ID: 957840804

View in Genome Browser
Species Human (GRCh38)
Location 3:85666735-85666757
Sequence GTGAAGATCTTCAGGGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 2, 2: 2, 3: 56, 4: 285}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957840798_957840804 6 Left 957840798 3:85666706-85666728 CCTTCGATATGGGACTGAACAAC 0: 1
1: 0
2: 0
3: 2
4: 33
Right 957840804 3:85666735-85666757 GTGAAGATCTTCAGGGGAGAAGG 0: 1
1: 2
2: 2
3: 56
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957840804 Original CRISPR GTGAAGATCTTCAGGGGAGA AGG Intronic
900463398 1:2811928-2811950 GGGAAGTTCTTCATGGTAGAAGG + Intergenic
902502952 1:16922627-16922649 GAGAGGGTCTTCAGGGGACATGG - Intronic
903575136 1:24335178-24335200 CTGTGGGTCTTCAGGGGAGAGGG - Intronic
905552705 1:38856907-38856929 GAGATGATCTTCAGGGGAACAGG - Exonic
906121293 1:43393201-43393223 GTGAAGATCTTCAGGTGAGAAGG + Intronic
906250272 1:44305735-44305757 GTGAAGCTGCTGAGGGGAGAAGG + Intronic
906609677 1:47192703-47192725 GTGAAGACCTCCAGGGAGGAGGG - Intergenic
907809267 1:57852170-57852192 ATGAGGATCTTCAGGGGAAAAGG - Intronic
908057446 1:60304868-60304890 GTGAAGCTCCTCAGGAGACAAGG + Intergenic
908421246 1:63960385-63960407 GTCAAGACCGTCAAGGGAGAAGG + Intronic
908836918 1:68237584-68237606 ATGAAGATCTACAGAGGAGGTGG - Intergenic
909379661 1:74984088-74984110 GAGAAGAATGTCAGGGGAGATGG - Intergenic
909496259 1:76282224-76282246 GTGAGGAATTTCAGGTGAGAGGG + Intronic
909596581 1:77412990-77413012 GTGAAGATCTCCATGGCAGCAGG - Intronic
910038761 1:82821809-82821831 GTGAAAATCTTTAAGGAAGAAGG + Intergenic
910689949 1:89955455-89955477 ATGAAGGTCTTCAGGGAAGAGGG - Intergenic
912861347 1:113216583-113216605 GTGAGGATGTTCAGAGGAGAGGG + Intergenic
913116206 1:115699653-115699675 GAGAAGATGTTTAGGGGAGAAGG + Intergenic
915700268 1:157785355-157785377 GTTAGGATCTTCAGTGGTGAAGG - Intergenic
916282247 1:163064577-163064599 ATGAGGGTCTTCAAGGGAGAAGG + Intergenic
917213180 1:172651059-172651081 GAGAAACTCTTGAGGGGAGAAGG + Intergenic
917529942 1:175825761-175825783 ATGACCAGCTTCAGGGGAGAAGG - Intergenic
917716119 1:177739812-177739834 GTGAAGACATTCAGGGTATAAGG - Intergenic
919164967 1:193880950-193880972 GTGATTATCATCAGGGAAGAAGG - Intergenic
919347794 1:196408093-196408115 GTTAAGATTATCAGGGCAGAGGG - Intronic
920773765 1:208915307-208915329 ATGAAGGTCTGCAGGGAAGAAGG + Intergenic
923401339 1:233618109-233618131 GGGCAGAGCTTCAGGGAAGAAGG + Intronic
923550533 1:234959561-234959583 AAGAAGAGCTTCCGGGGAGAGGG - Intergenic
924326623 1:242901277-242901299 ATGACCAGCTTCAGGGGAGAAGG - Intergenic
1062806565 10:424770-424792 GAGAAGACATTCTGGGGAGATGG - Intronic
1063046601 10:2398705-2398727 ATGAAGGTCTTCAAAGGAGAGGG + Intergenic
1063923275 10:10952246-10952268 GTGCGGAACTTCAGGGGGGAAGG - Intergenic
1063937420 10:11092732-11092754 GTGAATTGCTTCAGGGAAGAAGG + Intronic
1064971392 10:21070747-21070769 TTGAATTTCTTCAGGGGATAAGG + Intronic
1064973394 10:21088974-21088996 GTGAAGCTCTAGAGGGGAGATGG + Intronic
1065225450 10:23538920-23538942 GAGAAGGTCTGCAGAGGAGATGG - Intergenic
