ID: 957840502

View in Genome Browser
Species Human (GRCh38)
Location 3:85662601-85662623
Sequence CTGCAAATGATACTTTTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 170}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957840497_957840502 9 Left 957840497 3:85662569-85662591 CCATTCCTCCCAGATGGAGCAAC 0: 1
1: 0
2: 3
3: 18
4: 310
Right 957840502 3:85662601-85662623 CTGCAAATGATACTTTTGTCAGG 0: 1
1: 0
2: 1
3: 9
4: 170
957840500_957840502 1 Left 957840500 3:85662577-85662599 CCCAGATGGAGCAACTTCAGGTC 0: 1
1: 0
2: 0
3: 5
4: 216
Right 957840502 3:85662601-85662623 CTGCAAATGATACTTTTGTCAGG 0: 1
1: 0
2: 1
3: 9
4: 170
957840501_957840502 0 Left 957840501 3:85662578-85662600 CCAGATGGAGCAACTTCAGGTCT 0: 1
1: 0
2: 0
3: 6
4: 101
Right 957840502 3:85662601-85662623 CTGCAAATGATACTTTTGTCAGG 0: 1
1: 0
2: 1
3: 9
4: 170
957840498_957840502 4 Left 957840498 3:85662574-85662596 CCTCCCAGATGGAGCAACTTCAG 0: 1
1: 0
2: 0
3: 10
4: 111
Right 957840502 3:85662601-85662623 CTGCAAATGATACTTTTGTCAGG 0: 1
1: 0
2: 1
3: 9
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957840502 Original CRISPR CTGCAAATGATACTTTTGTC AGG Intronic
902431793 1:16368816-16368838 ATGCAAATGATACGTTTCTTGGG + Intronic
903084609 1:20844537-20844559 CTGCACATAAGACCTTTGTCGGG + Intronic
905949202 1:41933086-41933108 CTCCAAATGATACTATGTTCTGG - Intronic
907598232 1:55740209-55740231 CTGGATATGAGACCTTTGTCAGG + Intergenic
909145552 1:71925800-71925822 CTGCAAATAAAACCTATGTCTGG - Intronic
909524556 1:76607893-76607915 CTGCAAATGCTACATTTGGTTGG - Intronic
911715801 1:101131442-101131464 CTGCAATTGCTTCCTTTGTCAGG - Intergenic
915546675 1:156602855-156602877 CAGAAAAGGATACTTTTCTCGGG - Intergenic
916872358 1:168929822-168929844 CTGGATATTAGACTTTTGTCAGG - Intergenic
917208172 1:172600265-172600287 CTACAAATGACAATTTTGTTTGG - Intronic
919372987 1:196753730-196753752 TTGCCAATGATACTTTTATAGGG + Intergenic
919379431 1:196838413-196838435 TTGCCAATGATACTTTTATAGGG + Intronic
924550876 1:245075648-245075670 CTGCGAATGGTACTTTTAGCAGG + Intronic
1062962424 10:1582698-1582720 GTGCAAATGCTACTCTTCTCAGG + Intronic
1063809609 10:9689765-9689787 CTGGAAAAGATATTTTTGTCAGG - Intergenic
1068247281 10:54389529-54389551 GTGAAGATGATACTTATGTCAGG - Intronic
1070248634 10:74754180-74754202 CTGCAAAAGAAACCCTTGTCTGG + Intergenic
1070519043 10:77235916-77235938 CTGGAAAAGACACTTTTATCAGG - Intronic
1070600741 10:77864686-77864708 ATGCAAATGCAACTTTGGTCTGG - Intronic
1070980924 10:80646479-80646501 CTGCAAATGAAATTACTGTCTGG + Exonic
1074918799 10:117985700-117985722 CTGCAAATTATAATATTGTGAGG + Intergenic
1078053209 11:7985229-7985251 CTGCAAATGACATTTTTCTCAGG - Intronic
1079642064 11:22817863-22817885 CTGCATATTAGACCTTTGTCAGG + Intronic
