ID: 957833655

View in Genome Browser
Species Human (GRCh38)
Location 3:85555704-85555726
Sequence TTAGGTTGCCATTTGTTCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 120}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957833653_957833655 3 Left 957833653 3:85555678-85555700 CCTACAATTTTCTATTAAATACA 0: 1
1: 0
2: 5
3: 54
4: 605
Right 957833655 3:85555704-85555726 TTAGGTTGCCATTTGTTCCAAGG 0: 1
1: 0
2: 0
3: 17
4: 120
957833652_957833655 4 Left 957833652 3:85555677-85555699 CCCTACAATTTTCTATTAAATAC 0: 1
1: 0
2: 3
3: 40
4: 448
Right 957833655 3:85555704-85555726 TTAGGTTGCCATTTGTTCCAAGG 0: 1
1: 0
2: 0
3: 17
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957833655 Original CRISPR TTAGGTTGCCATTTGTTCCA AGG Intronic
905615565 1:39395276-39395298 ATAGGTGGCAATTTCTTCCAGGG - Intronic
908076668 1:60526954-60526976 TTAGGTGGCCTTTTACTCCAAGG + Intergenic
912564650 1:110578841-110578863 TTAGGTTGCCATTACTTTCAAGG + Intergenic
918350186 1:183647325-183647347 TTAGGTAGCTATTTTGTCCATGG + Exonic
919201541 1:194360300-194360322 TTTGCTTACCTTTTGTTCCAGGG + Intergenic
921728322 1:218549059-218549081 TTAGGTGGACATTTTATCCATGG - Intergenic
922875270 1:228935518-228935540 TTAGGCTGACCTTTGGTCCATGG - Intergenic
1064367294 10:14719497-14719519 TGGGCTAGCCATTTGTTCCAGGG + Intronic
1072187805 10:93059295-93059317 TTATATTGCCATTTGGACCACGG - Exonic
1074505402 10:114065555-114065577 GAAGGTTGCAATTTGTTCCGTGG + Intergenic
1078359525 11:10657683-10657705 TTAGGTTGCTATTAATACCACGG + Intronic
1078608145 11:12795651-12795673 TGATGTTGCCAGTTGGTCCATGG - Intronic
1078956522 11:16202442-16202464 TTCAGCAGCCATTTGTTCCATGG - Intronic
1079420251 11:20279501-20279523 TTAGGTTGCAGTTAGTTACACGG - Intergenic
1080069555 11:28064282-28064304 TTAAGGTGACATTTGTTTCAAGG - Intronic
1083165288 11:60881323-60881345 TTCTGTTGCCTTTTGTTCCAGGG - Intergenic
1086597283 11:88587950-88587972 TTAGTTTGTGTTTTGTTCCAAGG + Intronic
1087303524 11:96462523-96462545 TGAGGTTGGCATTACTTCCATGG - Intronic
1091941730 12:4490700-4490722 TTAGGTAGCCATTTGCTCGTAGG + Intronic
1094110539 12:26857379-26857401 ATAGGTAGCTATTTGTTTCAGGG - Intergenic
1094262501 12:28517227-28517249 TTAGTTTGGCATCTGTTGCAAGG + Intronic
1094344500 12:29452073-29452095 TTTGGGTGCCAGTTTTTCCATGG + Intronic
1095355477 12:41267950-41267972 TAAGGCTGCCATTGCTTCCATGG + Intronic
1097405880 12:59189424-59189446 TTAGTTTGCAATTTATTTCAAGG + Intergenic
1098166638 12:67705302-67705324 AAAGGTTGCCTTTTGTTCCAAGG - Intergenic
1098374720 12:69802814-69802836 TTAGGTGACCATTTGTTGGAGGG + Intronic
