ID: 957842754

View in Genome Browser
Species Human (GRCh38)
Location 3:85692931-85692953
Sequence AAGAAAAATCAGAAGGAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1483
Summary {0: 1, 1: 1, 2: 8, 3: 142, 4: 1331}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957842749_957842754 13 Left 957842749 3:85692895-85692917 CCCACATACTTCACTGGTTGTTC 0: 1
1: 0
2: 1
3: 7
4: 126
Right 957842754 3:85692931-85692953 AAGAAAAATCAGAAGGAGGCCGG 0: 1
1: 1
2: 8
3: 142
4: 1331
957842747_957842754 30 Left 957842747 3:85692878-85692900 CCTCTCAAATTTCTTCTCCCACA 0: 1
1: 0
2: 2
3: 37
4: 411
Right 957842754 3:85692931-85692953 AAGAAAAATCAGAAGGAGGCCGG 0: 1
1: 1
2: 8
3: 142
4: 1331
957842750_957842754 12 Left 957842750 3:85692896-85692918 CCACATACTTCACTGGTTGTTCT 0: 1
1: 0
2: 2
3: 16
4: 185
Right 957842754 3:85692931-85692953 AAGAAAAATCAGAAGGAGGCCGG 0: 1
1: 1
2: 8
3: 142
4: 1331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957842754 Original CRISPR AAGAAAAATCAGAAGGAGGC CGG Intronic
900077848 1:832535-832557 AAGAAAAAAAAGAGGGAGGAAGG - Intergenic
900106757 1:984798-984820 ATAAAAAATGAAAAGGAGGCCGG - Intergenic
900195992 1:1375684-1375706 AAAAAAAATAAGACGCAGGCTGG + Intergenic
900587076 1:3438117-3438139 AAGACCATTGAGAAGGAGGCTGG + Exonic
900769458 1:4529009-4529031 AAGAAAGAACACAGGGAGGCCGG + Intergenic
901382219 1:8882044-8882066 AAGAAAAAAGAAATGGAGGCCGG + Intergenic
901396042 1:8982341-8982363 CAGAAAAATCATAAGGAGGGGGG + Intergenic
901520342 1:9779040-9779062 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
901793598 1:11667585-11667607 AAAAAAAATCAGATGGAGGGTGG - Intronic
901837392 1:11933398-11933420 AAGAAACCTCAGACAGAGGCCGG - Intergenic
901860868 1:12073500-12073522 AAGAAAGAAGAGAAGGAGGGAGG - Intronic
902088744 1:13884935-13884957 AAGAAAAAGAAGAAGAAGGAAGG - Intergenic
902190193 1:14757288-14757310 AAGAGAAAGCAGGAGCAGGCAGG - Intronic
902546194 1:17191979-17192001 AAGAAAAAGGAGAAGGAAGAGGG - Intergenic
902558420 1:17260722-17260744 AAGAAAACTAAGAAGGAGAAGGG + Intronic
903053179 1:20616674-20616696 ATGAAAAAGCTGAAGGAGGCAGG + Intronic
903293763 1:22330859-22330881 AAGAAAAATAGGAATGAGGGAGG + Intergenic
903545312 1:24120306-24120328 GAAAAGAACCAGAAGGAGGCTGG - Exonic
904087203 1:27917165-27917187 AAAATAAATCAGATGGTGGCGGG + Intergenic
904139640 1:28342462-28342484 AAGAAAAAAAATAAAGAGGCTGG - Intergenic
904348512 1:29889856-29889878 AGGAGAAATGGGAAGGAGGCAGG + Intergenic
904501321 1:30914456-30914478 AGGAAAAAACAGAGGGAGCCTGG + Intergenic
904560682 1:31395206-31395228 AAGAAGAAGAAGAAGAAGGCGGG - Intergenic
904570081 1:31457075-31457097 AAGAAAATTCAGAAGGAAAATGG - Intergenic
904696537 1:32334847-32334869 AAGAGAAATCGGAAGGAGGGTGG - Exonic
904867696 1:33594492-33594514 AAGAGAAATAAAAAAGAGGCTGG - Intronic
904953170 1:34260791-34260813 AAGAAAAAGGAGAAGGAGAAAGG + Intergenic
905021593 1:34818731-34818753 ATCTAAAATCAGAATGAGGCCGG + Intronic
905063705 1:35161690-35161712 AAAAAAAAACAGAAATAGGCCGG + Intergenic
905069914 1:35216579-35216601 AAGAGAAAAGAGAAAGAGGCGGG - Intergenic
905400089 1:37695224-37695246 AAGAAAAATAAGCAGAGGGCAGG + Intronic
905418298 1:37820067-37820089 AATAAAAACCACATGGAGGCGGG + Intronic
905618608 1:39420369-39420391 AAGAAAAATCAGATAGAGGCAGG - Intronic
