ID: 957837347

View in Genome Browser
Species Human (GRCh38)
Location 3:85613826-85613848
Sequence CTCTGAAGTCTGACAGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 447
Summary {0: 1, 1: 0, 2: 1, 3: 43, 4: 402}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957837347 Original CRISPR CTCTGAAGTCTGACAGGCCA GGG Intronic
901174357 1:7287931-7287953 CTCTGTAGTTAGACTGGCCATGG - Intronic
903060602 1:20666129-20666151 TTTTGAAGTCAGACAGGCCTGGG - Intronic
903461995 1:23526718-23526740 CTTTGCAGTCAGACAGGCCTGGG - Intronic
903463422 1:23535002-23535024 ATCTGAAGTCAGACATCCCAGGG + Intergenic
903577499 1:24347802-24347824 GGCTGCTGTCTGACAGGCCAGGG + Intronic
903687449 1:25142357-25142379 CTCTGCAATCAGACAGGCCTGGG - Intergenic
904384990 1:30135228-30135250 GGCTGGAGTCTGACAGGCCAGGG - Intergenic
904417184 1:30370410-30370432 CTCAGAACTTTGAGAGGCCAAGG + Intergenic
904615801 1:31748959-31748981 CTCTGGAGTCAGGCAGGCCTGGG - Intronic
904793345 1:33040246-33040268 CTCTGAAGTCAGAAAAGGCAAGG + Intronic
905951431 1:41954701-41954723 CTTGGAAGTCAGTCAGGCCAGGG + Intronic
906279651 1:44544314-44544336 CTCTGGAGTCAGACAGACCTGGG + Intronic
907170940 1:52463995-52464017 CTCTGGAGTCAGACAGACCTGGG + Intronic
907243760 1:53094513-53094535 CTCTGGTGTCCCACAGGCCAGGG - Intronic
907720375 1:56966518-56966540 GTTTGGAGTCAGACAGGCCAAGG + Intergenic
908392361 1:63695335-63695357 CTCTGGAGTTAGAGAGGCCAGGG + Intergenic
908756382 1:67472654-67472676 TTCTGAAGTCTGATAGCCTAGGG + Intergenic
909288216 1:73848042-73848064 GTCTGAATCCTAACAGGCCAGGG + Intergenic
909644652 1:77903713-77903735 CTGGGAAGACTGACAAGCCATGG + Intronic
910057181 1:83046834-83046856 TTCTGGAGTCTGAAAGACCAAGG - Intergenic
910516922 1:88072393-88072415 CTCTGGAGTCAGACAGACCTGGG + Intergenic
911166495 1:94729312-94729334 GTAGGATGTCTGACAGGCCATGG - Intergenic
911182166 1:94870929-94870951 CTCTGCAGTTTGGGAGGCCAAGG - Intronic
911327471 1:96485193-96485215 CTCTGCAGTCAGACAGTCCAGGG + Intergenic
912155289 1:106910872-106910894 CTCTGAAGTGGGTCAGCCCAAGG + Intergenic
912470938 1:109906370-109906392 CTCTGAAGTCACACAGGGCCAGG + Intergenic
913700799 1:121372625-121372647 CTTTGGAGTCTGACAGACCTGGG + Intronic
914041348 1:144053087-144053109 CTTTGGAGTCTGACAGACCTGGG + Intergenic
914136736 1:144907399-144907421 CTTTGGAGTCTGACAGACCTGGG - Intronic
915076394 1:153311453-153311475 CTCTGGAGTCAGACAGACCTGGG - Intergenic
915443148 1:155959065-155959087 CACTGAAGCCTGACATCCCAGGG - Intronic
915513843 1:156401397-156401419 CCGTAAAGTCGGACAGGCCAGGG + Intergenic
915809766 1:158894645-158894667 CACAGAAGTCTTGCAGGCCAGGG + Intergenic
916547363 1:165818202-165818224 CTCTGCAGTTTGTCAGGGCAAGG - Intronic
917117685 1:171618824-171618846 CTCCGAACTTTGAGAGGCCAAGG - Intergenic
919816925 1:201447271-201447293 CTCTTGAGCCTGACAGGTCAAGG + Intergenic
919955600 1:202411808-202411830 CTTTGGAGTCAGACAGACCAGGG - Intronic
920488218 1:206391358-206391380 CTTTGGAGTCTGACAGACCTGGG + Intronic
921020850 1:211234481-211234503 CTCTGAAGTGTGGCTGGGCACGG + Intergenic
921931394 1:220757150-220757172 CCCAGAAGTCTGGGAGGCCAAGG - Intronic
921937813 1:220810832-220810854 CTCTGAAGTCAGCCAGGCCTGGG + Intronic
922246352 1:223802177-223802199 CTCTGAAGCCTGAATGACCAAGG + Exonic
922492242 1:226027352-226027374 CTCTTCAGTCTGAGAGGCCAAGG - Intergenic
922727549 1:227929934-227929956 CTCTGGAGGCTGGAAGGCCAAGG - Intronic
923254139 1:232205432-232205454 CCCAGCAGTCTGAGAGGCCAAGG - Intergenic
1063116406 10:3074911-3074933 CTCTGAAGGCTGTGAGACCACGG - Intronic
1064225083 10:13475810-13475832 CTTTGGAGTCAGACAGGCCTTGG + Intronic
1065688999 10:28314266-28314288 CTGTGAACTCTGAGAGGCTATGG - Intronic
1066064798 10:31754308-31754330 TTGTGAAGTCTGATAGGCCCTGG + Intergenic
1067140918 10:43655809-43655831 CTCAGTACTCTGACAGGCCAGGG + Intergenic
1067458707 10:46441487-46441509 CTCAGAAGTCTGACGGTCCTTGG - Intergenic
1067628487 10:47943149-47943171 CTCAGAAGTCTGACGGTCCTTGG + Intergenic