1066319446 10:34286785-34286807 GTGAAGAACTGCAGGTGAAAAGG + Intronic
1066444139 10:35466308-35466330 GAGAGGATATTCAGGGCAGAGGG + Intronic
1069481431 10:68785760-68785782 CTGAAGAGGTTCAGGGAAGATGG - Intronic
1071033693 10:81216379-81216401 ATGAGGGTCTTCAAGGGAGAAGG + Intergenic
1071409980 10:85379629-85379651 GTGAAGATGTATAGAGGAGATGG - Intergenic
1072044726 10:91643519-91643541 GTGAAGGACTTCCAGGGAGATGG - Intergenic
1072873776 10:99150037-99150059 GTAAGGATCATAAGGGGAGATGG - Intronic
1075104718 10:119531211-119531233 GAGAAGATCTGCTGGGGAAATGG - Intronic
1075730066 10:124630720-124630742 GTAAATATCTTCAGGGTGGAAGG + Intronic
1076863168 10:133151860-133151882 ATGAAGATCAGCAGGGAAGAGGG - Intergenic
1077020229 11:414017-414039 GGGAAGGTGTGCAGGGGAGAGGG - Intronic
1077020277 11:414170-414192 GGGAAGGTGTGCAGGGGAGAGGG - Intronic
1080493230 11:32790267-32790289 AAGAAAATCTTCAGAGGAGATGG - Intronic
1080708248 11:34719952-34719974 GTGAAGTTCTTGAGTGGTGAGGG + Intergenic
1081194234 11:40141707-40141729 GTTAAAATCTTCAAGGGACAAGG + Intronic
1082006574 11:47422667-47422689 GTGCAGATGTTCATTGGAGATGG - Exonic
1084144257 11:67255758-67255780 TTGAAGCTCTTCAGAGGAGCTGG + Exonic
1086213325 11:84347459-84347481 GTGGAGATAGTCAAGGGAGAGGG - Intronic
1087903011 11:103663830-103663852 ATGAGGGTCTTCAAGGGAGAAGG - Intergenic
1088911296 11:114194407-114194429 GTCAAGATCTTGAGGGCAGGGGG - Intronic
1089165474 11:116472799-116472821 GTGAGGGTTTTCAGGGGAGGAGG - Intergenic
1090304960 11:125683411-125683433 CTGAAAATCTTCAGGGTGGAGGG + Intergenic
1091317739 11:134626341-134626363 GTGTAGACATTCAGGGGACAGGG - Intergenic
1091597940 12:1891241-1891263 GTGAAGTTTTTCTGGGGACAAGG - Intronic
1095278149 12:40315454-40315476 TTGAAGAGCTTCATGGAAGAAGG + Intronic
1095545391 12:43362293-43362315 GTGCAGAACTTCAGGAGAGGAGG + Intronic
1096607743 12:52778541-52778563 ATGAAAATCTTCAGAGGAAAGGG + Intergenic
1096678834 12:53241705-53241727 TGGAGGATTTTCAGGGGAGAGGG + Intergenic
1096877763 12:54644002-54644024 TTGAAGATCTCCATGGAAGAAGG - Intergenic
1097323049 12:58246647-58246669 ATGAAGGTCTTCCAGGGAGAAGG - Intergenic
1097689934 12:62725352-62725374 GTGACCTGCTTCAGGGGAGAGGG - Intronic
1098618401 12:72558792-72558814 GAGAAGGTCTTCACTGGAGAAGG + Intronic
1099465097 12:82974913-82974935 AAGAGGATCTTCAAGGGAGACGG + Intronic
1099612265 12:84889000-84889022 ATGAGGATCTTCAAGGGAGAAGG - Intronic
1100561931 12:95755800-95755822 GTAAATATCTTCAGGGAAAAGGG + Intronic
1101597264 12:106178281-106178303 GTCAAGACCATCAGGTGAGAAGG + Intergenic
1104797247 12:131528297-131528319 GAGTAGAACTTCAGGGAAGAGGG + Intergenic
1105412319 13:20180917-20180939 GTCAAGTTATTTAGGGGAGAAGG - Intergenic
1105966833 13:25392435-25392457 CTGAAGATCAACAGTGGAGAGGG - Intronic
1106798391 13:33231276-33231298 GTGAAGATTTTCAGGACAGCAGG + Intronic
1106846721 13:33744847-33744869 ATGAAAATCTTCAGGGGAGGAGG + Intergenic
1109114399 13:58362698-58362720 GTGCAGATCCTAAAGGGAGATGG + Intergenic
1109332658 13:60949112-60949134 GTGAAGATGTTTAGTAGAGATGG + Intergenic
1111127826 13:83935213-83935235 GTGATGATTATCAGTGGAGATGG + Intergenic