906227106 1:44131089-44131111 TAGAAAAGCCAGAATGAGGCCGG - Intronic
906269801 1:44467504-44467526 AAGAAAAGTCTGAAGCAGCCAGG - Intronic
906403749 1:45524821-45524843 AACAAAAGTCTGAAGGCGGCCGG - Intergenic
907146396 1:52236932-52236954 AAAAAAAATAAGAATGAAGCAGG - Intronic
907488671 1:54794888-54794910 AATAAAAGTCACAAGGTGGCAGG + Intronic
907513225 1:54977877-54977899 AAAAAAAAGAAGAAGAAGGCAGG + Intergenic
907773904 1:57493725-57493747 AAGAAGAAAAAGAGGGAGGCAGG + Intronic
907904687 1:58773558-58773580 AAGTGAAGTCAGAAAGAGGCAGG - Intergenic
908043410 1:60141488-60141510 ATGGAAAAGCAGAAGGAAGCTGG + Intergenic
908424373 1:63991570-63991592 AAGGAAAGACAGAAAGAGGCAGG + Intronic
908776958 1:67649701-67649723 AAGGAGAATCAGGAGGAGGTAGG + Intergenic
908786858 1:67743607-67743629 AAGCAAATTCAAATGGAGGCAGG - Intronic
909339141 1:74511996-74512018 AAGGAAAATCGGAAGGAAGAGGG + Intronic
909528866 1:76658997-76659019 AACAAAAATTAGAAGTAGTCAGG + Intergenic
909655345 1:78025555-78025577 AACTAAAATCAAAAGCAGGCAGG - Intronic
909829070 1:80162590-80162612 AGGAAACAGCAGAAGGAGGATGG + Intergenic
909993176 1:82248255-82248277 AAAATAAATAAGAAGGAGTCAGG - Intergenic
910187265 1:84557557-84557579 AAAAAAAAAAAGAAGGAGGCTGG + Intronic
910443171 1:87273631-87273653 AAGAAATAGCAGAACTAGGCTGG - Intergenic
910499288 1:87871070-87871092 AAGAAAGAAAAGAAGGAGGGTGG + Intergenic
910634436 1:89391442-89391464 TAGAAAATTCAGCAGGAGGTGGG - Intergenic
910893744 1:92045278-92045300 AAAAAAAATCTGAAATAGGCCGG - Intronic
910896888 1:92079299-92079321 AAAAAAAAAAAAAAGGAGGCGGG - Intergenic
911122745 1:94312423-94312445 AAAAAAAAAAAGAAGGAGGGGGG - Intergenic
911214566 1:95178241-95178263 AATAAAAATTAAAAAGAGGCCGG - Intronic
911766203 1:101678146-101678168 AAAAAAAATCAGGCCGAGGCGGG + Intergenic
912214210 1:107589114-107589136 AAGAAAAATTAGAATAAGGATGG + Intronic
912228636 1:107766238-107766260 AAGAAGAAGAAGAAGGAGGAGGG - Intronic
912796597 1:112697157-112697179 AAGAAAAATAGGGAGGAGGTCGG + Intronic
912839454 1:113026049-113026071 AACAAAAATGACAAGGGGGCCGG + Intergenic
912918023 1:113837149-113837171 AAGAAGAAAGAGAAGGAAGCAGG + Intronic
912972671 1:114298730-114298752 CAGAGAAACCAAAAGGAGGCTGG - Intergenic
912983953 1:114406956-114406978 AAGAAAAAACAGAGGATGGCAGG - Exonic
913232648 1:116754518-116754540 ATTGAAAATCAGAAGGAAGCTGG - Exonic
913377596 1:118170889-118170911 TAGAAAGAGCAGAAGCAGGCAGG + Intronic
913461315 1:119088901-119088923 AGGAAAGATCAGAAGGAAGTAGG - Intronic
913477378 1:119251454-119251476 ATTAAAAATCAAAAAGAGGCCGG + Intergenic
913703045 1:121392294-121392316 AAGAAAAGTAAAAAGGAGGAGGG - Exonic
913705739 1:121420714-121420736 TAGAAAAATGAGAAGGAGCCAGG + Intergenic
914198512 1:145463953-145463975 AAGAAGGATACGAAGGAGGCAGG - Intergenic
914262639 1:146011794-146011816 ATGAAAAAGCTGAAAGAGGCAGG - Intergenic
914477620 1:148037082-148037104 AAGAAGGATACGAAGGAGGCAGG - Intergenic
914511102 1:148332833-148332855 AAGAAGGATATGAAGGAGGCAGG - Intergenic
914576828 1:148979499-148979521 AAGAAAAAGCAGAGAGAAGCTGG - Intronic
914840128 1:151241504-151241526 AAGAAAAAGAAAAAGGGGGCAGG + Intronic
914850192 1:151308453-151308475 AAGAAAAAGCAGATGGAAGGAGG + Intronic
915075972 1:153308288-153308310 ATGAAGAAAGAGAAGGAGGCTGG - Intronic
915562735 1:156696877-156696899 AGGAAAAGCCAGCAGGAGGCTGG - Intergenic
