ID: 957837134

View in Genome Browser
Species Human (GRCh38)
Location 3:85609515-85609537
Sequence ACTAGCACAGTGATAGGTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 153}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957837129_957837134 29 Left 957837129 3:85609463-85609485 CCGTTATTTCTTCTTGTGGTGTT 0: 1
1: 0
2: 1
3: 51
4: 600
Right 957837134 3:85609515-85609537 ACTAGCACAGTGATAGGTACAGG 0: 1
1: 0
2: 1
3: 7
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957837134 Original CRISPR ACTAGCACAGTGATAGGTAC AGG Intronic
902791655 1:18772886-18772908 ATTAGCACTGTGTTAGGTTCTGG - Intergenic
904312502 1:29638058-29638080 AATAACACAGTCATAGGTTCTGG + Intergenic
904921436 1:34011191-34011213 ACTAGCACAGTGCCAGGCAGTGG - Intronic
905151136 1:35929054-35929076 ACTGGCACTGTTCTAGGTACTGG + Exonic
906554485 1:46697599-46697621 CCAAGCACAGTGGTAGGCACTGG + Intronic
908550714 1:65206222-65206244 CCAAGCACTGTTATAGGTACTGG - Intronic
910132511 1:83925396-83925418 ACTACCACTGCAATAGGTACTGG - Intronic
911046499 1:93633218-93633240 TCTGGCACAATGCTAGGTACTGG + Intronic
913110874 1:115656069-115656091 ACTAGCACTGCGCCAGGTACTGG - Intronic
913441449 1:118902412-118902434 TCTAGCACAGTGCTGGTTACAGG + Intronic
914046611 1:144098861-144098883 CCTGGCACAGTTATTGGTACTGG + Intergenic
914131499 1:144861825-144861847 CCTGGCACAGTTATTGGTACTGG - Intergenic
914217200 1:145642891-145642913 ACTAGTACAGTGGTAGCTGCTGG - Intronic
914469770 1:147965571-147965593 ACTAGTACAGTGGTAGCTGCTGG - Intronic
915719740 1:157976008-157976030 CCTTGCACTGTGCTAGGTACAGG + Intergenic
917784248 1:178435609-178435631 TCTAGCAATGTGATAGGTAATGG - Intronic
1062913491 10:1230001-1230023 ACCAGCACAGTGCTTGGTCCTGG - Intronic
1063655986 10:7989180-7989202 ACAGGCACAGTGATTGGTTCAGG - Intronic
1068310375 10:55266703-55266725 AAAAGCACACTGACAGGTACTGG + Intronic
1075301857 10:121331827-121331849 ACAACCACAGTGAGAAGTACAGG + Intergenic
1075822422 10:125326276-125326298 CCAAGCACTATGATAGGTACCGG - Intergenic
1081678353 11:44984389-44984411 TCTAGCACAGTTCTAGGTACTGG + Intergenic
1083611776 11:64007789-64007811 ACTGGCACAGGGACAGGTGCGGG + Intronic
1086134465 11:83432543-83432565 CCAAGCACTGTGGTAGGTACTGG - Intergenic
1087597430 11:100272215-100272237 CCTAGAACAGTGTTTGGTACTGG + Intronic
1088263470 11:107967349-107967371 AGTGGCACAGTGATAGGTCGTGG + Intergenic
1089013860 11:115151057-115151079 CCTAGTACAGTGATAGCTTCTGG + Intergenic
1089685856 11:120146442-120146464 TCTAGCACAGTGCCTGGTACAGG - Intronic
1091074577 11:132603298-132603320 ACAAGCACAGGAGTAGGTACTGG - Intronic
1091742484 12:2969771-2969793 ACAAGCACGGTGTTAGGAACAGG + Intronic
1093625276 12:21339186-21339208 CCAAGCACAGTAGTAGGTACTGG + Intronic
1096555687 12:52402207-52402229 ACTAGGACAGTGCCTGGTACAGG + Intronic
1098494235 12:71116480-71116502 CCAAGCACAGCAATAGGTACTGG + Intronic
1099211610 12:79797570-79797592 GCAAGCACAACGATAGGTACTGG + Intronic
1099487246 12:83243666-83243688 GCTGGCACAGTAATAGGTCCCGG + Intergenic