1111425244 13:88071695-88071717 ATGAGGATCTTTAAGGGAGAAGG - Intergenic
1111729572 13:92056453-92056475 GTGAAAATCTTTGGGGGAGGGGG + Intronic
1112471789 13:99695860-99695882 ATGAGGGTCTTCAGGGGAGGAGG + Intronic
1113460106 13:110476291-110476313 GTGAAGAGCTCCAGGGGAAATGG - Intronic
1114229881 14:20771538-20771560 ATGAAGATCAACAGTGGAGAGGG + Intergenic
1114774296 14:25463875-25463897 GTGAAGACCTGCACTGGAGAAGG - Intergenic
1115523614 14:34257611-34257633 ATGAGAGTCTTCAGGGGAGAAGG - Intronic
1115812225 14:37121967-37121989 GAGACTATCATCAGGGGAGATGG - Intronic
1116478320 14:45367037-45367059 ATGAAGGTCTTCAAGGGAGAAGG - Intergenic
1117049118 14:51843156-51843178 GGAAAGGTCTTCAGGGGAGAGGG + Intronic
1117210926 14:53498873-53498895 ATGAGGGTCTTCAAGGGAGAAGG + Intergenic
1117699591 14:58399581-58399603 GGAAAGATCTTCTAGGGAGAGGG - Intronic
1118042314 14:61930588-61930610 GTGAACATCTTGAGGGGATGTGG - Intergenic
1118861754 14:69669618-69669640 TTGAAGATGTTTAGGGGAGAAGG - Intronic
1120242603 14:81966647-81966669 GTGAAGATTTTGAGGGTAGAGGG + Intergenic
1120242665 14:81967215-81967237 ATGAGGATCTTCAAGGGAGAAGG - Intergenic
1120732291 14:88017301-88017323 CTGAAGAGCTGCAGTGGAGAAGG + Intergenic
1121005206 14:90486121-90486143 GTGAAGAACTAGAGGGGAGAGGG + Intergenic
1122601199 14:102922814-102922836 GTGAAGATCTTCCGAGGAGTGGG + Intronic
1124992719 15:34691892-34691914 ATGAGGGTCTTCAAGGGAGAAGG + Intergenic
1126049505 15:44673464-44673486 GTGAAGTTCTTGAGGGGAAAAGG - Intronic
1127775766 15:62263361-62263383 GTGAACAGCTTCAAGGGAGAAGG + Intergenic
1128276299 15:66356594-66356616 ATGAAGTTCTTGCGGGGAGAGGG - Intronic
1128578299 15:68791067-68791089 ATGAGGGTCTTCAAGGGAGAAGG - Intronic
1128797046 15:70473651-70473673 GTGATGGTGTACAGGGGAGATGG - Intergenic
1129942281 15:79508879-79508901 ATTAAGATCTTCAGAGAAGAAGG - Intergenic
1131901028 15:97088014-97088036 TTGACTGTCTTCAGGGGAGAGGG + Intergenic
1131990186 15:98085635-98085657 CTGAAGACCTTTAGAGGAGAAGG - Intergenic
1132180615 15:99750140-99750162 ATGAGGGTCTTCACGGGAGAAGG - Intergenic
1133059356 16:3164440-3164462 ATGCAGATCTGCAGGGGAGTGGG + Intergenic
1133364078 16:5197206-5197228 ATGGACATCGTCAGGGGAGAAGG - Intergenic
1133450095 16:5896717-5896739 GCATAGCTCTTCAGGGGAGAGGG + Intergenic
1135063897 16:19293003-19293025 GAGAAGGTCTTCATGGGAGAAGG + Intronic
1136232345 16:28894140-28894162 ATAAACATCTGCAGGGGAGAAGG - Exonic
1136636720 16:31528998-31529020 GTGCAGAGCTGCAGGGGAGGGGG + Intergenic
1138268514 16:55677981-55678003 GGGAAGATCTGTAGGGCAGAAGG - Intronic
1139596119 16:67959349-67959371 GTGAAAATCATACGGGGAGAGGG + Intronic
1140335133 16:74097942-74097964 ATGAGGGTCTTCAAGGGAGAAGG - Intergenic
1142311858 16:89318778-89318800 GTGAAGTTATTCTGGAGAGAGGG + Intronic
1142402074 16:89864303-89864325 GTGTAGAACTCCAGAGGAGAGGG + Intronic
1142645017 17:1305980-1306002 GGTCAGAACTTCAGGGGAGAGGG + Intergenic
1143792385 17:9307912-9307934 ATGAGGGTCTTCAAGGGAGAAGG - Intronic
1143949558 17:10621886-10621908 GTTAAGATTTCAAGGGGAGATGG + Intergenic
1144410060 17:14992118-14992140 ATGAACTGCTTCAGGGGAGAAGG + Intergenic