1069064947 10:63932607-63932629 CTCTGAAGTCTTTCAGACAAGGG + Intergenic
1070794688 10:79209852-79209874 CTCTGAAGACAGGCAGGCCTCGG - Intronic
1071691722 10:87827304-87827326 ACCTGACGTGTGACAGGCCACGG - Intronic
1073181142 10:101584146-101584168 CTCTGAAGCCTAACAGACCAGGG - Intronic
1075052452 10:119192808-119192830 CTCTGCACTTTGAGAGGCCAAGG - Intergenic
1075214664 10:120521650-120521672 CTCTGAAGTCTAACAAACCCTGG + Intronic
1075563059 10:123482384-123482406 TTCTGGAGTCTGACAGGCCTGGG + Intergenic
1075676466 10:124299271-124299293 CTCTGGGGTCAGACAGGCTAGGG + Intergenic
1076035844 10:127197438-127197460 CTCTGATGCCTGTCAGGCCCTGG + Intronic
1076454472 10:130580157-130580179 CTTTGAAGTCAGACAGCCCAGGG + Intergenic
1077522346 11:3043765-3043787 CGCTGATGACTAACAGGCCAAGG + Intronic
1078584259 11:12567513-12567535 CTGTGAAGGCTGAGAGGCAAGGG - Intergenic
1079160153 11:17984751-17984773 CTTTGAAGTCAGATAGACCAAGG - Intronic
1079196660 11:18333989-18334011 CCCAGAAGTTTGAGAGGCCAAGG + Intronic
1080704688 11:34679408-34679430 CTTTAAAGTCAGACAGCCCAAGG - Intergenic
1081547587 11:44082831-44082853 CTCTGTAGTCCCACAGACCAAGG - Intronic
1082809806 11:57472855-57472877 CTCTGGAGTCAGACAGACCTGGG - Intronic
1082818663 11:57528617-57528639 CTGTGAAGACTGCCAGGCCTAGG - Exonic
1083226912 11:61291023-61291045 CTCTGAAGGCAAACAGGCCTGGG + Intronic
1083374838 11:62211172-62211194 CTCAGAACTCTGGGAGGCCAAGG - Intronic
1083384383 11:62296774-62296796 CTCTGAAGCCAGGCAGGGCAGGG + Intronic
1084367790 11:68714296-68714318 CACTGAAGTGTGACAGGCAGTGG + Intronic
1084503890 11:69553422-69553444 CCCTTAAGTCTGACATGCCCTGG + Intergenic
1086370240 11:86149149-86149171 CTCTTAAGCCTGAAAGGTCAAGG - Intergenic
1086371427 11:86159180-86159202 CTTTGGAGTCTGATAGGCCTGGG + Intergenic
1087049570 11:93871816-93871838 CTTTGAAGTCAGACAGACCCAGG - Intergenic
1087057758 11:93950273-93950295 CTCTGAAGTCCCACAGACCCAGG + Intergenic
1087136789 11:94729194-94729216 CTTTGAAGTCAGACAGACCTGGG + Intronic
1088860756 11:113797023-113797045 CTATGAAGTCAGACACACCAAGG + Intergenic
1090400925 11:126447706-126447728 CTCTGAGGCCTGCCTGGCCACGG - Intronic
1090924662 11:131238984-131239006 CTCTGAAGTCAGCCAGGCTGGGG - Intergenic
1093247170 12:16754040-16754062 CTCTGGAGTCAGACAGCCCTGGG - Intergenic
1093820947 12:23616867-23616889 CCCAGAACTCTGAGAGGCCAAGG + Intronic
1094546484 12:31409070-31409092 CTCTAAAGCCTGACAGCCAAGGG + Intronic
1096069856 12:48768854-48768876 CTCTGCAGTCTGCTAGGACAGGG - Intronic
1096466608 12:51850170-51850192 CTCTGGGGTCTGACAGGTCTGGG + Intergenic
1099427020 12:82535910-82535932 CTTTGAAGTTAGACAGACCAGGG + Intergenic
1100166782 12:91924967-91924989 CTTCGAAGTCTGAAAGGGCAAGG - Intergenic
1100463334 12:94822478-94822500 CCCTGAACTTTGAGAGGCCAAGG + Intergenic
1100568541 12:95823193-95823215 CTCTGAAGTCAGACAGACCTGGG + Exonic
1100634224 12:96419659-96419681 CTCAGAACTCTGGGAGGCCAAGG + Intergenic
1100973276 12:100094447-100094469 CTCTGAGGTCCTTCAGGCCAGGG + Intronic
1100974892 12:100112226-100112248 CTCAGCAGTTTGAGAGGCCAAGG + Intronic
1101523249 12:105504277-105504299 CTCTGAAGTCAGACACACCATGG + Intergenic
1101616464 12:106342752-106342774 CTCTGGAGTCAGACAGGCTGGGG - Intronic
1101820916 12:108183790-108183812 GTCTGGAGTCAGACAGGCCTGGG + Intronic
1101988098 12:109462924-109462946 CTCAGAAGGCTGACAAGGCAGGG + Intronic
1101999103 12:109545592-109545614 CTCTGGAGTGTGGCAGACCAGGG - Intergenic
1102557181 12:113734839-113734861 CACTGAAGTCTGAGAGGCACTGG - Intergenic
1102671238 12:114620832-114620854 CTCTTGAGTCTGGGAGGCCAAGG + Intergenic
1104405068 12:128510360-128510382 CCCTGAAGGCTGGCAGGCCAGGG + Intronic
1104509871 12:129367491-129367513 CTCTGAAGACTGGCGGGGCAGGG - Intronic
1106901795 13:34361371-34361393 CTCTGAGTTCTGACAGATCACGG - Intergenic
1107638632 13:42418538-42418560 CTCTGAAGTCAGACAGACCTGGG + Intergenic
1108311117 13:49192023-49192045 CTCTGGAGTCTGACAAACTAAGG - Intronic
1110210132 13:72962343-72962365 CTCTGGACTTTGAAAGGCCAAGG + Intronic