915594692 1:156889686-156889708 AAGTTAAATCAGTAGGAGGCTGG + Intergenic
915662501 1:157415878-157415900 AAGGAGAGTCAGACGGAGGCAGG - Intergenic
916472731 1:165139776-165139798 AAGAAAAAAGAAAAGGAGGTGGG + Intergenic
916534864 1:165694211-165694233 AAAAAAAAAAAAAAGGAGGCAGG + Intronic
916544630 1:165792110-165792132 AAGAAAAACCATATGGAGTCAGG - Intronic
916914931 1:169396255-169396277 TAGAAAAACAAAAAGGAGGCTGG + Intronic
917514883 1:175699001-175699023 AGGCAAGATCAGAAGGAAGCAGG + Intronic
918304311 1:183232152-183232174 AGGAAAGATCAGAACGAGGGTGG - Intronic
918354211 1:183690778-183690800 AAGAAAAATCAGTGGGAGAATGG - Intronic
918560119 1:185855414-185855436 AATAAAAAGAAGAAGCAGGCAGG - Intronic
918572315 1:186011338-186011360 ATTAAAAATCAGCAGTAGGCTGG - Intronic
919155258 1:193756534-193756556 AGGACAATTCAGAAGGTGGCAGG + Intergenic
919457960 1:197842330-197842352 AAAAAAAAACAGAAGCAGGGAGG - Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919908843 1:202097498-202097520 AAAAAAAAAAAAAAGGAGGCAGG - Intergenic
920222064 1:204411401-204411423 AAGAAAAAGGAGATGGAGCCGGG - Exonic
920947335 1:210542028-210542050 AAGAGAAAGCAGAAGGAAGGAGG - Intronic
921703757 1:218296070-218296092 AGGTAAAATCAGAATGAGGATGG + Intronic
922094061 1:222426368-222426390 AATAAAAATCAAAAGCAAGCAGG + Intergenic
922233070 1:223702882-223702904 AAGAAAAACCAGGAGAAGGAGGG + Intronic
922254319 1:223879257-223879279 GAGAGAAATCAGATGGTGGCTGG - Intergenic
922308249 1:224363338-224363360 TAGAAAATTCAAAAGAAGGCTGG - Intronic
922350733 1:224732946-224732968 AAGAAAAAAAAGAATGAGGAGGG + Intronic
922858952 1:228799026-228799048 ATGAAAAATCTCAAGGTGGCTGG + Intergenic
923457191 1:234174716-234174738 AAGAAATGTGAGCAGGAGGCTGG + Intronic
923610976 1:235493479-235493501 AAGAAAATTCACAACTAGGCCGG + Intronic
923694430 1:236233313-236233335 AAAAAAAAAAAGAAGAAGGCTGG + Intronic
923701835 1:236307149-236307171 TTGAAAAATCTGAAGGAGCCAGG + Intergenic
923809356 1:237295293-237295315 CAGGAAAGTCAGAAGGAGGAAGG + Intronic
923842126 1:237684230-237684252 CAGAAATATCTGAACGAGGCCGG - Intronic
924247700 1:242100787-242100809 AAGAAAAAAAAAAAGGGGGCAGG + Intronic
924494597 1:244575142-244575164 AAGGAAAATCAGAAAGAAACAGG - Intronic
924586238 1:245363490-245363512 AAGAAAAGAGAAAAGGAGGCCGG - Intronic
924660034 1:246007511-246007533 AAGAAAAGGCAGAAGGAGGCCGG + Intronic
1062879422 10:966156-966178 GAGAAAAAGAAGAAGGAGGCTGG + Intergenic
1063408119 10:5815482-5815504 AAAAAAAATTAGCTGGAGGCCGG + Intronic
1063446113 10:6118462-6118484 AAGAAAAAAAAAAAGGAGGCCGG - Intergenic
1063568614 10:7194137-7194159 AAGCAAACTCAGAACGAAGCAGG - Intronic
1063661653 10:8038269-8038291 AAGATAAATGAAAAGGAGGGTGG - Intergenic
1063683111 10:8209402-8209424 AAGAGAGATCAGGAGCAGGCTGG + Intergenic
1063771494 10:9207796-9207818 ATTAAGAACCAGAAGGAGGCTGG - Intergenic
1063847582 10:10148200-10148222 TATAAAAATCACATGGAGGCTGG + Intergenic
1063954533 10:11254209-11254231 AAAAAAACTCAGAAGAAAGCCGG + Intronic
1063998670 10:11644305-11644327 AAGAATAACCAGAAAGAGGCCGG - Intergenic
1064104635 10:12490550-12490572 AAGAAAAACCACAAAGAGGCTGG + Intronic
1064743603 10:18457592-18457614 AAGAAAAATTAGGAGAGGGCCGG + Intronic
1064971041 10:21067465-21067487 AAGAGAAAGCAGGAGGAGGGAGG + Intronic