1147553082 17:41458617-41458639 GTGGGGATCTTCAGGAGAGCAGG - Intergenic
1147746750 17:42699361-42699383 TGGAAGATCTTCAGGGCAGGGGG - Exonic
1149590155 17:57823077-57823099 GTGAGCATGTGCAGGGGAGAGGG - Intergenic
1150295163 17:64003485-64003507 GGAAAGAACTTCAGGGAAGAGGG + Intronic
1150701335 17:67449143-67449165 GTGACGATCTTCAAGTGACAGGG - Intronic
1153333319 18:3896860-3896882 ATGAGGGTCTTCAAGGGAGAAGG - Intronic
1153406691 18:4748792-4748814 AAGAGGATCCTCAGGGGAGAAGG + Intergenic
1156580696 18:38371342-38371364 TTGAAGGTCTTCAGGGAAGCTGG + Intergenic
1157015203 18:43703891-43703913 ATGAGGGTCTTCAAGGGAGAAGG - Intergenic
1158015685 18:52780752-52780774 GTGAAGGTCTTCAGGGGAGAAGG + Intronic
1158225571 18:55197726-55197748 ATGAAGATCTTCATGTAAGAGGG - Intergenic
1158483369 18:57842773-57842795 ATGAAGATGCTCAGGGAAGAAGG - Intergenic
1158504523 18:58034747-58034769 TTAAAGATCTTGAGGTGAGAGGG + Intergenic
1159514104 18:69435277-69435299 GTCAGGATATTGAGGGGAGAAGG - Intronic
1159659244 18:71073494-71073516 TTGAAGACCTCCAGGGGAGCTGG - Intergenic
1161290622 19:3491804-3491826 GTGCAGACCTGCAGGGGAGAGGG + Exonic
1162625612 19:11882199-11882221 TTGGAGTTCTTTAGGGGAGAGGG - Intronic
1162823185 19:13235720-13235742 ATGAAGTTATTCTGGGGAGATGG + Exonic
1163205830 19:15802087-15802109 GTGGACATCTTGTGGGGAGAAGG + Intergenic
1163760250 19:19132602-19132624 GTGGAGACCTTCAGGGCTGAGGG + Intronic
1164377559 19:27701889-27701911 GTGAAGATCTTCAGTTTAGTCGG - Intergenic
1164542074 19:29128747-29128769 TTGAAGACATGCAGGGGAGATGG + Intergenic
1164742417 19:30585732-30585754 GGGAAGGTCATCAGGGGAGATGG - Intronic
1167700134 19:51038522-51038544 ATGAGGGTCTTCAGGGGAAAAGG - Intergenic
925421563 2:3717029-3717051 GAGAAGAGCTTCAGAAGAGAAGG - Intronic
925590404 2:5503482-5503504 ATGAAGTTCTTCAAGGAAGAAGG - Intergenic
925876687 2:8317319-8317341 GTCAAGGTTTTCAGGAGAGAGGG + Intergenic
925880847 2:8351050-8351072 GGGAAGATCAACAGAGGAGATGG + Intergenic
926552422 2:14316375-14316397 CTGACGTTCTTCAGAGGAGATGG - Intergenic
928125970 2:28616482-28616504 CTTAAGATCTTCAGGGGATTTGG + Intronic
928733062 2:34255296-34255318 ATGTAGATTTTCAGGTGAGATGG + Intergenic
930025512 2:47026979-47027001 GTGAACATGTTCAGAGGGGAGGG + Intronic
930122164 2:47769147-47769169 AGGAGGATCTTCAAGGGAGAAGG + Intronic
930127653 2:47815324-47815346 ATGAGGATCTTCCAGGGAGAAGG + Intronic
930600346 2:53435704-53435726 GTGAGAATTTTCAGGGGACAAGG - Intergenic
932184192 2:69677879-69677901 ATGAGGGTCTTCAGGGGAGAAGG - Intronic
932396842 2:71454440-71454462 GACCAGACCTTCAGGGGAGAAGG - Intronic
932827653 2:74956609-74956631 ATGAGGGTCTTCAAGGGAGAAGG - Intergenic
937280474 2:120714095-120714117 GTGAAGAACCTGAGGGGTGAGGG + Intergenic
937891819 2:126944940-126944962 TTGAGGGTCTTCAGGGCAGAAGG + Intergenic
937914768 2:127093435-127093457 ATGAGGGTCTTCAGGGGTGAAGG - Intronic
938937233 2:136137772-136137794 ATGAAGGTCTTCAAAGGAGAAGG + Intergenic
938942132 2:136178623-136178645 ATTAAGGTCTTCAAGGGAGAAGG + Intergenic
939232907 2:139454176-139454198 GTGAAGTTTTTCTGGGGACAGGG + Intergenic
939450294 2:142364901-142364923 GTGAAGATCTGGAGGAGAAATGG + Intergenic