1099370708 12:81826333-81826355 ATAGGTTCCCATTTGAACCAGGG + Intergenic
1100271301 12:93027808-93027830 CTAGAGTGCCAGTTGTTCCAAGG - Intergenic
1101987659 12:109460440-109460462 TTAGGTGGCCTGCTGTTCCAGGG + Intronic
1106031410 13:26008726-26008748 TCAGTTTGCCATTTTTTGCAGGG - Intronic
1107707756 13:43123906-43123928 TTAGGTAGACATATGTTTCATGG + Intergenic
1108976605 13:56451843-56451865 TTAGATTGCCATCTTTCCCATGG + Intergenic
1109207680 13:59500219-59500241 TCAGGTTGTCTTTTCTTCCAAGG + Intergenic
1109929693 13:69198703-69198725 TTATGTTGCCATTTGTAAGAAGG + Intergenic
1111552220 13:89828416-89828438 TAAGGTTTCTATTTGTTCCAAGG - Intergenic
1111941842 13:94617420-94617442 TTATGTTGCCATTATTTCTAAGG + Intronic
1112084835 13:96019432-96019454 GTAAGTTGCCCTTTGTCCCAGGG + Intronic
1119141068 14:72267684-72267706 TTAGGAAGCCATTTGCTCCATGG - Intronic
1119395960 14:74326651-74326673 TCAGGGCGCCTTTTGTTCCAGGG - Intronic
1120566082 14:86059056-86059078 TTAAGTTACCATATGTTACATGG + Intergenic
1121891324 14:97593903-97593925 TTAGGTTTACATTCATTCCAAGG + Intergenic
1124876021 15:33594156-33594178 ATATGAGGCCATTTGTTCCAAGG + Intronic
1125009722 15:34857893-34857915 TTAGCTTGCCCTTTGCCCCATGG + Intronic
1125394941 15:39236401-39236423 TTGAGTTACCATTTGTTCCCTGG + Intergenic
1136142061 16:28294005-28294027 TTCTGTTCCCATTTGTCCCAGGG + Intronic
1137356089 16:47765965-47765987 TTTTGTTGGCATTTGTTCTATGG - Intergenic
1140585262 16:76283297-76283319 TTAGGTTGCCAATTAGTCCCAGG + Intronic
1141677830 16:85526834-85526856 AAAGGTCACCATTTGTTCCAGGG + Intergenic
1145728377 17:27154391-27154413 TTTGGCTGCCAGGTGTTCCAAGG - Intergenic
1156634097 18:39006951-39006973 TTAGATTGGAGTTTGTTCCATGG - Intergenic
1156657643 18:39308011-39308033 TAAGGTGGCCATTTTTTACAAGG + Intergenic
1156682217 18:39604735-39604757 TTAATTTGCCATTTGGTTCAAGG + Intergenic
1158881553 18:61783886-61783908 TTAGGCTACCATTTCATCCATGG - Intergenic
1159036666 18:63284769-63284791 TTTGGTTGCAATGTATTCCAGGG + Intronic
1160791057 19:923939-923961 TTAGGCTGCCCTTTGTTCAAAGG - Intergenic
1162608053 19:11726869-11726891 TTTGGTTGCAACTTGTTACATGG + Intronic
1164703888 19:30305092-30305114 TTTGCTTTCCATTAGTTCCAGGG + Intronic
1165016293 19:32882653-32882675 TTAGGTTACCAGTTGATGCAGGG - Intronic
928715243 2:34052793-34052815 TTGTGTTTCCATTTGTTTCAAGG + Intergenic
929737890 2:44569918-44569940 TTAAGTTGCCATTTGGATCAAGG + Intronic
929979578 2:46666043-46666065 TCAGGTTGCCATTTTTTGTAAGG + Intergenic
930105265 2:47634256-47634278 TTAGGTTGCTAGTTGATCCTGGG - Intergenic
936000478 2:108823544-108823566 TTAGGTAGCCTGTTGTTCCTAGG + Intronic
