTTTGGG + Intergenic
1010015317 6:71099014-71099036 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1010017188 6:71118920-71118942 ATGTATATTCTGCAGATGTTGGG + Intergenic
1010149225 6:72710870-72710892 ATGTATATCCTGTTGCTGTTGGG - Intronic
1010176965 6:73039774-73039796 ATGTGTATTCTGCTGATGTTGGG + Intronic
1010458965 6:76091622-76091644 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1010491283 6:76479354-76479376 ATGTATAATCAGCAGTTGTTGGG - Intergenic
1010564526 6:77393333-77393355 AAGTATAGTCTACTGTTGCTAGG - Intergenic
1010858172 6:80869912-80869934 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1010866908 6:80987069-80987091 ATGTGCATTCTACTGCTGTTGGG - Intergenic
1010976122 6:82315577-82315599 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1010978688 6:82345483-82345505 ATGTATATTCTGCTGTTGTTAGG + Intergenic
1011156427 6:84338605-84338627 ATGTATATTCTGCAGTTGTTAGG + Intergenic
1011394653 6:86893032-86893054 ATGTATATTCTGCAGGTGTTAGG - Intergenic
1011508080 6:88069589-88069611 ATGTGTATTCTGCTGCAGTTGGG + Intergenic
1011564533 6:88660844-88660866 ATGTATATTCTGCAGTTGTTGGG - Intronic
1011777121 6:90743369-90743391 ATGCATATTCTGCTGCTGTTAGG + Intergenic
1011965605 6:93154023-93154045 ATGTATATTCTGAAGCTGTTGGG + Intergenic
1011985846 6:93444594-93444616 ATGTATATTCTGTTGTTGTTGGG + Intergenic
1012056741 6:94422037-94422059 ATGTATATTCTGTTGCTGTTGGG + Intergenic
1012095771 6:94957349-94957371 ATATATATTCTATTGCTTTTTGG - Intergenic
1012134633 6:95540995-95541017 ATCTCTCATCTACTGCTATTTGG - Intergenic
1012204593 6:96444887-96444909 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1012222024 6:96660188-96660210 ATGTATATTCTATGGTTGTTGGG - Intergenic
1012299024 6:97561486-97561508 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1012302772 6:97610277-97610299 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1012328456 6:97954318-97954340 ATGTGTAATTTGCTGTTGTTGGG + Intergenic
1012770729 6:103430668-103430690 ATGTGTATTCTGCTGCTGTTAGG - Intergenic
1012810591 6:103952115-103952137 ATGTATATTCTATGGCTGTTGGG - Intergenic
1012965864 6:105672097-105672119 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1013381730 6:109578991-109579013 ATGTATATTCTGCAGTTGTTGGG + Intronic
1014481834 6:121948747-121948769 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1014528166 6:122525435-122525457 ATGTATATTCTGCTGCTGTTGGG + Intronic
1014792557 6:125691089-125691111 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1015210446 6:130691818-130691840 ATGTATATTCTATGGCTGATGGG - Intergenic
1015222376 6:130818946-130818968 ATGTATATTCTGTGGCTGTTGGG - Intergenic
1015765219 6:136709024-136709046 AGACATAATCTACTTCTGTTGGG - Intronic
1015887847 6:137938418-137938440 ACGTGTATTCTACCGCTGTTGGG + Intergenic
1016059550 6:139615484-139615506 ATGTGTATTCTACTGTTGTTGGG + Intergenic
1016496843 6:144673137-144673159 ATGTATATTCTGCAGTTGTTGGG + Intronic
1016909910 6:149188277-149188299 ATGTATATTCTTCAGTTGTTGGG + Intergenic
1017127017 6:151075639-151075661 ATGCGTAATCTGCTGTTGTTGGG - Intronic
1018353052 6:162982767-162982789 ATGTATATTCTGCAGTTGTTGGG + Intronic