1101591110 12:106126281-106126303 AATAGCACTGTGCTAGGCACTGG - Intronic
1102222907 12:111206623-111206645 TCAGGCACAGTGCTAGGTACTGG - Intronic
1103961419 12:124611395-124611417 ACTTGCACAGCGCTTGGTACAGG - Intergenic
1104519066 12:129456259-129456281 ATGAGCACAGTGCCAGGTACAGG + Intronic
1105398020 13:20059473-20059495 ACAGGCACAGGGATAGGCACTGG - Exonic
1107268915 13:38591363-38591385 ACTAGCACAGTGATAGTGTGGGG + Intergenic
1107377261 13:39817534-39817556 ACTTTTACAGTGATAGCTACTGG + Intergenic
1107411516 13:40162612-40162634 ATTAGGACAGAGATGGGTACAGG + Intergenic
1112105883 13:96238746-96238768 ACAAGCACTGTGCTGGGTACTGG - Intronic
1115263738 14:31478965-31478987 CCTGGCACTGTGATAGGCACTGG - Intergenic
1118351858 14:64977836-64977858 ATTAGGACATTGATAGGCACAGG - Intronic
1119050255 14:71360416-71360438 ACTAGCTGTGTGATAGATACTGG - Intronic
1126420417 15:48466495-48466517 ACCAGGACGGTGATATGTACAGG + Intronic
1126859352 15:52869256-52869278 CCTGGCACAGCGCTAGGTACTGG + Intergenic
1129767116 15:78177432-78177454 ACTAGTATAGTGAGAGGTAAGGG - Intronic
1130746650 15:86661281-86661303 TCTAGCACAGCGTTTGGTACAGG - Intronic
1135322411 16:21506010-21506032 ACTAGCAAAGTGACAGGTGATGG + Intergenic
1137411950 16:48236089-48236111 AATAGCACAGGGCGAGGTACAGG - Intronic
1137705820 16:50535155-50535177 ACTCCCACAGTGATTGGTCCAGG + Intergenic
1139740490 16:69031288-69031310 CCAAGCACTGTGATAGGTATTGG - Intronic
1140032830 16:71352015-71352037 CCTAGCACCGTGATTGGCACAGG - Intergenic
1141428472 16:83958381-83958403 CCTAGCACAGTGCTGGGCACAGG - Intronic
1144863139 17:18318251-18318273 AGTAACACAGTGGTAGGAACTGG - Intronic
1145226177 17:21130046-21130068 ACTTCCACAGTGATAGGGATAGG + Intronic
1147508119 17:41040762-41040784 GCAAGCCCAGTTATAGGTACTGG + Exonic
1152088829 17:78236089-78236111 CCTAGCACCGTGATAGGAGCAGG + Intronic
1154041894 18:10864279-10864301 CCAAGCACAGTGCTAGGTCCAGG + Intronic
1155243696 18:23887125-23887147 TCTGGCACAGTGCTAAGTACTGG + Intronic
1155998412 18:32357516-32357538 TCTAGCACAGTGATGGGCACAGG + Intronic
1156850767 18:41723301-41723323 ATTAGCACTGTGCTAGGCACTGG - Intergenic
1157632738 18:49115365-49115387 CCTATCACAATGAAAGGTACTGG + Intronic
1157812820 18:50709807-50709829 ACTAACACAGTGCTGGGCACAGG + Intronic
1158546271 18:58400048-58400070 ACTAGCACAGTGTCACGTAGGGG - Intronic
1160056613 18:75488277-75488299 CCTCGCACAGTGATAGATCCTGG + Intergenic
1162639866 19:11999860-11999882 AAGAGCACACTGATAGGCACTGG + Intergenic
1165798676 19:38534534-38534556 CCTAGCCCCGTGCTAGGTACAGG + Intronic
1167567576 19:50266707-50266729 CCTAGAACACTGACAGGTACAGG - Intronic
1202686165 1_KI270712v1_random:52275-52297 CCTGGCACAGTTATTGGTACTGG + Intergenic
925333030 2:3073561-3073583 ACTAGCACAGTGTCTTGTACAGG - Intergenic
926781992 2:16481468-16481490 GCTATCACAGGGATATGTACAGG - Intergenic
926825478 2:16901679-16901701 AAGAGCACACTGATAGGCACTGG + Intergenic
926945658 2:18184981-18185003 ACTTGCACAGCCATAGGCACTGG - Intronic