1080123784 11:28707105-28707127 CTGCAAATATTACTTTGGTAGGG + Intergenic
1083434937 11:62635956-62635978 CTGCAGTTGATACTTGTATCTGG - Intronic
1086599996 11:88621419-88621441 TTGAAAATGATTCTTTTTTCAGG + Intronic
1087709729 11:101534472-101534494 CTTGAAATGATACTTTAGTGTGG - Intronic
1088621840 11:111692793-111692815 CCTCAAATTATACTTTTTTCTGG + Intronic
1092779174 12:11969619-11969641 CTGAAAATGACCCTTGTGTCCGG - Intergenic
1093253590 12:16838450-16838472 CTGCACATCATATTTTTTTCTGG - Intergenic
1095317588 12:40784901-40784923 CCTCAACTGATACTTTTGTGTGG + Intronic
1095806779 12:46328197-46328219 CTAAAAATGAACCTTTTGTCAGG + Intergenic
1096854316 12:54468683-54468705 TAGCTGATGATACTTTTGTCAGG - Intronic
1097792534 12:63830018-63830040 CTTGAAATAATACTTATGTCAGG + Intergenic
1099174455 12:79404388-79404410 TTGCAAATGCTACTTTTGTGAGG - Intronic
1099625147 12:85063088-85063110 CTGCATATTATATGTTTGTCCGG + Intronic
1099648018 12:85384698-85384720 TAGCAAAAGATTCTTTTGTCAGG + Intergenic
1105747227 13:23388942-23388964 TTGCAAATGATACTTTCTTTTGG - Intronic
1106955172 13:34929561-34929583 CAGAAAATGATACTTTTATATGG - Intergenic
1108485708 13:50922055-50922077 CTGCAAATGAGACTTTTCCAAGG - Intronic
1112696997 13:101961076-101961098 CTGGATATTAGACTTTTGTCAGG + Intronic
1114072213 14:19121241-19121263 CAGAAAATGATACTTTTTTATGG - Intergenic
1114090044 14:19278732-19278754 CAGAAAATGATACTTTTTTATGG + Intergenic
1116251901 14:42496485-42496507 CTGGAAATGATTCTTCTGGCTGG + Intergenic
1117503565 14:56378155-56378177 CTGCAAATGATCCTCTTCTGTGG - Intergenic
1119693391 14:76694152-76694174 CTGCAAATGGTTCTTTAGACTGG + Intergenic
1120072195 14:80116307-80116329 CTGCATTTTATACTTATGTCTGG - Intergenic
1120426405 14:84353148-84353170 CTGGATATTATACCTTTGTCAGG - Intergenic
1120976437 14:90253127-90253149 CTGCAAATGATCCACTTGCCAGG - Intergenic
1121174279 14:91879131-91879153 CTGCACATGATACTTTATTGTGG - Intronic
1121598172 14:95181834-95181856 CAACAAATAATACTTTTGCCAGG - Intergenic
1130436953 15:83909982-83910004 CTGCAAAGAAAACTTTTGTAGGG - Intronic
1130626184 15:85517835-85517857 CTGCAACTGACAATTTTTTCAGG - Intronic
1131916627 15:97272470-97272492 CTGCAAAAGATGCTTTAGTTGGG + Intergenic
1138403564 16:56769286-56769308 ATTCAAAAGATACTTTTCTCCGG - Intronic
1140685530 16:77430632-77430654 GTGTAAATGATACTCTTCTCAGG - Intronic
1143951701 17:10637819-10637841 CTGCAAACGAGACTTCTGTGTGG + Exonic
1147411873 17:40259109-40259131 CTTCAAGTGATCCTTTTGCCTGG + Intronic
1154258449 18:12807021-12807043 CTGCAAACTATACATTTGACAGG + Intronic
1154379994 18:13840490-13840512 CTGCAAATGATATTTTCTTTAGG + Intergenic
1156389211 18:36635022-36635044 ATTCCAATCATACTTTTGTCAGG - Intronic
1156862242 18:41851317-41851339 CTGCATAAGATAATTTGGTCGGG + Intergenic