939970659 2:148655727-148655749 TGAGATTGCCATTTGGGCCATGG - Intronic
940670037 2:156656368-156656390 TTAAGTTGTAATTTGTTCTAAGG - Intergenic
941494326 2:166181466-166181488 TTAGGTTGCTATGAGATCCAGGG + Intergenic
943040052 2:182793710-182793732 TTAGGTTGCAATTTATTACATGG + Exonic
943761553 2:191615026-191615048 TTAGGTTGCAGTTTGTTATATGG + Intergenic
944481717 2:200164179-200164201 TTTGGTTGCCTTCTGTTCCTTGG - Intergenic
946567427 2:220982338-220982360 TTAGATTGACATTTGTTTTATGG + Intergenic
1175748745 20:61480370-61480392 TTGGGTTTCCCGTTGTTCCAAGG + Intronic
1178164033 21:29951121-29951143 TTAGGTGGATATTTATTCCAGGG + Intergenic
1180227736 21:46406038-46406060 TTAGGTTTCCAGTTATTTCAAGG + Intronic
1184194528 22:42917945-42917967 TAATGGTGCCATTTGTTGCACGG + Intronic
949258088 3:2073917-2073939 TCAGTTTGCCCTTAGTTCCAAGG - Intergenic
950050882 3:9988262-9988284 TGAGGTTGTCATTTACTCCAGGG + Intronic
950057971 3:10043382-10043404 TGAGGTTGTCATTTGCTCCAGGG + Intronic
950299149 3:11860022-11860044 TGAGGTTGTCATTTGCTCCAGGG + Intergenic
951014382 3:17714038-17714060 TAAGGCCGCCATTTGTACCAGGG - Intronic
956138639 3:66123846-66123868 TTAGGTCACCTTTTGTTACAGGG + Intergenic
957099816 3:75812893-75812915 TTAGGTTTCCTTTTGTTCTCTGG - Intergenic
957833655 3:85555704-85555726 TTAGGTTGCCATTTGTTCCAAGG + Intronic
961438360 3:126935075-126935097 CTATCTTGCCATTCGTTCCAGGG + Intronic
962632124 3:137288869-137288891 TTATTTTTCCATTTGTTCCAAGG + Intergenic
965862515 3:173163834-173163856 TTAGGTTGCCATTTCTTTTCAGG + Intergenic
968718911 4:2184594-2184616 TTAGGTTGACTTTTGTTACCAGG - Intronic
969140699 4:5069020-5069042 TTAGTTTGCAACTTGTTCCATGG + Intronic
970359008 4:15288547-15288569 GTAGGTATCCATTTGTTCCCTGG - Intergenic
977835462 4:101640425-101640447 TTATGTTGCCATTTTGGCCACGG + Intronic
982238774 4:153277694-153277716 TCAGGATGCTATTTCTTCCAGGG - Intronic
982274204 4:153622848-153622870 TGAGGTTGACAGTTGTTTCAGGG + Intronic
983676679 4:170302755-170302777 TTACTTTGCCATTTATTTCAAGG + Intergenic
984374940 4:178917834-178917856 TTAGGTTGAAATTTGATCCCGGG + Intergenic
985768400 5:1794145-1794167 CTTGGTTACCATTTGTTGCAGGG + Intergenic
986010154 5:3706791-3706813 TCAGTTTGCGATTGGTTCCAGGG + Intergenic
987205765 5:15623453-15623475 TTATGGTGATATTTGTTCCATGG + Intronic
988664879 5:33315533-33315555 TTAGGTTGCCATTTTTCACTGGG - Intergenic
993042299 5:82828205-82828227 GAAAGTTGCCATATGTTCCATGG - Intergenic
993862524 5:93153507-93153529 TCAGCTTGTCAGTTGTTCCATGG - Intergenic
994996798 5:107074187-107074209 TTTGGATGGAATTTGTTCCATGG + Intergenic
1002110711 5:176909093-176909115 TTAAGTTGACATTTTTACCAGGG + Intronic