1018781561 6:167071967-167071989 ATGTATATTCTACAGTTGTTGGG + Intergenic
1019035463 6:169052574-169052596 AAGTATATTCTGCTGCTGCTGGG + Intergenic
1019085927 6:169476629-169476651 ATCTCTAATAAACTGCTGTTGGG - Intronic
1019092154 6:169546758-169546780 ATGTAAAATCTCCAGCTGTCTGG + Intronic
1020362407 7:7341908-7341930 ATATATATTCTGCAGCTGTTAGG + Intergenic
1020606449 7:10343940-10343962 ATTAATAATCTACTGGTGTTGGG - Intergenic
1020702572 7:11501306-11501328 ATGTATATTCTGTTGCTTTTGGG - Intronic
1020843435 7:13251802-13251824 ATGTATATTCTGCTTCTGTTGGG + Intergenic
1020852467 7:13374115-13374137 ATGTATATTCTTCTGCTATTGGG + Intergenic
1020856019 7:13424553-13424575 ATGTGTAATCTGCTGCTATTGGG - Intergenic
1020997652 7:15283757-15283779 ATGTATATTCTGCAGTTGTTGGG - Intronic
1021112929 7:16716110-16716132 ATGTGTATTCTACAGTTGTTGGG + Intergenic
1021198695 7:17701524-17701546 ATGTGTATTATATTGCTGTTGGG - Intergenic
1021753753 7:23831091-23831113 ATGTGTATTCTGTTGCTGTTGGG + Intronic
1021831356 7:24614762-24614784 ATGTGTATTCTGCAGCTGTTGGG - Intronic
1022386860 7:29908514-29908536 ATGTATATACTGCTGTTGTTGGG - Intronic
1023510833 7:40951918-40951940 ATGTATATTCTATTGATTTTGGG + Intergenic
1023657415 7:42438682-42438704 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1023657905 7:42444770-42444792 ATGTATATTCTGTTGTTGTTTGG + Intergenic
1024174961 7:46829856-46829878 ATGTATATTCTACAGTTGTTGGG - Intergenic
1024494305 7:50026452-50026474 ATGTGTATTCTCCTGTTGTTGGG - Intronic
1024665345 7:51541510-51541532 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1024847589 7:53666050-53666072 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1025820835 7:64961670-64961692 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1026408080 7:70089058-70089080 ATGTATATTCTGCTGTCGTTGGG + Intronic
1026485330 7:70814158-70814180 ATGTATATTCTGCTGCTGTTGGG - Intergenic
1026495571 7:70898917-70898939 ATGTGTATTCTGTTGCTGTTGGG - Intergenic
1026495723 7:70900779-70900801 ATGTGTATTCTGCTGCTTTTGGG + Intergenic
1026860481 7:73784159-73784181 ATGTGTATTCTGCTGTTGTTGGG + Intergenic
1027627230 7:80561582-80561604 ATGTATATTCTGCTGTTTTTGGG + Intronic
1027715269 7:81661607-81661629 ATGTATATTCTATGGTTGTTGGG - Intergenic
1027838377 7:83276150-83276172 ATGTATATTCTACAGTTATTCGG + Intergenic
1028194723 7:87892984-87893006 ATGTATATTCTGCTGTGGTTGGG + Intronic
1028198015 7:87929430-87929452 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1028225592 7:88248952-88248974 ATGTGTATTCCACAGCTGTTGGG + Intergenic
1028347857 7:89805690-89805712 ATGTATATTCTCCAGCCGTTAGG + Intergenic
1028402132 7:90435164-90435186 ATGTATATTCTGCAGTTGTTGGG - Intronic
1028765151 7:94547918-94547940 ATGTATAATCCTATGCCGTTTGG + Intronic
1028819297 7:95187967-95187989 ATGTATACTCTGCAGTTGTTGGG + Intronic
1028936647 7:96472200-96472222 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1030533667 7:110739739-110739761 ATGTATATTCTGCAGTTGTTGGG - Intronic
1030709286 7:112731105-112731127 ATATATATTCTGCAGCTGTTGGG + Intergenic
1030773421 7:113503313-113503335 ATTTATAATCTAATTCAGTTTGG + Intergenic
1030786252 7:113666810-113666832 ATGTTTATTCTTCTGTTGTTGGG - Intergenic