1064978643 10:21144427-21144449 AAATAAAATCAGAATGGGGCCGG + Intronic
1064985172 10:21202759-21202781 AAGAAAAATTAGAAGGTGGAAGG - Intergenic
1065184289 10:23157064-23157086 AAGAAAAATAGAAAGGAAGCAGG + Intergenic
1065743735 10:28819682-28819704 AAAAAAAAAAAAAAGGAGGCGGG + Intergenic
1065830959 10:29613184-29613206 AAAAAAAAGAAGAAGGAGGAGGG + Intronic
1065881390 10:30040483-30040505 AAGGCAAATGAGAACGAGGCTGG - Intronic
1065883926 10:30060214-30060236 AAAAAAAGTCTGAAGGAGTCTGG + Intronic
1066782144 10:38963069-38963091 AAGACAAATGAGAAGGGGGCAGG + Intergenic
1066954973 10:42157561-42157583 AAGACAAATGAGAAGAGGGCAGG - Intergenic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1067235033 10:44439862-44439884 CAGAAACATCAGATGGAAGCTGG - Intergenic
1067961567 10:50857891-50857913 AAGAGAACCCAGCAGGAGGCTGG + Intronic
1068110986 10:52680805-52680827 AAGAAAAAAAAGATGGAGGGTGG + Intergenic
1068299186 10:55116737-55116759 AAGAAACAGCAGAAGCAGGAAGG + Intronic
1068319734 10:55396579-55396601 AAGAAATATTAGAATGATGCAGG + Intronic
1068416963 10:56735304-56735326 AAGGAAAGACAGAAGAAGGCAGG - Intergenic
1068451928 10:57201701-57201723 AAAAAAAAGCAGAAAAAGGCCGG - Intergenic
1068513791 10:58000674-58000696 AAGAAAGAGGAAAAGGAGGCAGG + Intergenic
1068521043 10:58077791-58077813 AAGAAAAAGAAGAAGAAGACAGG + Intergenic
1068771057 10:60821012-60821034 AAGAAAAATCACAAGGAAGGAGG + Intergenic
1068803753 10:61171666-61171688 AAGAAAAATGAGGAGGGGACTGG + Intergenic
1068836816 10:61564454-61564476 AAGAAAAAAAAGAAGGGGGACGG + Intergenic
1069015122 10:63420722-63420744 AAAAAAAAAAAAAAGGAGGCTGG + Intronic
1069131735 10:64712810-64712832 TATAAAAATCAGATGGAGCCAGG + Intergenic
1069145020 10:64880812-64880834 AAGAAAAAGCAGAATGTGGAAGG + Intergenic
1069204150 10:65660704-65660726 AAGATAATTCAGAAGAATGCTGG - Intergenic
1069456021 10:68554533-68554555 TAGAAAAAACTCAAGGAGGCTGG - Intergenic
1069926989 10:71857655-71857677 AAAAAAAAAAAGAAGGGGGCTGG - Intergenic
1070040384 10:72772398-72772420 AATAAAAATCAAAACAAGGCTGG + Intronic
1070168598 10:73915816-73915838 TACAAAACTGAGAAGGAGGCTGG + Intronic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070363819 10:75716698-75716720 GAGACACATGAGAAGGAGGCAGG - Intronic
1070364914 10:75727175-75727197 AAGAAAAATCAGGTGAAGGATGG - Intronic
1070385633 10:75921836-75921858 AGGAAGGATCAGAAGGAGGAAGG - Intronic
1070508956 10:77142069-77142091 AAGAAAAACCCTAAGTAGGCCGG + Intronic
1071040647 10:81305590-81305612 GAGATGAATCAGAAGAAGGCAGG + Intergenic
1071214394 10:83382962-83382984 AATTAAATTCAGAAGCAGGCTGG + Intergenic
1071241602 10:83712231-83712253 AAGAAAAGAAGGAAGGAGGCAGG + Intergenic
1071571076 10:86697515-86697537 AAGAAAAAAAAGAAGTTGGCCGG - Intronic
1071661506 10:87506763-87506785 GTGAAAAATTAGAAGTAGGCTGG + Intronic
1071957940 10:90779446-90779468 AACAAAAAGCAGGTGGAGGCAGG - Intronic
1072136628 10:92553125-92553147 AAGAAAAAGAAAAAGCAGGCTGG + Intronic
1072158008 10:92741335-92741357 GAGAAAAGTTACAAGGAGGCTGG + Intergenic
1072183693 10:93013659-93013681 TAGAAAAATCAGGATGATGCAGG - Intronic
1072437036 10:95423398-95423420 AAGAAAAATCAAAAGAAGAATGG - Intronic
1072841355 10:98777750-98777772 AAGAAGAAGGACAAGGAGGCAGG - Intronic
1072918780 10:99558071-99558093 AAAAAAAAAAAAAAGGAGGCTGG - Intergenic
1073140329 10:101242946-101242968 AAGAGAAAACAGCAGGAGCCAGG + Intergenic