1110282719 13:73714190-73714212 CCCAGAACTCTGAAAGGCCAAGG + Intronic
1112849316 13:103685170-103685192 CACTTTAGTCTGAGAGGCCATGG + Intergenic
1114029131 14:18560380-18560402 CCCAGAAGTTTGAGAGGCCAAGG + Intergenic
1115493995 14:33984709-33984731 CTCTGCACTCTGGGAGGCCAAGG + Intronic
1116835263 14:49764038-49764060 CTCTGCAGTTTGACAGGCAGTGG + Intergenic
1117927629 14:60800454-60800476 CTCTGAAGTCTAGGAGTCCAAGG + Intronic
1118857260 14:69633339-69633361 TTCTGAAATCTGTCAGGGCAAGG - Intronic
1119179813 14:72598163-72598185 CACTGAACCATGACAGGCCAGGG + Intergenic
1120511956 14:85426047-85426069 CTCTGAAGGCTCAGAGGCTAAGG + Intergenic
1121104599 14:91272115-91272137 CTCTGGGGTCTGCCAGGCCCTGG + Exonic
1122732863 14:103814431-103814453 CTTTGGAGTCACACAGGCCAGGG - Intronic
1123168438 14:106348573-106348595 TTCTGAAGTCTGAATGTCCAAGG + Intergenic
1123806121 15:23875472-23875494 ATCTGAAGTCTGAAAGAACAAGG - Intergenic
1125590199 15:40849683-40849705 CTGTGGAGTCTGACAGACCTTGG + Intronic
1126108646 15:45162982-45163004 CTCTGAATGCTGACAGCACATGG - Intronic
1127313458 15:57772633-57772655 CACTGAAGTTTGAGAAGCCACGG - Intronic
1128208508 15:65873838-65873860 CTCAGCACTCTGAGAGGCCAAGG - Intronic
1128666240 15:69540279-69540301 CACTGAAGTCTGAGAAGCCCTGG - Intergenic
1129407867 15:75330953-75330975 CTCTTACCTCTGACAGGCCACGG - Intergenic
1130414057 15:83673426-83673448 CCCTAGAGTGTGACAGGCCAAGG + Intronic
1131076544 15:89498955-89498977 CTTTGAAATCAGACAGCCCAGGG - Intergenic
1131397615 15:92098963-92098985 CTTTGAGGTCAGACAGGCCTGGG - Intronic
1133288172 16:4700825-4700847 CTGTGGAGCCTAACAGGCCATGG + Intronic
1133724056 16:8521074-8521096 TGCTGGTGTCTGACAGGCCAAGG - Intergenic
1133833303 16:9343891-9343913 CTCTGGAATCAGACAAGCCAAGG - Intergenic
1135884436 16:26292806-26292828 CTCTGAAATCTGGCAGTCCTGGG - Intergenic
1136160191 16:28414923-28414945 CTCTGAGGTCAGCGAGGCCAAGG + Intergenic
1136202897 16:28700367-28700389 CTCTGAGGTCAGCGAGGCCAAGG - Intronic
1136295078 16:29296985-29297007 CTCTGGAATCAGACAGGCCTGGG + Intergenic
1136687772 16:32005226-32005248 CTCTGGAGTCAGACAGTCCTGGG + Intergenic
1136788375 16:32948777-32948799 CTCTGGAGTCAGACAGTCCTGGG + Intergenic
1136881440 16:33905154-33905176 CTCTGGAGTCAGACAGTCCTGGG - Intergenic
1137562979 16:49514904-49514926 CTGTGAACTCTGACATGCCCTGG + Intronic
1137639913 16:50019891-50019913 CCCTGCAGTTTGAGAGGCCAAGG - Intergenic
1137764563 16:50967956-50967978 TTCTGAAGTTGGATAGGCCAGGG - Intergenic
1138223765 16:55275304-55275326 TTCTGAAGTCAGACAGGCCTGGG - Intergenic
1138885976 16:61079934-61079956 CTTTGGATTCTGACAGGCCCAGG - Intergenic
1139665400 16:68451618-68451640 CTCAGCAGTTTGACAGGCCAAGG + Intergenic
1139767892 16:69247604-69247626 CTCTGCAGTCAGACAGACCTTGG + Intronic
1140224748 16:73068224-73068246 CTTTAAAGCCTGACAGGCCCAGG - Intergenic
1140922357 16:79550982-79551004 CTCTGCTGTCTGTGAGGCCACGG - Intergenic
1141230423 16:82162253-82162275 CTCTGAAGTCAGGCAGACCTGGG - Intronic
1141920646 16:87133404-87133426 CTGTGGAGTCTGACAGACCCAGG - Intronic
1142100979 16:88270994-88271016 CTCTGGAATCAGACAGGCCTGGG + Intergenic
1203090574 16_KI270728v1_random:1210292-1210314 CTCTGGAGTCAGACAGTCCTGGG + Intergenic
1144822660 17:18086403-18086425 CTCAGAACTCTGGGAGGCCAAGG + Intergenic
1144823009 17:18088519-18088541 CTCTGGAGTCTGGAAGGCCTGGG + Intronic
1144995186 17:19263202-19263224 CTCTGAAGTCAGCCATGGCACGG - Intronic
1145305249 17:21670522-21670544 CTCTGAAGTCAGAAAGACCTGGG + Intergenic
1146619071 17:34382618-34382640 CTCTCAAGTCAGACATGCCTGGG - Intergenic
1147148757 17:38500897-38500919 CTCTGCAGTCAGACAGTCCTGGG + Intronic
1147572503 17:41580017-41580039 CTCTGGAGCCTGACAGCACAGGG + Intergenic
1147790430 17:43011146-43011168 CTCTGGAGTCAGACAGCCTAGGG + Intronic
1148732776 17:49847727-49847749 TTCGGAGGTCTGCCAGGCCAGGG + Intronic
1151082020 17:71340368-71340390 CTCAGAACTCTGGGAGGCCAAGG + Intergenic