941465063 2:165815796-165815818 GTGAAAAAGTTCAAGGGAGAGGG - Intergenic
941877292 2:170447053-170447075 ATGAGGGTCTTCAGGGGAGAAGG + Intronic
942929747 2:181475365-181475387 GTTTAGATGTTCAGAGGAGAGGG + Intronic
943491158 2:188557930-188557952 GTGAAGCTGTTCAGGGCAGTGGG + Intronic
943793811 2:191966596-191966618 TTGAAAATTTTCAGGGCAGAAGG + Intronic
943797789 2:192018659-192018681 GTGAATATCATCAGGGGATTTGG - Intronic
946451372 2:219782872-219782894 GTGCAGAGGATCAGGGGAGAGGG + Intergenic
947367099 2:229407779-229407801 TTGAAGAACTGCAGGGGAGAGGG + Intronic
947797501 2:232904224-232904246 GTGAGGCTCTCCAGGGGAGCAGG - Intronic
947847818 2:233259738-233259760 GGGAAGATCTAGAGGGAAGAAGG - Intronic
948880748 2:240856051-240856073 GGGAAGGTCTTCAGGGGCCAAGG + Intergenic
1168833034 20:857758-857780 GTGAAGGACGTGAGGGGAGAGGG + Intergenic
1169595041 20:7188852-7188874 GTGAAAATTTTTAGAGGAGATGG + Intergenic
1170750983 20:19144847-19144869 GTGAACATCTTTAGGGAAGGGGG - Intergenic
1170985823 20:21257306-21257328 GGGAAGGACTTCAGGGAAGAGGG + Intergenic
1171092208 20:22296005-22296027 CTGAATGTCTTTAGGGGAGATGG + Intergenic
1172663314 20:36582274-36582296 GTTAACATCTTGCGGGGAGATGG - Intronic
1174332268 20:49829838-49829860 GTGAAGAAGATCATGGGAGATGG + Intronic
1174770991 20:53300207-53300229 GTAATGATCTTTAGGAGAGAGGG + Intronic
1175039623 20:56035905-56035927 GTGAACATCTTTAGGGGTGAGGG + Intergenic
1175590785 20:60190274-60190296 ATGAGGAACTTCAGGGGAGAAGG - Intergenic
1178195198 21:30337026-30337048 GTGAAGATCTGTAGGGGAGATGG - Exonic
1181668967 22:24416928-24416950 GTGCAGAGCTGCAAGGGAGAGGG + Exonic
1181901721 22:26161515-26161537 GTGAAAAACTTCTAGGGAGAAGG + Intergenic
1182440545 22:30361398-30361420 ATGAGGGTCTTCAGGGGAGGAGG + Intronic
1183027877 22:35079750-35079772 GTGAAGGTGATCTGGGGAGAGGG + Intronic
1183077845 22:35438047-35438069 GTAAAGATCTTCCAGGCAGAAGG + Intergenic
1183225780 22:36548996-36549018 GTGAAGATCAACAGGGACGAGGG - Intergenic
1184158579 22:42684809-42684831 ATGAAGATCTTCAGGGGTCTTGG - Intergenic
1184175214 22:42785183-42785205 GTGAACAGCTTCCAGGGAGAAGG - Intergenic
1184561850 22:45268362-45268384 GGGAAGATCTTCCAGGCAGAGGG - Intergenic
949152073 3:781373-781395 GTGACCTACTTCAGGGGAGAAGG - Intergenic
949397109 3:3626413-3626435 GAGAATATCTTCAGTGTAGAGGG - Intergenic
949563304 3:5222463-5222485 GTGAAGATCAACAGTGAAGAAGG + Intergenic
950469100 3:13173646-13173668 ATGAAGATCTTCAGGGGGTTGGG - Intergenic
950528733 3:13540172-13540194 GTGAAGATACTCAGGACAGAGGG + Intergenic
950557580 3:13704743-13704765 GTGGAGACCTTCATGTGAGAAGG + Intergenic
950633405 3:14298975-14298997 CAGCAGATCTACAGGGGAGATGG - Intergenic
950892311 3:16414897-16414919 TTGGAGAGCCTCAGGGGAGATGG + Intronic
951755363 3:26085490-26085512 ATGAGGATCTTCATGGGAGAAGG - Intergenic
953403184 3:42644784-42644806 GTGGAGATCTGCAGGGTAGATGG - Intronic
954458995 3:50615820-50615842 GTGCAGATGTTGAGTGGAGATGG - Intronic
955651046 3:61194151-61194173 ATGAGGATCTTCAAAGGAGAAGG + Intronic
955715825 3:61828727-61828749 GTGAAGACCTCCAGGGGACAGGG + Intronic