1073359019 10:102882337-102882359 CAAAAAAATCAGAAGAAGCCAGG - Intronic
1073438988 10:103541305-103541327 AAGAAAAATAAGGAGGAAGCTGG + Intronic
1073560122 10:104489201-104489223 AAAAAAAAAAAAAAGGAGGCCGG - Intergenic
1073744414 10:106449051-106449073 AAAAAAAATAAGAAGTAGGAAGG - Intergenic
1073938197 10:108660749-108660771 AAGAAAAATCTGTTGGGGGCCGG + Intergenic
1073953558 10:108840001-108840023 AAGAAGAATAGGAAGGAGACAGG + Intergenic
1074079575 10:110156997-110157019 AAGAAAGATCAACAGGAAGCAGG + Intergenic
1074197912 10:111205612-111205634 TGGAAAAATCAGAAGAAGGAAGG - Intergenic
1074264692 10:111889819-111889841 AAGAAATATAAGAGGGAGGATGG - Intergenic
1074994979 10:118748948-118748970 AAGAAGAGTCAGGAGGAGGGAGG + Intronic
1075318570 10:121471258-121471280 AAAAAAAAAAAGAAAGAGGCCGG - Intergenic
1075397355 10:122137290-122137312 AAAAAAAAGCAGAATGAGCCTGG + Intronic
1076239053 10:128888783-128888805 AAGAAGGATGAGAATGAGGCAGG + Intergenic
1076339123 10:129730698-129730720 AAAAAAAATCAGAGGAGGGCAGG - Intronic
1076490758 10:130859725-130859747 ATGAAAATGCACAAGGAGGCCGG + Intergenic
1077827181 11:5823785-5823807 AGGAAAAAACAGAGGGAGACAGG - Intronic
1077866026 11:6222683-6222705 AAGAGAAATCAGGAGCAGACAGG + Intronic
1077966424 11:7138646-7138668 AAAAAAAATCAGAAATAGGCTGG + Intergenic
1078048552 11:7940775-7940797 GAGAAAAAGCATAAGGAGGAAGG + Intergenic
1078130650 11:8611559-8611581 AATAAAAATAAGAAGCAGGCTGG + Intergenic
1078173541 11:8950137-8950159 AAGAAAAAAAAAAAGGAGGCAGG + Intronic
1078213780 11:9293875-9293897 AAAAAGAATCAGAAGTAGCCAGG - Intronic
1078536988 11:12183158-12183180 AAGAAAAAAAAAAAGGAGTCAGG - Intronic
1079697081 11:23495355-23495377 AAGAAAGAAGAGAAGGAGGAAGG + Intergenic
1079975390 11:27084447-27084469 AAAAAAAATCTGAAGAGGGCAGG + Intronic
1080549872 11:33363733-33363755 AAGATAACACAGAAAGAGGCCGG + Intergenic
1081271948 11:41095572-41095594 AAGAACACTCAGAAAAAGGCAGG - Intronic
1081817772 11:45961290-45961312 ATGAAAAATCAAAGGTAGGCAGG + Intronic
1082031687 11:47609156-47609178 AAAAAAAATCTCAAGGAGCCCGG + Intergenic
1082042627 11:47698466-47698488 AATAAAAATAAGAATGTGGCTGG - Intronic
1082073757 11:47960725-47960747 AAAAAAAAAAAGATGGAGGCTGG - Intergenic
1082556880 11:54573823-54573845 AAGAAAAAGCACAAGGGGTCAGG + Intergenic
1082757916 11:57096455-57096477 AAGAAAAAAGAGAAGGGGTCTGG - Intergenic
1082880219 11:58029832-58029854 AAAAAAAAAAAGGAGGAGGCAGG - Intronic
1083386778 11:62316897-62316919 AACAAAAGTCAAAATGAGGCTGG + Intergenic
1083482395 11:62957992-62958014 AAAAAAAAGAAGAAAGAGGCTGG - Intronic
1083489166 11:63002204-63002226 AATAAAAATAAAAAAGAGGCTGG - Intronic
1083686223 11:64377177-64377199 AGAAAAAATCAGTAAGAGGCTGG + Intergenic
1083807041 11:65080638-65080660 GAGAGAAATCAGAAGGTCGCTGG - Intronic
1084346295 11:68551781-68551803 TATAAAAATAAAAAGGAGGCCGG - Intronic
1084508022 11:69581967-69581989 AGGATAATTCAGAAGGTGGCTGG - Intergenic
1084643676 11:70441707-70441729 AACAAAAACCACATGGAGGCTGG + Intergenic
1084653207 11:70500966-70500988 AAGAAACAACAGAATGAGGCAGG - Intronic
1084911913 11:72396277-72396299 GAGAAAAGGCAGAAGGAGGGAGG + Intronic
1085016913 11:73179705-73179727 TTAAAAAATCAGAGGGAGGCTGG - Intergenic
1085592241 11:77774753-77774775 AAGAAAAAAAAGAAAGAAGCAGG - Intronic