1030813199 7:114002021-114002043 ATGTATATTCTGTTGTTGTTGGG - Intronic
1030972540 7:116077954-116077976 ATGTATATTCTGCAGTTGTTGGG - Intronic
1031012653 7:116539822-116539844 ATATACCATCTGCTGCTGTTTGG + Intronic
1031090215 7:117345714-117345736 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1031220145 7:118955369-118955391 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1031261568 7:119527323-119527345 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1031461449 7:122054164-122054186 AGGCATACTCTTCTGCTGTTGGG + Intronic
1031796698 7:126184208-126184230 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1032288925 7:130568738-130568760 ATGTATATTCTGCAGTTGTTGGG - Intronic
1032778532 7:135142010-135142032 ATGTATATTCTGTTGTTGTTGGG + Intronic
1032788668 7:135223787-135223809 ATGTATATTCTGCTGCCATTGGG - Intergenic
1034247604 7:149660109-149660131 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1034611410 7:152373322-152373344 ATGTTTCATCTGGTGCTGTTAGG - Intronic
1034708293 7:153167645-153167667 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1035440866 7:158898198-158898220 ATGTGTATTCTGCTGTTGTTGGG + Intronic
1036042089 8:5096649-5096671 ATGTATATTCTGCTGTCGTTGGG + Intergenic
1036118190 8:5983804-5983826 ATGTATATTCTGCTATTGTTGGG - Intergenic
1037320586 8:17638507-17638529 ATGTATATTCTGCAGTTGTTGGG + Intronic
1037668087 8:20988926-20988948 ATGCATATTCTACTGTTGTTGGG - Intergenic
1038074746 8:24058863-24058885 ATGTATCTTCTGCTGCTGTTGGG - Intergenic
1038393494 8:27228242-27228264 ACGTATATTCTGCTGCTGTTCGG + Intergenic
1038836123 8:31126184-31126206 ATGTGTACTCTACTGTTGTTGGG - Intronic
1038876533 8:31557152-31557174 ATATGTATTCTGCTGCTGTTGGG - Intergenic
1038908971 8:31940078-31940100 ATGTATACTCTGCAGTTGTTGGG - Intronic
1039763659 8:40605626-40605648 ATGTATATTCTACAGTTGTTGGG + Intronic
1039810284 8:41041774-41041796 ATGTATATTCTGCGGTTGTTGGG + Intergenic
1040076853 8:43245905-43245927 ATGTGTATTCTGCTGTTGTTGGG + Intergenic
1041161288 8:55046879-55046901 ATGCATATTCTGCAGCTGTTGGG - Intergenic
1041174744 8:55183695-55183717 ATGTCTATTCTGCTGCTATTGGG + Intronic
1041188808 8:55331415-55331437 ATGTGTATTCTACCGTTGTTGGG + Intronic
1041508189 8:58624708-58624730 AAGTGTATTCTGCTGCTGTTGGG + Intronic
1041602640 8:59738323-59738345 ATGTAGTTTCTAATGCTGTTAGG - Intergenic
1041615545 8:59901879-59901901 ATGTATATTCTGTTGCTTTTAGG - Intergenic
1042084537 8:65093165-65093187 ATGTATATTCCACAGTTGTTAGG - Intergenic
1042724419 8:71857674-71857696 ATGTATATCCTACTGCTGTGGGG + Intronic
1042768217 8:72350475-72350497 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1043003278 8:74785911-74785933 ATTTATTATCTACAGCTTTTTGG + Intronic
1043104184 8:76087491-76087513 ATGTATATTCTGCTGTTGTTGGG + Intergenic
1043144346 8:76633622-76633644 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1043240188 8:77923622-77923644 ATGTATATTCTATTGTTTTTGGG - Intergenic
1043556504 8:81436730-81436752 ATGTATACTCTGCAGTTGTTGGG + Intergenic
1043685174 8:83075592-83075614 ATGTATATTCTGCTGTTATTGGG - Intergenic
1043988107 8:86717690-86717712 ATGTATATTCTGCAGTTGTTGGG - Intronic