956782274 3:72613387-72613409 GCCAAAATCTCCAGGGGAGATGG - Intergenic
957840804 3:85666735-85666757 GTGAAGATCTTCAGGGGAGAAGG + Intronic
958192942 3:90206081-90206103 TTGAAGGTCTTCATGGGAGATGG + Intergenic
958416242 3:93877033-93877055 TTGAAGGTCTTCATGGGAGATGG + Exonic
960507671 3:118513165-118513187 AAGAGGGTCTTCAGGGGAGAAGG - Intergenic
960965858 3:123104296-123104318 CTGGAGTTCTTCAGGGCAGAGGG + Intronic
961125001 3:124409459-124409481 GTGAAGCTCTTCATGCCAGAGGG + Intronic
961332314 3:126149804-126149826 GGGAAGACCTTCAAGAGAGAAGG - Intronic
962686892 3:137856604-137856626 CTTAAGATCTTCAGGGGTGATGG - Intergenic
962878237 3:139552415-139552437 CTCAAGATGTTCAGGGGAGAGGG + Intergenic
964764905 3:160170266-160170288 ATGAAGGTCTTCAAGGGAGAAGG + Intergenic
965125682 3:164626585-164626607 ATGAAGGTTTTCAGGGAAGAAGG - Intergenic
965183896 3:165438345-165438367 TTTATGATCTTCAGGGGAGAAGG + Intergenic
965457688 3:168924344-168924366 ATTAGGGTCTTCAGGGGAGAAGG - Intergenic
967544620 3:190710202-190710224 GTGAAGGTCTAGAGGGGAGTTGG + Intergenic
968609293 4:1549801-1549823 GTGGAGCTTGTCAGGGGAGATGG + Intergenic
968922596 4:3530432-3530454 GTGAAGTTCTTCGGGGGTGAGGG - Intronic
969238462 4:5884345-5884367 GTGAAGATGATCAGGAAAGAAGG - Intronic
971232103 4:24808378-24808400 GTGAAAACCTGAAGGGGAGAGGG - Exonic
971628784 4:28961480-28961502 GTGACCTGCTTCAGGGGAGAAGG - Intergenic
975448090 4:74491339-74491361 ATGAAGATCAACAGCGGAGAGGG - Intergenic
977411750 4:96674958-96674980 TGGAGGATCTTCAGAGGAGAAGG - Intergenic
980515159 4:133847676-133847698 ATGAAGGTCTTCAGGGGAGAAGG + Intergenic
980532832 4:134076448-134076470 GGGAACATCTTCAGTGCAGAAGG + Intergenic
981601706 4:146496505-146496527 ATGAGGGTCTTCAGGGGAGAAGG - Intronic
982810056 4:159814075-159814097 GTGAAGAGTTCCAGGGGATATGG + Intergenic
983640820 4:169942575-169942597 GTGAGGATTTTCAGGGGAGGAGG - Intergenic
984519392 4:180784148-180784170 ATGAAGGTCTTCATGGGAGAAGG + Intergenic
984606935 4:181796498-181796520 CTGAAGATCTTCAAGGCAGAGGG + Intergenic
985052860 4:186010207-186010229 ATGAAGATCATCAAGGGAGAAGG + Intergenic
986313925 5:6573516-6573538 ATCAAGATCTTCAAGAGAGAAGG - Intergenic
987297581 5:16567651-16567673 GAGAAGATCTTCAAGAGAGCTGG + Intronic
987488067 5:18545089-18545111 GTGAAGATCTTCAATGAATAGGG - Intergenic
988205836 5:28132720-28132742 GTGAATATATAAAGGGGAGAGGG + Intergenic
988690014 5:33562452-33562474 GTGAGGATGAGCAGGGGAGAGGG - Intronic
988720830 5:33877604-33877626 GTGAAAATGTTGATGGGAGAAGG + Intronic
990003581 5:50922029-50922051 GTGGAGCTTGTCAGGGGAGATGG - Intergenic
990052752 5:51528246-51528268 GTGAAGTTGTTGCGGGGAGAAGG + Intergenic
992752027 5:79870637-79870659 GTCTAGGTCTTCAGGGGAAATGG + Intergenic
994994233 5:107039191-107039213 ATGAGGGTCTTCAGGGGAGAAGG + Intergenic
995083926 5:108086133-108086155 ATGAGGATCTTCAAGGGAGAAGG - Intronic
995083941 5:108086223-108086245 ATGAGGATCTTCAAGGGAGAAGG - Intronic
995256062 5:110048247-110048269 GAGACAAGCTTCAGGGGAGATGG + Intergenic
999200164 5:149810530-149810552 TTGCAGATCTTCAGTGGATAAGG + Intronic
1002187230 5:177460000-177460022 GGGAAGAGCTTCAGGAGAGGCGG + Intronic