1085656941 11:78324091-78324113 AAAAAAATTCAGAGGGAGTCAGG - Intronic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086165425 11:83772435-83772457 AAAAAAAAAGAGAAGGAGGGAGG + Intronic
1086243350 11:84721554-84721576 AAAAAAAATCAGCATGTGGCTGG + Intronic
1086259616 11:84923432-84923454 AAGAAGAAGAAGAAGGAGGGGGG + Intronic
1087078446 11:94147584-94147606 AACAGAAACGAGAAGGAGGCTGG - Intronic
1087260639 11:96007405-96007427 TAGAAAATTCAGAATAAGGCAGG + Intronic
1087331120 11:96781859-96781881 AAGAAGATTCAGCAGAAGGCAGG + Intergenic
1087453587 11:98354298-98354320 AAGAAGCATCAGAAGGGGCCAGG - Intergenic
1087702335 11:101449474-101449496 AAGAAACAGCAGAAGCAGGAAGG + Intergenic
1087953946 11:104260157-104260179 TAGAAAAGTCACAAGGAGGAAGG + Intergenic
1088011157 11:105002420-105002442 AAGAAAAAGGAGAAGGAAGGGGG - Intronic
1088330918 11:108650541-108650563 AAAAAAAAGGAGCAGGAGGCAGG + Intergenic
1088623810 11:111714006-111714028 AGTATAAATCAGAACGAGGCAGG + Intronic
1088638128 11:111844298-111844320 ATAAAATCTCAGAAGGAGGCCGG - Intronic
1089028605 11:115298376-115298398 AAGAAGAAAGGGAAGGAGGCAGG + Intronic
1089089720 11:115861209-115861231 AAGAAAAAGTAGAAGGAGTAAGG + Intergenic
1089237257 11:117040940-117040962 AAAAAAAAAAAAAAGGAGGCAGG - Intronic
1089316868 11:117597749-117597771 ATGAAAAATCAGAATTAGCCAGG - Intronic
1089367225 11:117928312-117928334 AAGAAAAGTCAAGAGGGGGCTGG + Intronic
1089432025 11:118433112-118433134 AAAAAAATTTAAAAGGAGGCCGG - Exonic
1089559513 11:119336737-119336759 CAGAAAAACCAGAAGCAGACAGG - Exonic
1089575640 11:119440910-119440932 AAAAAACAGAAGAAGGAGGCCGG - Intergenic
1089879730 11:121762297-121762319 AAGAAAAATCAGGAGGGGATGGG + Intergenic
1090030515 11:123202239-123202261 CAGAAAAATCACAAGGTGTCTGG - Intergenic
1090568435 11:128021201-128021223 AAGAAAAAACATAAGGAGGAGGG + Intergenic
1090840559 11:130484212-130484234 AAGAAAAACGAAAAGGAGGAAGG + Intergenic
1090894009 11:130953089-130953111 AGGAAAAGACAGAAGGAGGAAGG - Intergenic
1091241186 11:134053544-134053566 AAGAATAAACAGCAAGAGGCAGG + Intergenic
1091939941 12:4470146-4470168 CACAAACATCAGATGGAGGCTGG + Intergenic
1091964153 12:4723852-4723874 TAAAAAAATCAGAAGTCGGCCGG + Intronic
1092035150 12:5327984-5328006 AAGAAAAAACAGGCCGAGGCGGG + Intergenic
1092089551 12:5793290-5793312 AAGAAAAATCAAGCAGAGGCTGG + Intronic
1092149532 12:6237653-6237675 AAGAAAAATGACAAGGAGAATGG - Intronic
1092388842 12:8057196-8057218 CAGAAAAATGAGAAGGTGGTAGG + Intergenic
1092714368 12:11373293-11373315 AAGAGAAATGAGCAGGAGGAAGG + Intronic
1092943918 12:13435807-13435829 AAGAAAAATCAAACCGCGGCAGG - Intergenic
1093077336 12:14771444-14771466 TTGAAAAAACAGAAGGAGGGAGG - Intergenic
1093461101 12:19407596-19407618 AAGAAAAAAGAGATGGAGGCTGG - Intronic
1093566126 12:20606140-20606162 AGGAAAAATCAGAAAAAGACTGG - Intronic
1093612031 12:21172625-21172647 AAGAAAAATCAGAAGGAAAGGGG - Intronic
1093683805 12:22032957-22032979 AGAAAAAAACAGAAGGAGGAAGG + Intergenic
1093773900 12:23049920-23049942 AACAAAAATGAGAAGGAAGGGGG + Intergenic
1094002919 12:25715691-25715713 AATAAATATCTGAAGAAGGCCGG + Intergenic
1094171490 12:27497442-27497464 TGGTAAAATCAGATGGAGGCTGG + Intronic
1094535100 12:31314196-31314218 AAGAAAAATCAGATCCAGCCTGG + Intronic
1095133917 12:38574918-38574940 AAGAAACATCAGACGTAGGCAGG + Intergenic