1044227253 8:89733476-89733498 ATGTGTATTCCATTGCTGTTGGG - Intergenic
1044334612 8:90965532-90965554 ATGTATATTCTGCTGTTGTTGGG - Intronic
1044447344 8:92294590-92294612 ATGTATACTCTATTGTTTTTAGG + Intergenic
1044811440 8:96067508-96067530 ATGTGTATTCTGCTGTTGTTGGG + Intergenic
1045133805 8:99189903-99189925 ATGTGTACTCTGCTGTTGTTGGG + Intronic
1045671254 8:104555839-104555861 ATGTATATTCTACAGTTGTTGGG - Intronic
1046276116 8:111962544-111962566 ATGTATATTCTATGGTTGTTGGG + Intergenic
1046284527 8:112077393-112077415 ATGTATATTCTGCAGCTCTTGGG + Intergenic
1046323316 8:112606569-112606591 ATGTGTACTCTGCTGCTGATGGG - Intronic
1046440716 8:114250006-114250028 ATGTAGAATCAACTGCAATTAGG + Intergenic
1046448859 8:114360713-114360735 ATGTATATTCTGCAGTTGTTTGG - Intergenic
1046709104 8:117489336-117489358 ATGTATATTCTGCTGTTTTTGGG - Intergenic
1046764223 8:118052454-118052476 TTGTTAAATGTACTGCTGTTAGG - Intronic
1046808154 8:118503244-118503266 ATGTATCATGCACTGCAGTTTGG + Intronic
1046959881 8:120099940-120099962 ATGTATATTCTGTTGTTGTTGGG + Intronic
1047099364 8:121659188-121659210 ATGTGTATTCTGCTGCTGTTGGG - Intergenic
1047148048 8:122228036-122228058 ATGTATATTCTACAGTTGTTGGG - Intergenic
1047383953 8:124391784-124391806 ATGTATATTCTTCAGCTCTTGGG + Intergenic
1047607067 8:126485729-126485751 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1047688546 8:127326697-127326719 ATGTGTATTCTACTGTTGCTGGG - Intergenic
1047842619 8:128769605-128769627 ATGTATATTCTGCAGCTGTTAGG - Intergenic
1047901602 8:129428800-129428822 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1048102732 8:131371798-131371820 ATGTATAGTCTTTTGTTGTTAGG - Intergenic
1048530828 8:135248578-135248600 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1048741127 8:137562050-137562072 ATGTATATTCTGTTGCTGTGGGG + Intergenic
1049033341 8:140053522-140053544 ATGTATAATCTGCCACTGTTGGG + Intronic
1049871778 8:144984866-144984888 ATGTGTATTCTGCTGTTGTTGGG - Intergenic
1050004191 9:1111744-1111766 ATGTATATTCTGCTATTGTTGGG + Intergenic
1050198804 9:3118346-3118368 ATGTGTATTCTGCTGCTGTTGGG + Intergenic
1050248442 9:3716715-3716737 ATGTATATTCTGTAGCTGTTGGG - Intergenic
1050498918 9:6273500-6273522 ATGTATATTCTGCTGTTGTTAGG - Intergenic
1050505818 9:6348151-6348173 ATGTATATGCTGCTGTTGTTGGG - Intergenic
1050776341 9:9266427-9266449 ATGTGTATTCTGCTACTGTTGGG - Intronic
1050889007 9:10799381-10799403 ATGTATATTCTTCTGCTATTGGG + Intergenic
1051016788 9:12486882-12486904 ATGTTCAATCTGCTGTTGTTGGG - Intergenic
1051471019 9:17442198-17442220 ATATATATTCTGCTGTTGTTGGG - Intronic
1051687443 9:19672998-19673020 ATGTATATTCTGCAGTTGTTGGG + Intronic
1051819428 9:21147609-21147631 ATGTGTACTCTGCTGTTGTTGGG + Intergenic
1051881385 9:21843431-21843453 ATGTATATTCTGCAGTTGTTGGG - Intronic
1051885925 9:21892803-21892825 ATGTATATTCTGTTGTTGTTGGG - Intronic
1052006444 9:23355408-23355430 ATGTATATTCTACAGGTGTTGGG + Intergenic
1052016002 9:23468100-23468122 ATGTGTATTCTGCTGCTGTTGGG - Intergenic
1052307455 9:27026502-27026524 ATGTATATTCTGCAGTTGTTGGG - Intronic
1052550043 9:29936670-29936692 ATGTATATTCTACAGTTGTCAGG + Intergenic
1052583448 9:30392050-30392072 ATGTATAATCTGTTGGTTTTGGG - Intergenic