1002370111 5:178745241-178745263 GTCAAAGTCTTCTGGGGAGAGGG + Intergenic
1002931493 6:1637969-1637991 GAGAAGACCCTCAGGGGAGGTGG - Intronic
1003801192 6:9669270-9669292 GTGAAGATCTGCAGGAGAGGTGG - Intronic
1004028567 6:11843377-11843399 GTGAAGATCTTGGGGACAGATGG - Intergenic
1005010302 6:21329349-21329371 ATGAGGGTCTTCAGGGGAAAAGG - Intergenic
1005125487 6:22442264-22442286 GTGACCTGCTTCAGGGGAGAAGG - Intergenic
1007109036 6:39302418-39302440 ATGAAGTTCTTCAGAGGAGCTGG + Intronic
1007209543 6:40181251-40181273 ATGAAGGTCTTCAAGGGAAATGG - Intergenic
1007872285 6:45053955-45053977 CTGATGGTCTTCAGGGGAGAAGG - Intronic
1007931944 6:45699622-45699644 GTGAACATCTACATGGGAAATGG + Intergenic
1009027361 6:58016047-58016069 ATGAGGGTCTTCAGGAGAGAAGG - Intergenic
1009902764 6:69828964-69828986 GTTAAGATCATCAAGGCAGAGGG + Intergenic
1010465264 6:76160629-76160651 GGGAAGATCTTCAAGGCAGAGGG + Intergenic
1010972044 6:82273349-82273371 ATGAGGATCTTCAAGGAAGAAGG + Intergenic
1011101938 6:83731852-83731874 ATGAAGATCTTCAAGGGAAAAGG + Intergenic
1011547689 6:88499242-88499264 GGGAAGATCCTCAGGTGAAAGGG + Intergenic
1012279515 6:97312174-97312196 GTGGAAATCTTCATGGGAGGGGG - Intergenic
1013758700 6:113490683-113490705 ATGAAGATTTCCAGTGGAGAAGG - Intergenic
1014060178 6:117063136-117063158 GTAAAGTTTTTCTGGGGAGAGGG + Intergenic
1015444630 6:133288648-133288670 GTGATGCTTTTAAGGGGAGATGG + Intronic
1016805214 6:148205624-148205646 GTGAAGTTCTTCTGGGGACTAGG - Intergenic
1017090719 6:150756280-150756302 TTGAGGATCTGCAGGGGAGCAGG - Intronic
1017693927 6:156995046-156995068 GTGAGGATCTTCAGCAGAGGAGG + Intronic
1018333647 6:162760944-162760966 GTGAATAAATTCAGGGTAGATGG + Intronic
1018567637 6:165172319-165172341 GTGAAGATCTTCAGGAAAAATGG - Intergenic
1019671009 7:2278298-2278320 CGGCAGATCTGCAGGGGAGATGG + Exonic
1023480134 7:40625309-40625331 GTGAAGATTTTCAGGGCAGTAGG + Intronic
1023708048 7:42963030-42963052 ATGAAGATCAACAGAGGAGAAGG - Intergenic
1024288117 7:47777930-47777952 GTGAGGAGCTGCAGGGGAGGTGG + Intronic
1024983868 7:55179522-55179544 GGGAAGCTCTCCTGGGGAGAAGG + Intronic
1026807211 7:73435934-73435956 GTGAGGCTCATTAGGGGAGATGG + Exonic
1027218177 7:76197585-76197607 GGGAGCAGCTTCAGGGGAGAAGG - Intergenic
1027560624 7:79724436-79724458 GTGAAGGTCTTCAGAAGAGAAGG + Intergenic
1029028847 7:97447733-97447755 ATGAAGTTCTTTAGGGCAGATGG - Intergenic
1029464607 7:100717351-100717373 GTGAAGAGCTTGATGGGAGGGGG - Intergenic
1029897176 7:103995372-103995394 GTGATGGTCTTCAAAGGAGATGG + Intergenic
1029927306 7:104330413-104330435 GGGAAGGTTTTCTGGGGAGAGGG + Intronic
1030187597 7:106778840-106778862 GTGAAAGCCTTCTGGGGAGATGG - Intergenic
1031491385 7:122393904-122393926 GTCAGGACCTTCAGGGGAGCTGG - Intronic
1032627367 7:133606391-133606413 GTGAAGATATTCAGGATATAAGG - Intronic
1033609211 7:142949706-142949728 GTTAAGATCCTGAAGGGAGAAGG - Intronic
1033711600 7:143951675-143951697 GTGGAGTTTTTGAGGGGAGAGGG + Intergenic
1033832667 7:145272325-145272347 GTGAGAATCTTCAGGGAAGAGGG + Intergenic
1034026168 7:147707468-147707490 ATGAAGATTTTCTGGGGACAGGG + Intronic