1157379116 18:47195002-47195024 CTTCACATGATACTATTGTGCGG + Intergenic
1157974494 18:52311316-52311338 CTGCAACTGTTACTGATGTCAGG + Intergenic
1160234192 18:77072860-77072882 CTGCAAATGGCACATTTCTCTGG + Intronic
1162197345 19:8995589-8995611 CTGGATATTAGACTTTTGTCAGG + Intergenic
1164602663 19:29573560-29573582 CTGCATATTATATTTTTTTCAGG - Intergenic
1165277743 19:34769537-34769559 CTTCAAATGATACTAATGCCTGG + Exonic
1168219625 19:54951243-54951265 CTACAAAGGATATTTTTGTGGGG - Intronic
932916670 2:75866759-75866781 CTGCCAATGATACTTTTCCTAGG + Intergenic
933293361 2:80462186-80462208 CTGCACAGGTTAATTTTGTCTGG + Intronic
935122824 2:100197434-100197456 CAGCAAATGAAACTATTGACAGG - Intergenic
935929630 2:108109995-108110017 CTGGATATTAGACTTTTGTCAGG + Intergenic
937120103 2:119434987-119435009 CTGCATATCATACAATTGTCTGG + Intronic
938486455 2:131714647-131714669 CAGAAAATGATACTTTTTTATGG - Intergenic
942525845 2:176851736-176851758 TTGCAAATGATTTTTTTCTCAGG + Intergenic
942690924 2:178584406-178584428 AAGCCAATGATACTCTTGTCCGG - Exonic
942810709 2:179997051-179997073 CTGTAAATGATAACTTTCTCAGG + Intronic
942936375 2:181561578-181561600 CTGCAAATGATAGCTTTGCAGGG - Intronic
944156764 2:196615600-196615622 CTTCAAAGTATACTTCTGTCAGG - Intergenic
946352152 2:219162205-219162227 CTGCAAAAGAGAGGTTTGTCAGG + Intronic
948284791 2:236775159-236775181 CTGCAAATGCCACTTTTACCAGG + Intergenic
1170757277 20:19215140-19215162 CTGCAAATGATAATTTTGCAAGG + Intronic
1170935045 20:20802626-20802648 CTGCATAAGATAATTCTGTCTGG - Intergenic
1173938810 20:46893027-46893049 CTGCAAATTATACATGTATCAGG - Intergenic
1175552561 20:59826813-59826835 CTGCCAATGCTACTTTTGAAAGG - Intronic
1177401266 21:20608040-20608062 ATGCAAATGATGCTGTTATCAGG + Intergenic
1177777192 21:25581305-25581327 CTACAAATATTTCTTTTGTCTGG - Intergenic
1178216037 21:30599321-30599343 ATCCAAATAATACTTTTTTCAGG + Intergenic
1178375917 21:32067466-32067488 CTGCAGATTATCTTTTTGTCAGG + Intergenic
1179049564 21:37877289-37877311 CTGCAGATAATACCTTTGGCAGG - Intronic
1180490655 22:15843594-15843616 CAGAAAATGATACTTTTTTATGG - Intergenic
1181048733 22:20228772-20228794 CAGCAAATGGTGCTGTTGTCAGG - Intergenic
1183003385 22:34880054-34880076 CTGCGAGAGCTACTTTTGTCTGG - Intergenic
949251289 3:1987255-1987277 CTTGAAATGCTACTTATGTCTGG - Intergenic
951454989 3:22881456-22881478 ATGGAAAAGATACTTTTGTAAGG + Intergenic
951733029 3:25831909-25831931 CTCCAAATGAAACTTTGGACAGG - Intergenic
951856137 3:27199213-27199235 CTGCATATTAGACCTTTGTCAGG - Intronic
956657471 3:71566485-71566507 CTGGAAATGATACTTTAGTTGGG - Intronic
956757810 3:72406462-72406484 CTCCATATGACACTTGTGTCAGG - Intronic
957840502 3:85662601-85662623 CTGCAAATGATACTTTTGTCAGG + Intronic
960345010 3:116520243-116520265 CTGCATATTAGACCTTTGTCAGG + Intronic