1151221056 17:72613435-72613457 CTCTGAAGTCAGACGGGGCAAGG + Intergenic
1151696726 17:75721692-75721714 CCCTGAAGGCTGACAGGCCCCGG + Intronic
1152142642 17:78546653-78546675 CTCAGAACTTTGGCAGGCCAAGG + Intronic
1153756531 18:8288981-8289003 CTCTGAAGTCACCCTGGCCATGG - Intronic
1154059005 18:11041076-11041098 CTCTGAAAACGGACAGTCCAAGG + Intronic
1154289680 18:13096568-13096590 CTCTGAAGTCTTCCATACCAGGG - Intronic
1155449395 18:25947469-25947491 CTCTTGAGTCTGAGAGGTCAAGG + Intergenic
1155898655 18:31360973-31360995 CTTTGAAGTCTGATGGGACATGG - Intergenic
1157288550 18:46393826-46393848 CTCTGGAGTCTGACAGACCTGGG + Intronic
1157356512 18:46940157-46940179 CTCTGGAGTCATACAGGCCAGGG - Intronic
1157454796 18:47816606-47816628 CTCTGAAGTTGGACAGGCAGTGG - Exonic
1158527323 18:58226826-58226848 CTCTGGAGTCTGACACACCCTGG - Intronic
1158629054 18:59096226-59096248 CTCTGCAGACTGCAAGGCCAAGG + Intergenic
1159964986 18:74586667-74586689 CTCTGAACTCTGGCAATCCAGGG - Intronic
1160331844 18:78000548-78000570 CTTTTGACTCTGACAGGCCAGGG + Intergenic
1160334781 18:78029159-78029181 CTCTGGAGTCTGATGGGCCTGGG + Intergenic
1162031612 19:7919976-7919998 CTCTGGGGTCAGACAGGCCTGGG - Intergenic
1162074866 19:8179279-8179301 CTCAGTACTCTGAGAGGCCAAGG - Intronic
1162742591 19:12782104-12782126 CTCAGAATTTTGAGAGGCCAAGG - Intronic
1162864340 19:13532957-13532979 CTCAGAGATCTGAGAGGCCAAGG + Intronic
1162870817 19:13585400-13585422 CTCTGGATTCTGACAGACCTGGG + Intronic
1163137008 19:15319217-15319239 CTCAGAACTCTGGGAGGCCAAGG + Intronic
1166225297 19:41391415-41391437 CTCTGGAGTCAGACTGGCCTGGG + Intronic
1166878179 19:45910957-45910979 CTCTGAAGTATATAAGGCCAAGG - Intergenic
1167465437 19:49648507-49648529 CTCAGCAGTTTGAGAGGCCAAGG - Intronic
1167497355 19:49827437-49827459 CTCTGAAATCTTACAGGGGAAGG + Intronic
925049295 2:799325-799347 CTCTGAAGTATTCCGGGCCAGGG + Intergenic
925185869 2:1845991-1846013 GTCTGAATTCTGACAAGGCAGGG - Intronic
925346046 2:3172711-3172733 ATCTGGAGTCAGACAGGCCTGGG - Intergenic
925836019 2:7947709-7947731 CCCTGGAGTCACACAGGCCAGGG + Intergenic
926001234 2:9334428-9334450 ATCTGAAGCCAGAAAGGCCATGG - Intronic
927244914 2:20949751-20949773 GTCTGAAGTCGGCCAGGCCCAGG - Intergenic
927423130 2:22953741-22953763 CTCTGGAGTCAGAGAGACCATGG + Intergenic
927903019 2:26835862-26835884 CTCTTAAGTGTCACAGACCAAGG - Intergenic
929003609 2:37372716-37372738 CCCTGAAGTCTGGCACACCATGG + Exonic
930339775 2:50097887-50097909 CCCAGCAGTCTGAGAGGCCAAGG - Intronic
930387302 2:50713060-50713082 CTCAGCAGTTTGAAAGGCCAAGG + Intronic
930450075 2:51524835-51524857 TTCTGAAGTCCGACATGGCATGG + Intergenic
931034031 2:58216399-58216421 CACTGAAGTCTGAATAGCCAAGG + Intronic
932739153 2:74278571-74278593 CCCTGAAGTCTCAGAGGCCCTGG - Intronic
933568093 2:83976035-83976057 TTCTGAAGGCTGAAAGTCCAAGG - Intergenic
935627925 2:105186207-105186229 CTTTGGGGGCTGACAGGCCAGGG + Intergenic
936042128 2:109158149-109158171 TTTTGAAGTCTGACATGCCTGGG - Intronic
937235617 2:120430361-120430383 CTCTGGAGTCAGACAGACCAAGG - Intergenic
937649577 2:124305013-124305035 CTCAGCACTCTGAGAGGCCAAGG + Intronic
938597724 2:132805304-132805326 CTCTGCAGTCAGACTGTCCAGGG - Intronic
938982479 2:136539772-136539794 CTCTGGAGGCAGACAGGCCTGGG - Intergenic
941123096 2:161554156-161554178 CTCTTAAGTCTTTCAGGCTAAGG + Intronic
941380693 2:164788736-164788758 CTCAGCACTCTGGCAGGCCAAGG + Intronic
941864938 2:170324960-170324982 CTCTGAGGTGAGACAAGCCAGGG - Intronic
942530988 2:176910215-176910237 CTCTGAAGTCTGACATTCTCTGG + Intergenic
943382347 2:187167103-187167125 CTTTGAAGTCAGACAGACCTTGG - Intergenic
944126975 2:196305147-196305169 CTCTCAAGTCTGGGATGCCAGGG + Intronic
944304750 2:198166303-198166325 CTCTGGAGTCTGACTGCCCAAGG + Intronic
944726166 2:202473538-202473560 CTCAGCAGTTTGAGAGGCCAAGG + Intronic
945588489 2:211697019-211697041 CTTTGAAGTCAGACAGGCATTGG + Intronic
945917860 2:215723210-215723232 CTCAGAAGTCTCAGAAGCCAGGG - Intergenic
946010027 2:216557236-216557258 CTCTGAAGCCAGACAGTCCTGGG - Intronic