1052624686 9:30960169-30960191 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1052746411 9:32446075-32446097 ATGTATATTCTACTGATTTGGGG + Intronic
1052872558 9:33523040-33523062 ATGTATATTCTGCTGTTGTTGGG + Intergenic
1053031098 9:34778793-34778815 ATGTGTATTCTGCTGCTGTTGGG - Intergenic
1053092178 9:35288773-35288795 ATGTATAAGAAACTGCTGTGGGG + Intronic
1053571597 9:39315394-39315416 ATGTGTATTCTGCTGCTGTTGGG + Intergenic
1053589238 9:39494534-39494556 ATGTGTATTCTATTGTTGTTGGG - Intergenic
1053837505 9:42156739-42156761 ATGTGTATTCTGCTGCTTTTGGG + Intergenic
1054093154 9:60874096-60874118 ATGTGTATTCTGCTGCTGTTGGG + Intergenic
1054114632 9:61150008-61150030 ATGTGTATTCTGCTGCTGTTGGG + Intergenic
1054125548 9:61303618-61303640 ATGTGTATTCTGCTGCTGTTGGG - Intergenic
1054577060 9:66870759-66870781 ATGTGTATTCTATTGTTGTTGGG + Intronic
1054593122 9:67032519-67032541 ATGTGTATTCTGCTGCTGTTGGG - Intergenic
1054844595 9:69780356-69780378 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1054859919 9:69940172-69940194 ATGTATATTCTGTTGTTGTTAGG - Intergenic
1055131561 9:72780994-72781016 ATGTATATTCTGTTGTTGTTGGG - Intronic
1055156527 9:73069231-73069253 ATGTATATTCTGCAGTTGTTGGG - Intronic
1055186930 9:73468442-73468464 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1055203904 9:73703053-73703075 ATGTGTATTCTACTGTTATTGGG - Intergenic
1055448742 9:76410698-76410720 ATGTGTATTCTGCTGTTGTTGGG + Intergenic
1055557714 9:77491841-77491863 ATGTGTATTCTACAGCAGTTGGG - Intronic
1055802451 9:80054183-80054205 ATGTGCATTCTGCTGCTGTTGGG - Intergenic
1056312705 9:85357293-85357315 ATGTATATTCTGCAGTTGTTTGG + Intergenic
1056345222 9:85687396-85687418 ATGTATATTCTGCTGTTGTTGGG - Intronic
1056396918 9:86189877-86189899 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1056582396 9:87901114-87901136 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1056671843 9:88636502-88636524 ATGTATATTCTGCAGTTGTTTGG + Intergenic
1056996308 9:91463623-91463645 ATGTGCATTCTGCTGCTGTTGGG + Intergenic
1057066932 9:92062525-92062547 ATGTGTATTCTGCTGCTGTTTGG - Intronic
1057289453 9:93793233-93793255 ATATATATTCTGCTGTTGTTGGG + Intergenic
1057418810 9:94890908-94890930 ATATGTATTCTACTGTTGTTGGG + Intronic
1057532453 9:95863648-95863670 ATATATATTCTGCTGTTGTTGGG + Intergenic
1057634400 9:96749956-96749978 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1058487313 9:105455119-105455141 ATGCTTAAACTACTGCTGTTAGG - Intronic
1058913567 9:109543507-109543529 ATGTATATTCTTCTGTTGTTGGG + Intergenic
1059347894 9:113644539-113644561 ATGTGTATTCTGCTGTTGTTGGG + Intergenic
1061031407 9:128086095-128086117 ATGTGTATTCTGCTGTTGTTGGG + Intronic
1062608104 9:137357443-137357465 ATGTATTTTGTACTGCTTTTTGG + Intronic
1062713825 9:137992616-137992638 ATGTATATTCTGCAGTTGTTGGG - Intronic
1186212294 X:7262209-7262231 ATGCAAAATCTATTGCTGGTTGG + Intronic
1187040025 X:15584372-15584394 ATGTATATTCCATAGCTGTTGGG + Intronic
1187109021 X:16276749-16276771 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1187219988 X:17315409-17315431 ATGTATAGTCTGCTGCTATTGGG - Intergenic