1003750041 6:9044809-9044831 TTAGGGTGTCATTTGTTGCAAGG + Intergenic
1005777033 6:29145240-29145262 TTAGGTTTTCAATTGTTACAGGG + Intergenic
1006498158 6:34439029-34439051 TTGGGTTGCCTTGTGTGCCATGG + Intergenic
1008169289 6:48182752-48182774 TATGGTTGATATTTGTTCCATGG + Intergenic
1008469813 6:51871976-51871998 TTAGGCTTCTATTTGTTTCATGG - Intronic
1012909344 6:105101826-105101848 TTAGGATGCCATTTAATCAAAGG + Intronic
1015185834 6:130414496-130414518 TTAGGTTCCCTCTTCTTCCAGGG - Intronic
1019406311 7:885941-885963 TTAGGATGCCACCTGTTCCTGGG + Intronic
1019794353 7:3038830-3038852 TTGGGTTGTGATTTGTTCAAGGG - Intronic
1021457645 7:20846961-20846983 TTAGCTTGCCATTTGTTGGCTGG + Intergenic
1022371017 7:29771413-29771435 TTAGGTTGCATTTTTTACCAAGG - Intergenic
1022749906 7:33213734-33213756 GTAGGTTGCCTTTTGGTCCAGGG + Intronic
1024446510 7:49485543-49485565 TTTGTTTGCCATTTGTTACATGG + Intergenic
1027705555 7:81528735-81528757 TTAATTTGCAATTGGTTCCAGGG + Intergenic
1028694081 7:93688231-93688253 TTAGGATGCAAATTGTTCAAAGG + Intronic
1028781036 7:94736724-94736746 TTAGGTTGAAGTTTGGTCCAAGG + Intergenic
1028929117 7:96393167-96393189 TGAGGTTGCCCTTTTCTCCATGG + Intergenic
1031344281 7:120645810-120645832 TTAGGATGCCATTTGTCACATGG - Intronic
1031371244 7:120969513-120969535 TTATTTTGCCATGTGTTTCAAGG + Intronic
1032846078 7:135753112-135753134 TCAGGTTGCCATATGTTAAATGG - Intergenic
1033302789 7:140201345-140201367 TTTGGTTGTCATTTTCTCCAGGG - Intergenic
1036919365 8:12836578-12836600 TTAGGCTGCCTTTTGTTAAAAGG + Intergenic
1038969584 8:32618046-32618068 TTAGTTTCCTATGTGTTCCAAGG + Intronic
1042037687 8:64554300-64554322 TTGGGACCCCATTTGTTCCAGGG + Intergenic
1042497955 8:69476689-69476711 TTAGGCTGGCGTTTCTTCCAGGG - Intronic
1042759646 8:72257116-72257138 TTAGGCTGCCGTTTTTTCCCTGG + Intergenic
1046327248 8:112665032-112665054 TTAGGTTGCCATTTCTTATGCGG - Intronic
1046515343 8:115252445-115252467 TTAGGTTGTCATTTGTGGCAGGG - Intergenic
1046651628 8:116842163-116842185 TTAGTTACCCATTTCTTCCAGGG - Intronic
1046970941 8:120222886-120222908 TCAGGTTGCCATTGGTGCCAAGG + Intronic
1051781736 9:20696222-20696244 TTAGGTCTCCATTTGGTCAAAGG - Intronic
1052015267 9:23456488-23456510 ATAGATTGCCAATTGTTCCTTGG - Intergenic
1052102560 9:24467031-24467053 TGAGGTTGTCAATTTTTCCAAGG + Intergenic
1059999986 9:119949845-119949867 TTAGCTTGCCTTCTGGTCCAAGG - Intergenic
1194707942 X:97198934-97198956 TTAGGTTGACATGTGAGCCATGG + Intronic
1198138082 X:133774504-133774526 TTGGGTTGACATTGCTTCCACGG - Intronic
1201365975 Y:13206435-13206457 TTATGTAGCCATTTGTGCCTGGG + Intergenic