929130925 2:38570305-38570327 ATAAGCACTGTGGTAGGTACTGG + Intronic
931931805 2:67146321-67146343 TGTAGCACAGTGATAGGCTCAGG - Intergenic
933027548 2:77279994-77280016 ACTAGCATGGTCATAGGTTCTGG - Intronic
934245557 2:90302545-90302567 CCTGGCACAGTTATTGGTACTGG - Intergenic
934263189 2:91494494-91494516 CCTGGCACAGTTATTGGTACTGG + Intergenic
939659405 2:144869620-144869642 CCTAGCACTGTGATATGTACAGG + Intergenic
939659648 2:144872299-144872321 CCTAGCACTGTGCTATGTACAGG - Intergenic
941341695 2:164313676-164313698 ACTGGCACAGTGCTGGGCACTGG - Intergenic
944196088 2:197054546-197054568 ACTAGCTGAGTGGTATGTACAGG - Intronic
944634638 2:201663364-201663386 ACTAGCCCTGTGAGAAGTACTGG + Intronic
947169079 2:227293045-227293067 GCCAGCACTGTGATAGGTGCTGG - Intronic
947553785 2:231069416-231069438 ATTAGCACACTGAAAGCTACAGG - Intronic
1172480800 20:35270256-35270278 CCTAGCACAGTGCTGGGTACAGG - Intronic
1178724593 21:35039779-35039801 ATTAGCACTGTGAAAGGTGCAGG - Intronic
949829812 3:8201782-8201804 ATTTGTACAGTGATAGGTATAGG + Intergenic
952038110 3:29228533-29228555 ACTAACACAGTGATATGTCATGG + Intergenic
952198405 3:31099917-31099939 AGGAGCACAGTCATAGGTCCTGG + Intergenic
952943499 3:38460419-38460441 ACTAAGGCAGTGGTAGGTACTGG + Intronic
957837134 3:85609515-85609537 ACTAGCACAGTGATAGGTACAGG + Intronic
958131117 3:89425038-89425060 ACTGGCACAGTGGTAGGTGTTGG + Intronic
959297471 3:104555341-104555363 AGTAGCACAGTGATAGGAGAAGG - Intergenic
960645283 3:119873600-119873622 ACTATCACAGTGGTAGGGAAAGG + Intronic
960671818 3:120161723-120161745 CCAGGCACAGTGCTAGGTACTGG + Intergenic
962611651 3:137082463-137082485 ACCTGCACTGTGATAGGCACTGG + Intergenic
964054851 3:152441450-152441472 GCTAGTAAAGTGATAGGAACTGG + Intronic
964426927 3:156563387-156563409 CCTAGCACCGTGACTGGTACAGG + Intergenic
966770374 3:183498722-183498744 TCAGGCACAGTGCTAGGTACAGG + Intronic
967787699 3:193515120-193515142 CCTAGCACAGTGCTTGGCACAGG - Intronic
968601438 4:1511797-1511819 ACGACCACAGTGATTGGTCCAGG + Intergenic
971242122 4:24898625-24898647 TCTAGCACAATGCTAGGCACAGG - Intronic
972571479 4:40314313-40314335 ACCAGGACAGTGATAGGAAAAGG + Intergenic
973681275 4:53323055-53323077 CCTACCAAAGTGATAGATACTGG - Intronic
974071320 4:57126837-57126859 ACTAATACAGTAATTGGTACTGG + Intergenic
975549828 4:75601288-75601310 TCTAGCATAGTGATAAGCACAGG - Intronic
977532180 4:98213096-98213118 AAAAGAACAGTGATAGGAACTGG + Intergenic
981506746 4:145509316-145509338 CCTAGCACAGTGCTAGACACAGG - Intronic
981605478 4:146535995-146536017 AGTAGCATATTCATAGGTACTGG + Intergenic
982126742 4:152190185-152190207 ACTATCACTGTGATAATTACTGG - Intergenic
982876288 4:160654938-160654960 ACTTGCCCATTTATAGGTACTGG + Intergenic
984906678 4:184634054-184634076 ACCACCACTCTGATAGGTACTGG + Intronic
992921164 5:81522801-81522823 AGTAGCACAGTGAATGATACTGG - Intronic
993343678 5:86755976-86755998 ATTAGCAAGGTGATAGTTACAGG + Intergenic
994753947 5:103771938-103771960 ACTAACCCAGGGATAGGTGCAGG + Intergenic