946140602 2:217687516-217687538 CTCCAGAGTCTGACATGCCAGGG + Intronic
946208673 2:218129608-218129630 CTTGGAAGGCTGCCAGGCCAAGG - Intronic
946318620 2:218934392-218934414 CTCTGCACTCTGGGAGGCCAAGG - Intergenic
946948637 2:224848694-224848716 CTTGGAAGTCTGCCAGGGCAAGG + Intronic
947042639 2:225941108-225941130 TTCTGGAGTCTCACAGGCCAAGG + Intergenic
947144430 2:227051678-227051700 CTCTGAAGTTTGAGAGGCACTGG + Intronic
948121887 2:235536899-235536921 CTCTGTAGTTGGACAGGCCATGG + Intronic
1168951823 20:1807598-1807620 CTCTGGAATCTGACAGTCGAGGG - Intergenic
1168962012 20:1876448-1876470 ATCTGGAGTCTGACAGGCCTGGG - Intergenic
1168970188 20:1925614-1925636 CTTTGAAGTCAGACAAACCAGGG + Intronic
1169870299 20:10241813-10241835 CTCTGCAGGCTGGCAGGCCCTGG - Intronic
1171219098 20:23378058-23378080 CCTTGAAGTCTGGGAGGCCAAGG + Intronic
1171398583 20:24857110-24857132 CTCTGAAGGCTCAGAGGTCACGG - Intergenic
1171522765 20:25787995-25788017 CTCTGAAGTCAGAAAGACCTGGG + Intronic
1171530508 20:25849964-25849986 CTCTGAAGTCAGAAAGACCTGGG + Intronic
1171554062 20:26067888-26067910 CTCTGAAGTCAGAAAGACCTGGG - Intergenic
1172227379 20:33314321-33314343 CTCTGCAGCCAGACAGGCCTGGG - Intergenic
1172450426 20:35018812-35018834 CTCTGCAGTCAGACAGCCCTGGG + Intronic
1172574259 20:35995161-35995183 CCCTGCTGTCAGACAGGCCAAGG - Intronic
1172780925 20:37436559-37436581 CTCTGAGCTCCCACAGGCCATGG - Intergenic
1173679560 20:44868304-44868326 CTCTGAAGTCAGACAGAACTGGG - Intergenic
1174241930 20:49143339-49143361 CTCTGCACTTTGAGAGGCCACGG + Intronic
1174420302 20:50395213-50395235 CTCTGGAGTCTGACAGGTGTGGG - Intergenic
1176001940 20:62836179-62836201 CTCTGCAGTCTGGCAGTCGAGGG + Exonic
1176246279 20:64098756-64098778 CTCAGAGGTCTTGCAGGCCAGGG - Exonic
1177416234 21:20796931-20796953 CCCTGACCTCTGACAGGCCCTGG - Intergenic
1179240123 21:39582474-39582496 CTCAGAAATCAGACAGGCCTGGG + Intronic
1180453248 22:15487443-15487465 CCCAGAAGTTTGAGAGGCCAAGG + Intergenic
1180915565 22:19484067-19484089 TCCTGAAGCCTGCCAGGCCAAGG + Intronic
1180981298 22:19879375-19879397 CTCTGAAGCCTGCCGGGCCGTGG - Intronic
1182086367 22:27563821-27563843 CTCTGGAGTCAGACAGGTCTGGG + Intergenic
1182988234 22:34741589-34741611 CTCTGCAGACAGACAGGCCTGGG - Intergenic
1183340600 22:37278653-37278675 ATCTGAAGTCAGACAGTTCAGGG + Intergenic
1183598979 22:38829068-38829090 CTTTGGAGTCAGACAGCCCAGGG + Intronic
1183967709 22:41452638-41452660 CTCAGCAGTTTGAGAGGCCAAGG + Intergenic
1184252599 22:43269225-43269247 CTCTGGACTCTGACAGGCCCTGG + Intronic
1184619622 22:45666381-45666403 CTCTGGAGTCAGACAGACCTGGG - Intergenic
1184689940 22:46112935-46112957 CTGAGAAGTCTGACAGGCCTAGG + Intronic
1185196417 22:49473348-49473370 GTCTGAGGCCTGACGGGCCAGGG + Intronic
949211433 3:1507626-1507648 CTTTGAAGTCAGACAGCCCTAGG + Intergenic
949877104 3:8633652-8633674 CTCTGCAGGGTGAGAGGCCAGGG - Exonic
949979009 3:9488296-9488318 CTCTAAACTTTGGCAGGCCAAGG + Intergenic
950187127 3:10952083-10952105 CTCTGGAGTCACACAGGCCTGGG + Intergenic
950221722 3:11201368-11201390 CTCCAAAGTCTGAAAGGGCACGG + Intronic
952499334 3:33945314-33945336 CTTTGAAGTCAGACAGACCTGGG - Intergenic
952651762 3:35736074-35736096 CTTTGAAGTCTTACTGACCAGGG + Intronic
953484050 3:43277847-43277869 CTCTTAAGTCTGGGAGGCCAAGG + Intergenic
954270409 3:49503579-49503601 CCCAGAAGTTTGAGAGGCCAAGG + Intronic
955397539 3:58567597-58567619 CTCTGCAGTCAAACAGGCCTGGG - Intronic
956783111 3:72620051-72620073 CTCTAGAAGCTGACAGGCCAGGG - Intergenic
956859327 3:73307028-73307050 CTCTGGAGTCTGAGAGGACTGGG - Intergenic
956932134 3:74055618-74055640 CTCTGACATCTGAATGGCCATGG + Intergenic
957837347 3:85613826-85613848 CTCTGAAGTCTGACAGGCCAGGG + Intronic
958653984 3:96977906-96977928 CCCAGAAGTTTGAGAGGCCAAGG + Intronic
959088875 3:101881091-101881113 ATCTGAAGTGTGAGAGGCCATGG + Intergenic
959904084 3:111691718-111691740 CACTGAGGTCTGACAGACCTGGG + Intronic