1095177467 12:39109965-39109987 GAGAAAAATCAAAAGAAGGATGG - Intergenic
1095214987 12:39537920-39537942 CAGATGAATCAGAATGAGGCAGG + Intergenic
1095650581 12:44604189-44604211 AAGAAGAAAGAGAAGGAGGGAGG + Intronic
1095694476 12:45129192-45129214 AAGAAAAAAGAAAAGGAGGCCGG + Intergenic
1095730287 12:45498940-45498962 AAGAAAAACCATATGTAGGCTGG - Intergenic
1096059320 12:48682901-48682923 AAAATAAATCAGACAGAGGCTGG + Intergenic
1096286118 12:50302076-50302098 AAAAAAAAAAACAAGGAGGCTGG + Intergenic
1096313583 12:50543931-50543953 AAAAAAAAAAAAAAGGAGGCTGG + Intronic
1096336814 12:50763334-50763356 AAGAAAAATCTGAGTAAGGCCGG + Intergenic
1096366567 12:51033267-51033289 AAAAAAAAAAAGAAGGAGGAGGG - Intergenic
1096511009 12:52128548-52128570 AAATAAAATCACAATGAGGCCGG + Intergenic
1096757081 12:53808657-53808679 AACAAAAAAAAGAGGGAGGCTGG - Intergenic
1096766980 12:53899321-53899343 AGGAAAAAGGAGAAGGAGGGAGG + Intergenic
1096793446 12:54059581-54059603 GAGAAAAATCAAAATGGGGCTGG - Intergenic
1096795013 12:54071341-54071363 AAGCAAAAACTGAAGGATGCTGG + Intergenic
1096831522 12:54318167-54318189 AAGAAGTAACAGAAAGAGGCTGG - Intronic
1096973925 12:55687784-55687806 AAGATAAATCAGATGCAGGCTGG - Intronic
1097003451 12:55897955-55897977 AAAAAAAAAAAGAAGAAGGCTGG + Intergenic
1097012675 12:55964600-55964622 AAGAAAAGAGATAAGGAGGCCGG - Intronic
1097986305 12:65786376-65786398 AAGAAAAATGAAAAGAAGGAAGG - Intergenic
1098193824 12:67978385-67978407 AAGAGAAAACAAAAGGAGTCAGG - Intergenic
1098495878 12:71135279-71135301 AAGAAGAAGAAGAAGGAGGAGGG + Intronic
1098536022 12:71594392-71594414 TGGAAAAATCAGTAAGAGGCTGG + Intergenic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1098884763 12:75949395-75949417 AAGAAAAAAAAAAAAGAGGCCGG - Intergenic
1099011382 12:77295326-77295348 TGGAGAAATCAGAAGTAGGCAGG + Intergenic
1099118370 12:78656191-78656213 AAGAAAAATTAGAAACAAGCTGG + Intergenic
1099157900 12:79202521-79202543 AAGAAGAAAGAGAAGGAGTCAGG + Intronic
1099398439 12:82170982-82171004 AAGAAAAAGAAGGAGGAGGAGGG + Intergenic
1099571127 12:84320247-84320269 AAGAAACATAAAAAGGAGGATGG - Intergenic
1100193737 12:92220480-92220502 AATACAGATCAGAAGGAGGTAGG + Intergenic
1100207186 12:92363590-92363612 GAGAAGAATGAGGAGGAGGCAGG - Intergenic
1100208141 12:92373727-92373749 AAGAAAAAATAAAAGTAGGCTGG - Intergenic
1100217184 12:92463846-92463868 GAAAAAAATCTGAGGGAGGCAGG - Intergenic
1100438435 12:94593204-94593226 AAGAAAAAACAAAAAGAGCCAGG + Intronic
1100474293 12:94921639-94921661 AATAAAAAACAAATGGAGGCAGG - Intronic
1100580565 12:95935780-95935802 ATAAATAAGCAGAAGGAGGCTGG + Intronic
1100787049 12:98089787-98089809 AAGAAAAGACAGAGGGAGGATGG + Intergenic
1100850149 12:98701795-98701817 AAGAAAGAACAGGAGGAGGAAGG - Intronic
1100982970 12:100177612-100177634 AAGAAAACTCAGAACCAAGCAGG + Intergenic
1101221825 12:102649615-102649637 AAGAAATATGAGAATGAGGATGG + Intergenic
1101268947 12:103122585-103122607 TATAAAAATCTGAAGGAGGTAGG + Intergenic
1101498823 12:105281844-105281866 AAGGGAAAACAGAAGGAGCCTGG + Intronic
1102159575 12:110757571-110757593 CAGAAAAATGGGAAGGGGGCTGG - Intergenic
1102272078 12:111545664-111545686 AGGAAAAATAATAATGAGGCCGG + Intronic
1102464546 12:113120763-113120785 AAGAAAAATCAGATGGAAGATGG - Intronic