1187375856 X:18753910-18753932 ATGTATAGTCTGCTTTTGTTGGG + Intronic
1187435771 X:19267691-19267713 ATGTGTATTCTGCTGTTGTTGGG - Intergenic
1187663496 X:21576102-21576124 ATGTGTATTCTGCTGTTGTTGGG - Intronic
1187683691 X:21795182-21795204 ATGTATATTCTACTGTTCTTTGG - Intergenic
1187695931 X:21920216-21920238 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1187751976 X:22476684-22476706 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1187801684 X:23070524-23070546 ATGTATATTCTGTTGTTGTTGGG - Intergenic
1188569665 X:31568231-31568253 ATGTGTATTCTGCTACTGTTGGG + Intronic
1188756797 X:33972432-33972454 ATGTATATTCTGCTGTTGCTGGG + Intergenic
1188913060 X:35874120-35874142 ATGTATATTCTGCTGTTCTTGGG + Intergenic
1189139827 X:38591489-38591511 TTGTGTATTCTACTGTTGTTGGG + Intronic
1189435085 X:40985548-40985570 ATGTATATTCTGCTGTTGTTGGG - Intergenic
1189567419 X:42257387-42257409 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1189599926 X:42613244-42613266 ATGTATATTCTGCAGATGTTGGG + Intergenic
1189639101 X:43048489-43048511 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1189652077 X:43201276-43201298 ATGTATATTCTGTTGCTTTTGGG + Intergenic
1189931943 X:46021780-46021802 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1189945781 X:46177026-46177048 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1190020733 X:46871655-46871677 ATGTGTAATCTGCTGTTGCTTGG + Intronic
1190151159 X:47949949-47949971 ATGTGTATTCTTCTGCTGTTGGG - Intronic
1190469179 X:50760022-50760044 ATGTATATTCTTCTGTGGTTGGG + Intronic
1190502604 X:51094788-51094810 ATGTATATTCTGCAGCTGTTGGG - Intergenic
1190529936 X:51364292-51364314 ATGTACAATCTACTGATTTGGGG - Intergenic
1190540504 X:51473180-51473202 ATATATATTTTATTGCTGTTGGG + Intergenic
1190608882 X:52173441-52173463 ATGTATAATCTGTTGATGTGGGG - Intergenic
1190802233 X:53801357-53801379 ATGTGTATTCTACTATTGTTGGG - Intergenic
1190807997 X:53857497-53857519 ATGTGTATTCTGCAGCTGTTGGG + Intergenic
1191021989 X:55871188-55871210 ATGTATATTCTTCTGCTGTTGGG - Intergenic
1191050556 X:56186552-56186574 ATGTATAATCTGCTGATTTGGGG - Intergenic
1191067478 X:56365889-56365911 ATGTATATTCTGCTGTTGTTGGG + Intergenic
1191123420 X:56928844-56928866 ATTTATATTCTTCTGCTGTTGGG + Intergenic
1191147242 X:57179795-57179817 ATGTATATTCTGTTGCTTTTGGG - Intergenic
1191164280 X:57370987-57371009 ATGTGTATTCTGCAGCTGTTGGG - Intronic
1191186924 X:57623150-57623172 ATGTATATTCTACTGATTTGGGG - Intergenic
1191212039 X:57895139-57895161 ATGTATATTCTGCAGGTGTTGGG - Intergenic
1191634107 X:63357672-63357694 ATGTGTATTCTGCAGCTGTTGGG - Intergenic
1191642269 X:63439317-63439339 ATGTATATTCTTCAGTTGTTGGG - Intergenic
1191768585 X:64730733-64730755 ATGTATACTCTATTGTTTTTGGG + Intergenic
1191813808 X:65220877-65220899 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1191818662 X:65277394-65277416 ATGTGTATTCTACAGCTATTGGG - Intergenic
1191836953 X:65473931-65473953 ATGTGTATTCTTCTGCTGTTGGG + Intronic
1191891383 X:65945950-65945972 ATGTATATTCTATTCTTGTTGGG + Intergenic
1191944090 X:66512309-66512331 ATGTATACTCTGTTGTTGTTGGG + Intergenic