960320424 3:116228370-116228392 CTCTGAAATCTGACAGACTTAGG + Intronic
963610362 3:147459429-147459451 CTCTGAGGTGTCACAGACCAAGG + Intronic
963709089 3:148725796-148725818 CTTTGCAGTCTCACAGGTCAGGG - Intronic
964809378 3:160646947-160646969 CTCTGGAGTCAGACAGACCTGGG - Intergenic
966318202 3:178672380-178672402 TTCTGAAGTCTGAAAGACCTAGG - Intronic
967295311 3:187958585-187958607 CACTGAAGCCTGCCAGGACATGG - Intergenic
968155379 3:196376793-196376815 CTCAGAACTCTGGGAGGCCAAGG + Intronic
969538552 4:7771679-7771701 CTCTGGGGTCACACAGGCCAGGG - Intronic
969959633 4:10930676-10930698 CTTTGAAGTCTAATAGGCCTGGG + Intergenic
970371453 4:15411511-15411533 CTATGGAGTCTGACAGCCCATGG + Intronic
970539850 4:17066648-17066670 ATCTGAAGTCTAAATGGCCATGG + Intergenic
971172901 4:24251754-24251776 CTGTGGAGTCAGACAGGCCTGGG - Intergenic
972022023 4:34327125-34327147 CTGAGAAGTCTGAATGGCCAAGG - Intergenic
972171232 4:36348098-36348120 CCCAGAACTCTGAGAGGCCAAGG - Intergenic
972285233 4:37642011-37642033 CCCTGGAGTCAGACAGACCAGGG - Intronic
972457574 4:39269436-39269458 CCCTGAAGTCCACCAGGCCATGG - Intronic
973239649 4:47944027-47944049 TTCTGAAGTCAGACAGACCTAGG + Intronic
973942032 4:55920822-55920844 AGCTGAAGTCAGACAAGCCAGGG - Intergenic
974473866 4:62354943-62354965 CTCAGAGGCCTGACAGGCAAGGG + Intergenic
975006252 4:69290460-69290482 CTCTGAAGTCTGAAAAGTAATGG + Intronic
976609373 4:87013876-87013898 CTCTGCTGTCTGTAAGGCCAGGG + Intronic
977214106 4:94258430-94258452 GTCTAAAATCTGACAGGCCCAGG - Intronic
977601535 4:98938705-98938727 CTCAGCACTCTGGCAGGCCAAGG + Intergenic
978259187 4:106732619-106732641 CCCTGAAGACTGACTGGTCAGGG + Intergenic
980183347 4:129429983-129430005 CTCTGAAGACTCAAAGGGCATGG - Intergenic
980251740 4:130324517-130324539 CTCTGGAGTCTGGGAGGTCAAGG + Intergenic
982270610 4:153582604-153582626 CTCTGAAGACTGAAAGGTAAAGG - Intronic
984109776 4:175597683-175597705 CCCAGAACTCTGAGAGGCCAAGG - Intergenic
984432373 4:179665233-179665255 CTCTGAAGCCGGAAAGACCATGG - Intergenic
985810031 5:2075904-2075926 ATCTGAACACTGACAGGCAAAGG - Intergenic
985927718 5:3030725-3030747 CTCTGGAGGCTGGCAGGACACGG - Intergenic
986701105 5:10409508-10409530 CCCTGAAGTCAGAAAGGTCATGG + Intronic
987212372 5:15695792-15695814 CTCTGGATTCAGACAGGCCAGGG - Intronic
988406659 5:30832695-30832717 CCCTGAAGTCAGACAGACCTTGG + Intergenic
988959897 5:36359295-36359317 CTCTGAAGTCAGGCAGGACTGGG - Intergenic
989149298 5:38282926-38282948 CACTTGAGTCTGAGAGGCCAAGG - Intronic
989257553 5:39381608-39381630 GGCTGAAGACTGACAGGACAGGG + Exonic
990520980 5:56580620-56580642 CCTTGAAGTCTGACAGGGCATGG + Intronic
990610635 5:57453591-57453613 CTCTGGAGTCAGAAAGGCCCAGG - Intergenic
990694317 5:58398764-58398786 CTTTGAACTCTGACATGTCAAGG + Intergenic
990902820 5:60771538-60771560 CTCTGATGTCAGACAGACCTGGG + Intronic
991642679 5:68770420-68770442 GTCTGGAGTCAGACAGGCCTTGG - Intergenic
992202873 5:74401403-74401425 CTCTGAATTGGGAAAGGCCAGGG - Intergenic
992478057 5:77123137-77123159 TTCTGAAGGCTGAAAGTCCAAGG + Intergenic
993388711 5:87291445-87291467 CACTTAAGCCTGAGAGGCCAAGG + Intronic
994450022 5:99929815-99929837 CTCTGGAGTCTGTGAGGGCAAGG + Intergenic
995355791 5:111236522-111236544 TGCTGAAGTCTGACAAACCAGGG - Intronic
995492366 5:112706712-112706734 ATCTGAAGCCTGACTGACCATGG - Intergenic
995629329 5:114116283-114116305 CTCTGCAGTCAGAGAGGCAAAGG + Intergenic
996560033 5:124818843-124818865 CTCTGGAGTCTTACAGTCCTTGG - Intergenic
997757531 5:136413631-136413653 TTCTGAAGTCTGACAGCCAGGGG + Intergenic
997825440 5:137102664-137102686 CTCTTGAGTCAGACAGACCAGGG + Intronic
997842241 5:137252525-137252547 GGCTGAAGTATGACAGGGCAGGG - Intronic
997882216 5:137601381-137601403 CTCAGAAGTCAGACAGACCTGGG - Intergenic
998133499 5:139662750-139662772 CTCTGGAGTTGGACAGGCCTGGG + Intronic
999116460 5:149168410-149168432 CTCTGAAATCTGAAGGGACAGGG + Intronic
999190386 5:149742780-149742802 CTCTGAAGTCAGACAAACCTAGG - Intronic
999797662 5:155003382-155003404 CCCAGAATTCTGAGAGGCCAAGG - Intergenic