960457015 3:117884664-117884686 GTGCATATGATACTCTTCTCAGG - Intergenic
961402536 3:126657274-126657296 CTGCAAAAGCTACTGCTGTCAGG - Intergenic
962579937 3:136789105-136789127 CTGCAAGTGCTACTGTTGCCTGG + Intergenic
963855874 3:150252726-150252748 CAGCAAAACAAACTTTTGTCTGG + Intergenic
964630752 3:158807692-158807714 CTGGAAATGATATTTTTCCCAGG + Intronic
965153120 3:165008506-165008528 CTGAAAAAGATAATTTTCTCTGG + Intronic
965344787 3:167535088-167535110 CTCTAAATCATAATTTTGTCTGG - Intronic
965854129 3:173067270-173067292 CTGCAAAGGATTCTTTTTTATGG - Intronic
967067513 3:185932949-185932971 CTGGAAATTATCCTTTTGTTAGG - Intronic
967487736 3:190053752-190053774 CTTCAAAAGACACTTTTGGCTGG - Intronic
968110911 3:196045732-196045754 CTGCAAAATATACTTTTTTTAGG - Intronic
971410068 4:26360982-26361004 CTGTGAAGGATACATTTGTCTGG + Intronic
971969001 4:33597726-33597748 CTGCAAATGATAAAATTTTCAGG - Intergenic
972266023 4:37460725-37460747 CTGGAAATTAGACCTTTGTCAGG + Intronic
977452254 4:97213614-97213636 ATGTAAATGATACTCTTGTATGG - Intronic
978872629 4:113598568-113598590 CTGCAAATGACACTGTTGAGAGG + Intronic
981427846 4:144624337-144624359 ATGCAAATTATCTTTTTGTCTGG - Intergenic
982012579 4:151120496-151120518 CTGCAAATGATAATTTAATTTGG + Exonic
982450412 4:155545429-155545451 CTGCAAATGATACTTTTCCATGG - Intergenic
983701788 4:170605602-170605624 CTCCAAATAATACTTTTCTTTGG - Intergenic
984233047 4:177122897-177122919 CTGAAAATGTTACTTTTCTTTGG + Intergenic
984804418 4:183737851-183737873 CTGCAAATGAGTCTAGTGTCAGG - Intergenic
986333594 5:6736230-6736252 CTCCAAATGACTCTTTTGGCGGG + Intronic
987549068 5:19355025-19355047 CTGCAAAGGATACTTCTTCCTGG + Intergenic
991130055 5:63111841-63111863 CTGCAAATGTTACTGTAGTTGGG + Intergenic
993336029 5:86659913-86659935 CTGGAAATAAGACATTTGTCAGG + Intergenic
993938781 5:94033808-94033830 ATGTAAATGTGACTTTTGTCAGG - Intronic
994310524 5:98264301-98264323 ATGCAACTGATAGTTCTGTCAGG - Intergenic
995002218 5:107147852-107147874 CTACACATGTTACTTTTGTTTGG + Intergenic
995312857 5:110732923-110732945 CTGGATATTAGACTTTTGTCAGG - Intronic
995829449 5:116337721-116337743 CTGCACATGAAACATTTTTCAGG + Intronic
998101115 5:139435612-139435634 CTTCTTATGATATTTTTGTCTGG + Intronic
999041481 5:148418030-148418052 CTACAGATGATTCTTTTGTCAGG - Intronic
1000492738 5:161935008-161935030 CTGCTAATGATATTTTTTTGTGG + Intergenic
1003364978 6:5464761-5464783 CTGTAAGAGATACTTTTCTCTGG - Intronic
1005117272 6:22352582-22352604 TTTCAAATGATCTTTTTGTCTGG - Intergenic
1005651488 6:27889283-27889305 CTGCAAATCAGTCTTTTGTGGGG + Intergenic
1005851060 6:29822595-29822617 CTGAATATGAGACCTTTGTCAGG - Intergenic
1006943707 6:37770063-37770085 CAGCTTATGATACGTTTGTCTGG - Intergenic
1007881241 6:45169407-45169429 TAGCAAATGATTATTTTGTCTGG - Intronic