1192021739 X:67400495-67400517 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1192028770 X:67486451-67486473 ATGTACATTCTACTATTGTTGGG - Intergenic
1192609925 X:72557229-72557251 ATGTATATTCTGCAGTTGTTGGG - Intronic
1192703417 X:73500995-73501017 ATGTATATTCTATTGCTTTGGGG - Intergenic
1192722923 X:73719160-73719182 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1192756611 X:74052519-74052541 ATGTATATTCTAATTTTGTTGGG - Intergenic
1192769581 X:74173477-74173499 ATGTGTATTCTGTTGCTGTTGGG - Intergenic
1192835978 X:74800068-74800090 ATGTGTATTCTGCTGCTGTTGGG - Intronic
1192876837 X:75238642-75238664 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1192920356 X:75699564-75699586 ATGTATATTCTACTGTTGTTCGG - Intergenic
1193015573 X:76729475-76729497 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1193182545 X:78475310-78475332 ATGTATATTCTGCAGCTGTTGGG + Intergenic
1193185753 X:78510165-78510187 ATGTATATTCTGCAGCTATTGGG - Intergenic
1193197149 X:78645830-78645852 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1193218624 X:78896276-78896298 ATGTATATTCTACAGTTGTTGGG + Intergenic
1193415490 X:81217713-81217735 ATGTATATTCTGCAGTTGTTGGG + Intronic
1193446701 X:81614245-81614267 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1193501889 X:82286656-82286678 ATGTGCATTCTGCTGCTGTTGGG + Intergenic
1193572911 X:83166069-83166091 ATGAGTATTCTACTGCTGTTGGG + Intergenic
1193703651 X:84793391-84793413 ATGTATATTCTATTGCTTTTGGG - Intergenic
1193791855 X:85824075-85824097 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1193891702 X:87054373-87054395 ATGTATAGTCTGTTGCTTTTAGG - Intergenic
1194001613 X:88436671-88436693 ATGCATAATCTTCAGTTGTTGGG - Intergenic
1194006086 X:88494402-88494424 ATGTGTATTCTATTGCTGTTGGG + Intergenic
1194040087 X:88929933-88929955 ATGCATATTCTACAGGTGTTGGG + Intergenic
1194154291 X:90367313-90367335 ATGTATATTCTGCTGCTTTCGGG + Intergenic
1194175062 X:90635421-90635443 ATGTATATTCTGCGGCTGTTGGG - Intergenic
1194193770 X:90867639-90867661 ATGTATATTCTGCTGCTTTGGGG - Intergenic
1194214071 X:91107348-91107370 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1194232181 X:91337976-91337998 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1194438873 X:93904439-93904461 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1194516151 X:94856763-94856785 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1194553977 X:95335065-95335087 ATGTATATTCTGCAGTTGTTTGG - Intergenic
1194606393 X:95984275-95984297 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1194664120 X:96658373-96658395 ATGTATATTCTGTTGCTTTTGGG - Intergenic
1194771395 X:97910680-97910702 ATGTATAGTGTACACCTGTTGGG + Intergenic
1194791286 X:98153823-98153845 ATATATATTCTGCTGGTGTTGGG + Intergenic
1194839516 X:98723477-98723499 ATGTGTATTCTGCAGCTGTTGGG - Intergenic
1194881625 X:99259202-99259224 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1194989664 X:100533501-100533523 ATGTATCTTCTCCTGATGTTGGG + Intergenic
1195130932 X:101851285-101851307 GTGTATATTCTGCTGTTGTTGGG - Intronic
1195268578 X:103209061-103209083 ATGCATATTCTACTGTTGTTGGG + Intergenic
1195528894 X:105928945-105928967 ATGCATATTCTGCAGCTGTTGGG + Intronic