1035215744 7:157365358-157365380 GTGAAGACTGTCAGTGGAGAGGG + Intronic
1037281850 8:17250056-17250078 GTGAGGGTCTTCAGGGCGGAAGG + Intronic
1038440151 8:27565812-27565834 GCTCAGATCTTCAGTGGAGATGG - Intergenic
1039277901 8:35953194-35953216 GAGAAGATCGTCAGAGGTGAAGG - Intergenic
1039314155 8:36353279-36353301 GTGAATATATTCATGGGATATGG - Intergenic
1040896722 8:52375829-52375851 GTGAAGAGCTGCGGGGGAGCTGG - Intronic
1042938353 8:74082936-74082958 GTGATCTGCTTCAGGGGAGAAGG + Intergenic
1043523796 8:81074313-81074335 GTGAGGATCATGAGGGAAGAGGG + Intronic
1043664048 8:82785830-82785852 CTTAACAACTTCAGGGGAGAGGG + Intergenic
1043908746 8:85836291-85836313 GCGGAGTTCTTCAGGGCAGAGGG + Intergenic
1045385061 8:101664673-101664695 TGGAAGATCTTTAGGAGAGAGGG + Intronic
1047301012 8:123613413-123613435 TTGAGGATCTTCAAGGGAGAAGG + Intergenic
1047483285 8:125305072-125305094 GGGAAGATCTTCAGAAGTGAAGG + Intronic
1049702161 8:144020257-144020279 GAGAGGTTCTTCAGCGGAGAGGG - Intronic
1049702917 8:144023194-144023216 GAGAGGGTCCTCAGGGGAGAGGG - Intronic
1049703349 8:144024764-144024786 GGGTAGGTCTTGAGGGGAGAGGG - Intronic
1051552482 9:18345697-18345719 GAGAATATCCTCAGGGCAGATGG + Intergenic
1051618295 9:19027602-19027624 GTGCAGATGTTCACTGGAGATGG + Intronic
1051871813 9:21746686-21746708 ATGAGGACCCTCAGGGGAGAAGG + Intergenic
1051944227 9:22547064-22547086 GTGAAGATGTGGAGAGGAGATGG - Intergenic
1053030859 9:34777044-34777066 GTGAAGATTTTCTGGGGATGGGG + Intergenic
1055502588 9:76916392-76916414 ATGAGTGTCTTCAGGGGAGAAGG - Intergenic
1056553890 9:87673493-87673515 TGGAAGATGTGCAGGGGAGAGGG + Intronic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1057930950 9:99192482-99192504 CTGAAGATCTTCAGGGCTAAGGG - Intergenic
1058203445 9:102072427-102072449 GTGAAAATTTTCAGGTGAGGGGG - Intergenic
1060404804 9:123367933-123367955 GGGATGGTCTTCAGGGAAGACGG + Intronic
1061064288 9:128267768-128267790 GTGCACAACTTCAAGGGAGAAGG + Intronic
1185956531 X:4497125-4497147 ATGAAGTTCTTCAGGGAAGAAGG - Intergenic
1186748159 X:12592072-12592094 ATGAAGGTCTTCAAGGGAGAAGG - Intronic
1187502934 X:19854719-19854741 GGGAAGATCGTGTGGGGAGATGG - Intronic
1188562002 X:31479298-31479320 GTAAAGCTATTCTGGGGAGATGG + Intronic
1189104126 X:38219870-38219892 GCGAAGAGCTTCAGGGGAGTAGG - Intronic
1189615513 X:42779102-42779124 GGGAAGAATTTAAGGGGAGAAGG - Intergenic
1189701987 X:43721256-43721278 GTGAAGGCCTTGAGGTGAGAAGG + Intronic
1189861143 X:45273691-45273713 ATGAGGGTCTTCAAGGGAGAAGG + Intergenic
1190292305 X:49001073-49001095 GGGGAGATCTTGAGGGGAGTGGG - Intronic
1190457908 X:50643431-50643453 GTTAAGACCTTCTGGGGCGAGGG + Intronic
1194051727 X:89077839-89077861 GTGGAGTTCTTCAGGGAACAGGG + Intergenic
1195202917 X:102566814-102566836 GTGAAGATCAGCATGGGAAATGG + Intergenic
1195508004 X:105681108-105681130 ATGAAGGTCTTCAAGGGAAAGGG + Intronic
1195992014 X:110692180-110692202 GTCCAAATGTTCAGGGGAGATGG - Intronic
1198459211 X:136847306-136847328 GAGAAGGTCTCCAGGGGTGAGGG - Intergenic
1201224052 Y:11799844-11799866 ATGACCAGCTTCAGGGGAGAAGG - Intergenic