995020691 5:107364185-107364207 ACAAGCACAGTGATTGGCTCAGG - Intergenic
995641321 5:114260583-114260605 ATTTGCACTGTGCTAGGTACAGG - Intergenic
996918515 5:128738465-128738487 CCAAGCACTGTGATAGGCACTGG - Intronic
998891128 5:146747045-146747067 ACAAGCACTGTTGTAGGTACTGG - Intronic
1000628995 5:163570497-163570519 AATAGGACTGTGGTAGGTACTGG + Intergenic
1005382671 6:25252881-25252903 CCTAGCCCAGTGCTTGGTACAGG + Intergenic
1007016562 6:38473656-38473678 ACAAAGACAGTGATAGGTACTGG + Intronic
1008552938 6:52650494-52650516 CCTAGCACAGTGCCTGGTACAGG - Intergenic
1011049265 6:83126435-83126457 ACTAGCATAGTGATAGCAGCAGG - Intronic
1012956302 6:105574128-105574150 GCCAGCACAGAGCTAGGTACTGG - Intergenic
1018287707 6:162258285-162258307 CCAAGCACAGTGCCAGGTACTGG - Intronic
1022346219 7:29517018-29517040 GCTAGCACAGTGCTGGGTAAGGG - Intergenic
1022887417 7:34661030-34661052 ACTAACATAGTGGTAGGTCCTGG - Intronic
1029014267 7:97298396-97298418 ATTAGCACAGTGATAGGTGCTGG + Intergenic
1030470956 7:109961853-109961875 AGTAGCACAGTGACAGATAAAGG + Intergenic
1030664379 7:112258534-112258556 AGTAGCACAGTGCTAGGAACAGG - Intronic
1031822019 7:126514074-126514096 TCAAGCACAGTGCTGGGTACAGG + Intronic
1033417093 7:141171791-141171813 GCTAGCACAGTGTTAGGCACTGG - Intronic
1033444523 7:141408706-141408728 ACTAGAATAGAGATAGGTATGGG + Intronic
1033993073 7:147311865-147311887 ACCATCACAGTTATAGGCACGGG - Intronic
1034081258 7:148279679-148279701 ACTAGGACATTGATCGTTACTGG + Intronic
1042035992 8:64534283-64534305 ACAAGAACAGGGATAGATACAGG + Intergenic
1043355611 8:79408787-79408809 ACTATTCAAGTGATAGGTACAGG - Intergenic
1045018268 8:98018391-98018413 ACTCGCACAGTGCTAGTCACTGG + Intronic
1045554182 8:103199480-103199502 AACAGCACAGTGCTAGGCACAGG + Intronic
1048300146 8:133245359-133245381 ATAGCCACAGTGATAGGTACTGG - Intronic
1048567857 8:135622189-135622211 TCTAGCACTGTGGTAGGCACTGG - Intronic
1053578805 9:39381690-39381712 CCTGGCACTGTGATAGGAACTGG - Intergenic
1054100388 9:60940494-60940516 CCTGGCACTGTGATAGGAACTGG - Intergenic
1054121787 9:61216119-61216141 CCTGGCACTGTGATAGGAACCGG - Intergenic
1054585957 9:66966392-66966414 CCTGGCACTGTGATAGGAACTGG + Intergenic
1061493569 9:130959378-130959400 GCTGGCAGAGTGATAGGTAGGGG - Intergenic
1187225627 X:17373525-17373547 AATAGGACAGTGCTAGGTAAGGG + Intergenic
1187494719 X:19785069-19785091 CCAAGCACAGTGCCAGGTACTGG + Intronic
1190397082 X:49996038-49996060 ACTAACACAGAGATAGATAATGG - Intronic
1190916561 X:54815519-54815541 ACTGGCACTGTTATTGGTACTGG - Exonic
1191884465 X:65874433-65874455 AACAGCACAGTGACAGGGACAGG + Intergenic
1194787765 X:98107261-98107283 AGTATCACAGTGATAGGAAGAGG - Intergenic
1198377075 X:136050787-136050809 CCAAGCACTGTGGTAGGTACTGG + Intergenic
1198505068 X:137293450-137293472 AGGAGCACAGTGACAGGTGCAGG + Intergenic
1198700783 X:139396155-139396177 TCTAGCACAGTGCCAGGCACAGG - Intergenic
1202587514 Y:26447375-26447397 CCTGGCACAGTTATTGGTACTGG - Intergenic