1195786531 X:108530082-108530104 ATGTATAACCTGCAGTTGTTGGG - Intronic
1195988905 X:110663139-110663161 ATGCATATTCTCCTGTTGTTGGG - Intergenic
1196038187 X:111170430-111170452 GTATACTATCTACTGCTGTTAGG + Intronic
1196949259 X:120859917-120859939 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1196994467 X:121366394-121366416 ATGTATATTCTTCTGTTGTTGGG + Intergenic
1197081534 X:122424199-122424221 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1197109156 X:122752312-122752334 ATGTATATTCTGCTGTTGTTAGG + Intergenic
1197120300 X:122882948-122882970 ATGTATATTCCACAGTTGTTGGG - Intergenic
1197184602 X:123572677-123572699 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1197434484 X:126409174-126409196 ACGTATATTCTGTTGCTGTTGGG - Intergenic
1197435424 X:126422267-126422289 ATATATATTCTGCAGCTGTTGGG + Intergenic
1197504135 X:127280595-127280617 ATGTATATTCTATGGTTGTTGGG - Intergenic
1197565091 X:128073917-128073939 ATGTATAGTCTACAGTTCTTGGG + Intergenic
1197571964 X:128160957-128160979 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1197604098 X:128564210-128564232 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1197640528 X:128962130-128962152 ATGTGTATTCTTCTGTTGTTGGG - Intergenic
1197902157 X:131385102-131385124 ATGTGTATTCTGCTGTTGTTAGG - Intronic
1197986989 X:132277634-132277656 ATGCATATTCTACAGCTCTTAGG + Intergenic
1198168973 X:134086065-134086087 ATGTATATTCTATGGCTGTTGGG - Intergenic
1198327523 X:135588353-135588375 ATGTATAGTCTGGTGTTGTTGGG - Intergenic
1198559657 X:137835683-137835705 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1198573219 X:137980747-137980769 ATGTATAATCTCCTTCTCTTAGG + Intergenic
1198616735 X:138465853-138465875 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1198633343 X:138667782-138667804 ATGTTGAATCAGCTGCTGTTGGG - Intronic
1198664961 X:139010330-139010352 ATGTATATTCTACAGTTGTTGGG - Intronic
1198836621 X:140812441-140812463 ATGTATATTCTACAGTTGTTGGG + Intergenic
1199065739 X:143415939-143415961 ATGTATATTCTGCAGTTGTTAGG + Intergenic
1199132058 X:144201241-144201263 ATGTATATTCTGTTGTTGTTGGG + Intergenic
1199242017 X:145557930-145557952 ATGTACATTCTTCTGTTGTTGGG - Intergenic
1199464394 X:148119674-148119696 ATGTGTATTCTTCTGCTGTTGGG - Intergenic
1199564564 X:149200878-149200900 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1199658907 X:150026837-150026859 ATGTATATTCTGCTGTTGTGAGG - Intergenic
1200317874 X:155153286-155153308 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1200332886 X:155316292-155316314 ATGTATATTCTGCAGTTGTTGGG - Intronic
1200365708 X:155660484-155660506 ATGTATATACTGCTGTTGTTAGG + Intronic
1200368185 X:155690282-155690304 ATGTACATTCTATTGCTTTTGGG + Intergenic
1200376778 X:155789792-155789814 ATGTGTATTTTGCTGCTGTTGGG - Intergenic
1200500646 Y:3944206-3944228 ATGTATATTCTGCTGCTTTTGGG + Intergenic
1200521709 Y:4216394-4216416 ATGTATATTCTGCGGCTGTTGGG - Intergenic
1200540379 Y:4450023-4450045 ATGTATATTCTGCTGCTTTGGGG - Intergenic
1200804674 Y:7420994-7421016 ATGTATAATCTACTGTTTCATGG - Intergenic
1201321668 Y:12705410-12705432 ATGTGTACTCTACTGTTGTTGGG + Intronic