1000172702 5:158718691-158718713 CTCTGATGTCTAACAGGCCTGGG - Intronic
1000433998 5:161185532-161185554 CTCTGGAGTCCCACAGGGCAGGG - Intergenic
1001577773 5:172775344-172775366 CTCTCAAGTCAGACAGGCGCTGG - Intergenic
1001787563 5:174426759-174426781 TTCTAAAGTCAGACAGACCAAGG - Intergenic
1001931313 5:175675030-175675052 CTCTGGAGGCTGACAGACCTCGG + Intronic
1001951929 5:175822342-175822364 CTTTGATGTCTAACAGACCAGGG + Intronic
1005682431 6:28219648-28219670 CTCTTGAGTCTGACAGGCGGAGG + Intergenic
1005704318 6:28436234-28436256 CTCTGCAGTCTGAAGGGTCAAGG + Exonic
1006139667 6:31920715-31920737 CTCTAAAGACTCACAGGCCTGGG - Intronic
1006565446 6:34952495-34952517 CTCTGGACTTTGACAAGCCAGGG + Intronic
1006799939 6:36753341-36753363 CTCTGAAGTCAGACACACCCTGG - Intronic
1007430758 6:41775418-41775440 CGCCGATGTCAGACAGGCCAGGG - Exonic
1008904039 6:56656657-56656679 CTCTGTAGTCAGACAGACCTGGG - Intronic
1011278702 6:85655239-85655261 CTCAGAACTCTGAGAGGCCGCGG - Intergenic
1011577156 6:88815232-88815254 CTATGATGTATGACAGTCCAGGG - Intronic
1013244756 6:108275798-108275820 CTCAGCAGTCTGGGAGGCCAAGG - Intergenic
1015027680 6:128556448-128556470 CTCTGGATTGTAACAGGCCAGGG - Intergenic
1015498063 6:133901636-133901658 CTCTGTACTCTGGGAGGCCAAGG + Intergenic
1015607159 6:134970073-134970095 CCCTGAAGTCAGACAGACCTGGG + Intronic
1016051064 6:139530623-139530645 CTTTGAAGTCAGACAGACCCAGG + Intergenic
1016181879 6:141156717-141156739 CTCTTAAGCCTGAGAGGTCAAGG - Intergenic
1017282000 6:152636149-152636171 CGCTGGAGTCTGACGCGCCAGGG + Intronic
1017313447 6:153001766-153001788 CGCTGGTGGCTGACAGGCCAGGG - Intronic
1017519557 6:155189884-155189906 CGCTGCAGTTGGACAGGCCATGG + Intronic
1018532335 6:164780819-164780841 CTCAGCACTCTGGCAGGCCAAGG + Intergenic
1019083483 6:169452727-169452749 CACAGAAGCCTGAGAGGCCACGG + Intergenic
1019896918 7:3989959-3989981 CTCTGGAGTCAGACAGCACAGGG - Intronic
1021126731 7:16859145-16859167 CTCAGCACTCTGGCAGGCCAAGG + Intergenic
1021502522 7:21346403-21346425 CTCCAAAGTCAGACAGGCCCAGG + Intergenic
1021956430 7:25829805-25829827 CTCTGACATCTGACAAGGCAGGG - Intergenic
1024978055 7:55131788-55131810 CTCTGAATGCTGACAGCGCAAGG - Intronic
1025250664 7:57349273-57349295 CTCTGGAGTCTGACAGGTGTGGG + Intergenic
1026652449 7:72227287-72227309 CTCAGAACTTTGAGAGGCCAAGG + Intronic
1027713437 7:81638489-81638511 CTCTGATGTCTATCAGGTCACGG + Intergenic
1029563278 7:101318267-101318289 CTCAGCAGTCTGGGAGGCCAAGG + Intronic
1030148062 7:106376443-106376465 CTCTGAAGTCTGACAGGCTTGGG + Intergenic
1031492694 7:122408675-122408697 CTCAGCACTCTGAGAGGCCAAGG - Intronic
1031612009 7:123839140-123839162 CTCCCACCTCTGACAGGCCACGG + Intronic
1031796301 7:126178401-126178423 CTCAGCAGTTTGAGAGGCCAAGG + Intergenic
1032643800 7:133798673-133798695 GTCTGAGGTCAGACAGGCCTGGG - Intronic
1034067049 7:148147109-148147131 CTCTGAAATCTGACAAACCTTGG + Intronic
1035207225 7:157301724-157301746 CTCTGCAGTCTGGAAGGCCAAGG + Intergenic
1035302273 7:157905356-157905378 CTCCCAAGTCTGTCAGGCCAGGG + Intronic
1036159147 8:6370337-6370359 CCCAGCACTCTGACAGGCCAAGG + Intergenic
1036213671 8:6862721-6862743 CTCTCAAGTCAGACAGACCTGGG - Intergenic
1036461069 8:8953238-8953260 CTCTGAACTCTGAAATGACAAGG + Intergenic
1038057508 8:23874563-23874585 CTCTGTACTCAGATAGGCCATGG + Intergenic
1038284211 8:26192266-26192288 CTCAGCAGTTTGAGAGGCCAAGG - Intergenic
1040275917 8:46013598-46013620 CTTTCAAGTCTGACGTGCCATGG + Intergenic
1040461498 8:47653314-47653336 CACTGAAACCTGAGAGGCCAAGG - Intronic
1040987741 8:53314871-53314893 CTCTGCAGCCAGGCAGGCCAGGG + Intergenic
1041512710 8:58669458-58669480 CTCAGCACTTTGACAGGCCAAGG - Intergenic
1042128264 8:65560492-65560514 GTCTGAAGTCTGGGAAGCCAGGG - Intergenic
1044112136 8:88287942-88287964 CTCTGAAGTTTGACTGACCTTGG - Intronic
1044132914 8:88548782-88548804 CTCTAATGTATTACAGGCCAGGG + Intergenic
1044248853 8:89983813-89983835 CTGTGAAGACTCACAGGTCAAGG - Intronic