1009214381 6:60902593-60902615 CTGCATATTAGACCTTTGTCAGG - Intergenic
1010042311 6:71399599-71399621 CTGCAAATGCTACTGTTTTACGG + Intergenic
1010722794 6:79302820-79302842 CTGCAAATGATCCTCCTGTGTGG - Intergenic
1011309665 6:85968124-85968146 CTGCAAATGGAACTTTTGAAAGG - Intergenic
1014046956 6:116900223-116900245 CTGCTAATTCTACTTTTGTATGG + Intronic
1018250067 6:161860634-161860656 CTGGATATTAGACTTTTGTCAGG + Intronic
1019862024 7:3668066-3668088 CCTCAAATGATAGTTTTGTTAGG - Intronic
1020635769 7:10694169-10694191 CTCCAAATGATACTGGTTTCAGG - Intergenic
1020957286 7:14756816-14756838 TTGCAAAAGACCCTTTTGTCAGG - Intronic
1022133285 7:27423848-27423870 CTTCAAAGATTACTTTTGTCAGG + Intergenic
1026175551 7:67993650-67993672 CTGCATCTGATTCTTTTGTTAGG + Intergenic
1028355988 7:89908987-89909009 CTGTATATAATCCTTTTGTCTGG - Intergenic
1028617126 7:92780928-92780950 CTTGAAATGGTATTTTTGTCAGG - Intronic
1029897651 7:104001988-104002010 GTGTAACTGATACTTTTTTCTGG + Intergenic
1029946153 7:104535283-104535305 CTCCAAATGATACTTCTGTCAGG + Intronic
1037396018 8:18444535-18444557 TTGCAAAAGATACTGTTGGCTGG + Intergenic
1038673738 8:29604001-29604023 CTGAAAATGATAGTTATCTCTGG - Intergenic
1039082192 8:33744431-33744453 CTGCACATGTTTCTTTTGCCTGG - Intergenic
1041258354 8:55998687-55998709 CTCCACATGATACTTTTGTTAGG + Intronic
1042094874 8:65203388-65203410 CTGGATATTAGACTTTTGTCAGG - Intergenic
1043554506 8:81415393-81415415 CTGGATATGAGACCTTTGTCAGG - Intergenic
1044140354 8:88643841-88643863 CAGCAGATGATAATTTGGTCAGG + Intergenic
1044705253 8:95002204-95002226 CAGCAAAAGATATTTTTATCAGG - Intronic
1044727432 8:95204830-95204852 CAACAAGTGATACTTTTGTTAGG + Intergenic
1046345428 8:112918881-112918903 CTGCAATTTATGCTGTTGTCTGG + Intronic
1046642640 8:116749782-116749804 CTCCAAATGATACTTTTCTTTGG + Intronic
1047846745 8:128814379-128814401 TTGAAACTTATACTTTTGTCAGG - Intergenic
1048701464 8:137095337-137095359 CTGAATATTAGACTTTTGTCAGG - Intergenic
1054866442 9:70007113-70007135 CTGCAAAAGCTACTTATGCCAGG - Intergenic
1058751298 9:108040876-108040898 CAGGAAATGAGACTTGTGTCAGG + Intergenic
1059546965 9:115186126-115186148 CTGGAATTGATACTTGTGTATGG + Intronic
1186553192 X:10528681-10528703 CTCAAAATGATAATATTGTCTGG + Intronic
1187078716 X:15963501-15963523 TTCCAAATGATACGTATGTCTGG - Intergenic
1188570599 X:31580618-31580640 CATAAAATGATACTTTTGCCAGG + Intronic
1189602377 X:42640796-42640818 CTGCCCATGATACTATTGCCAGG + Intergenic
1193208116 X:78772910-78772932 CTGCTAGTTATACTTTTCTCTGG + Intergenic
1195195350 X:102492807-102492829 GTGCACATGAAACTTTTTTCAGG - Intergenic
1195813658 X:108861402-108861424 ATGCAAATGATAATTGTGTGTGG + Intergenic
1197993664 X:132347864-132347886 CTGCATATTAGACCTTTGTCAGG - Intergenic