1045001997 8:97886642-97886664 CTCTGAAGGTTGACAGGCCCAGG + Intronic
1045270897 8:100660690-100660712 CACTGGAGTTTGACAGGCCCAGG - Intronic
1046105933 8:109666488-109666510 CCCAGAACTTTGACAGGCCAAGG + Intronic
1047049038 8:121088978-121089000 CCCTCAAGTCTCACTGGCCATGG - Intergenic
1047227777 8:122970989-122971011 CTCTGAAGTTGGACTGGCCAAGG + Intronic
1047859037 8:128944422-128944444 CTCTGTAGTCAAATAGGCCACGG + Intergenic
1047957224 8:129985092-129985114 CTTTGAAGCCTGACACACCAGGG + Intronic
1048864072 8:138746569-138746591 CTTTGATGACTGAAAGGCCATGG + Intronic
1050531361 9:6592429-6592451 CTCTGAACTCTAACATTCCATGG + Intronic
1050931714 9:11336786-11336808 CTGTGCACTTTGACAGGCCAAGG - Intergenic
1051596305 9:18827424-18827446 CTCTGAAATCTGAGTGGGCAGGG - Intronic
1051969878 9:22875646-22875668 CTCAGAACTTTGACAGGCCATGG - Intergenic
1051983792 9:23057592-23057614 CCCTGGAGTCTGGCAGTCCAGGG - Intergenic
1053154758 9:35769250-35769272 CTCCCAAGTCTGACAGGGCCAGG - Intergenic
1054453355 9:65415559-65415581 TGCTGAAGCCTGGCAGGCCAAGG + Intergenic
1057416402 9:94867393-94867415 CTCTGAAAGCAAACAGGCCAGGG - Intronic
1057702610 9:97374730-97374752 CTCTGAAGTCAGACAGACCTGGG + Intronic
1058447224 9:105064736-105064758 CTTTGAAGTCAGACAAGCCACGG + Intergenic
1058647901 9:107147636-107147658 CTCTGAACTCTTTCAGGGCAAGG + Intergenic
1058896391 9:109404272-109404294 CTCTGAGGACTGACAGGGCGAGG - Intronic
1058994233 9:110283864-110283886 CTCTGAAGTTGGACAGACCTAGG - Intergenic
1059399757 9:114061497-114061519 CTGGAAAGTCTCACAGGCCATGG + Exonic
1059929191 9:119244171-119244193 CTCTCAGGTTTTACAGGCCAAGG + Intronic
1060040551 9:120296500-120296522 CTCTGGAGTCAGACAGATCAGGG + Intergenic
1060391071 9:123277228-123277250 CTCTGAAGTCTGGCCGGGCGGGG + Intergenic
1060580730 9:124743974-124743996 CTCAGAACTCTGGGAGGCCAAGG + Intronic
1061011151 9:127955393-127955415 CTCTGAAGTCATACAGTCCTGGG - Intronic
1061404498 9:130385869-130385891 GTTTGGGGTCTGACAGGCCAAGG - Intronic
1062525242 9:136975636-136975658 CTCTGAAGTCTGATGGGGCCGGG - Intergenic
1062613645 9:137386621-137386643 CTCTCAAGGCTGAGGGGCCACGG - Intronic
1186428766 X:9486482-9486504 CGCTGTACTCTGAGAGGCCAAGG - Intronic
1187376365 X:18758743-18758765 CTGTGAAGTCTGTGAGGCCAGGG + Intronic
1188353076 X:29156172-29156194 CTTTGGAGTCAGACAGACCAGGG - Intronic
1189959896 X:46314437-46314459 CTCTCAAGCATGACATGCCAAGG + Intergenic
1191067806 X:56368470-56368492 CTCAGAAGTTTGGGAGGCCAAGG - Intergenic
1192184238 X:68935826-68935848 CTCAGAAGTCAGACTGGCCTGGG + Intergenic
1192342244 X:70273595-70273617 CTTTGGAGTCAGACAGGCCTGGG + Intronic
1192914438 X:75637716-75637738 CTCAGAAGCCTGACAGTCTAGGG + Intergenic
1193046676 X:77061366-77061388 CTCAGATTTCTGACAGGGCATGG - Intergenic
1193711663 X:84887455-84887477 CTCTTAAGTATGACAGACCAAGG + Intergenic
1193809103 X:86030574-86030596 CTCTGAGCTCTAACAGGCTAGGG - Intronic
1194109295 X:89812546-89812568 CTCTGGAGACTGAAAGTCCAAGG + Intergenic
1195984480 X:110614543-110614565 CTCTGACCCCTGACAGGCCCCGG - Intergenic
1196271032 X:113711025-113711047 CTCTGAAGCCAGACATGCTATGG + Intergenic
1196805400 X:119579656-119579678 CTCTGCAGTCAGACAGGTCTGGG - Intronic
1197863273 X:130992608-130992630 ATCTGGAGTCACACAGGCCAAGG - Intergenic
1198328455 X:135597861-135597883 CTCTGAAATCTGACAGACCTAGG - Intergenic
1198338005 X:135687195-135687217 CTCTGAAATCTGACAGACCTAGG + Intergenic
1198554301 X:137776478-137776500 CTCTGGAGTCAGACAGCCTAAGG + Intergenic
1198848099 X:140935159-140935181 CTCTGGAGTCTGACACACCTGGG - Intergenic
1199449250 X:147961223-147961245 CTCTCACTTCTGCCAGGCCAAGG + Intergenic
1200207225 X:154325401-154325423 CTTTGAGATCGGACAGGCCAAGG + Exonic
1200461958 Y:3467288-3467310 CTCTGGAGACTGAAAGTCCAAGG + Intergenic
1200641659 Y:5726488-5726510 CTCTGGAGTTTGACAGGAAATGG + Intronic
1201516589 Y:14824758-14824780 CTCAGCAGTTTGAGAGGCCAAGG - Intronic
1202579002 Y:26359379-26359401 CTTTGGAGTCAGACAGACCAGGG + Intergenic