1102577550 12:113865825-113865847 AAGAAAAAAAAAAAGGGGGCAGG + Intronic
1102731262 12:115112724-115112746 AAGAAAAGGCAGAAGGAGATTGG - Intergenic
1102749174 12:115277251-115277273 AAGAAAAAGAAGAAGGACGGGGG + Intergenic
1102777677 12:115534823-115534845 AAGAAAAAGGAGGAGTAGGCAGG + Intergenic
1103235346 12:119368066-119368088 AAGAACAAGAAGAAGGAGGAGGG + Intronic
1103552315 12:121746656-121746678 TAGAAAAATGAGAAGAAGGCCGG + Intronic
1103662613 12:122533396-122533418 TAAAAAGATAAGAAGGAGGCTGG + Intronic
1103698217 12:122834298-122834320 AAGAAAGAAAAGAAGGAGGAAGG + Intergenic
1103885824 12:124199330-124199352 ATGAAAAAGAATAAGGAGGCTGG - Intronic
1104122904 12:125816190-125816212 TAGACAAATCAGAAGGAGACTGG - Intergenic
1104459895 12:128946627-128946649 AAAAAAAAAAAAAAGGAGGCCGG - Intronic
1105057792 12:133118921-133118943 AAAAAAAATCAGTAAGAGCCAGG + Exonic
1105795562 13:23848864-23848886 AAGAAAAGCCAGAAGGAGAGAGG + Intronic
1105962641 13:25356046-25356068 AAGAAAAATGAGAACGGGGAGGG - Intergenic
1105983809 13:25545929-25545951 CATAAAAAACAGAAGTAGGCTGG - Intronic
1106176073 13:27333033-27333055 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1106181690 13:27374730-27374752 CAGAAAACTGAGAAGTAGGCAGG - Intergenic
1106513978 13:30436805-30436827 AAGAAAGAGGAAAAGGAGGCTGG - Intergenic
1106848928 13:33767659-33767681 AAAAAAAAAAAAAAGGAGGCAGG - Intergenic
1107016388 13:35711022-35711044 AGGCAAGATCAGAAGCAGGCAGG + Intergenic
1107323587 13:39215731-39215753 AACAAAAATCAGAGGAAGGAAGG - Intergenic
1107625437 13:42277327-42277349 TAGAATAATCAGATGAAGGCAGG - Intronic
1107628537 13:42317172-42317194 AATAAAAATAAAAATGAGGCTGG - Intronic
1108038727 13:46320073-46320095 AAGAAAAAGGAGGAAGAGGCCGG + Intergenic
1108068718 13:46605549-46605571 AAGAAAAATGAGGTGGAGGAAGG - Intronic
1108355597 13:49626315-49626337 AAAAAAAAAAAGAAGCAGGCTGG - Intergenic
1108421895 13:50259220-50259242 AAGAAAAACCAGATGGAGAATGG - Intronic
1108853318 13:54762562-54762584 AAGAAAAATGAGGAAGAGGAGGG + Intergenic
1108895527 13:55322630-55322652 AAGAAAAAATAGAAGGAAGGAGG - Intergenic
1108983640 13:56554499-56554521 AAGAAAAATAAGAAGGTGGAGGG + Intergenic
1109184750 13:59254573-59254595 AAGAAAACACAGAAAGAGGCAGG + Intergenic
1109384705 13:61611163-61611185 AAGGAAAAGAGGAAGGAGGCAGG - Intergenic
1109456535 13:62599264-62599286 AAGAAATTTCAAAAGTAGGCAGG - Intergenic
1109952786 13:69522570-69522592 AAGAACAATAAGAAGGATGGAGG - Intergenic
1109987166 13:70002806-70002828 AAGAAAAATCAGTGGGAGAATGG + Intronic
1110001444 13:70208017-70208039 AAGAAAAACCAAAAGTTGGCTGG + Intergenic
1110077445 13:71265436-71265458 AAAAAAAATAAGAAGGAAGAAGG - Intergenic
1110323001 13:74181384-74181406 CAGAAAATTGAGAATGAGGCTGG + Intergenic
1110744434 13:79036383-79036405 AAGAAAAAAGGGAGGGAGGCAGG + Intergenic
1110764269 13:79265035-79265057 AAAAAAAATCAGAAATACGCAGG + Intergenic
1111025826 13:82521575-82521597 AAGAAAAATGAGCAGTAGACTGG - Intergenic
1111232890 13:85366933-85366955 CAGAAACAACAGAAGGAGACGGG - Intergenic
1111461951 13:88556685-88556707 AGGAAAAATCAGAAGGAAAGAGG + Intergenic
1111697848 13:91647774-91647796 AAGAAAATTGAGAGGGAGCCAGG - Intronic
1112234894 13:97626424-97626446 AAGAAAAATCACAAGGAAATTGG - Intergenic
1112251088 13:97781107-97781129 AAGAAAAAAAAAAAGGAGGGAGG + Intergenic
1112350984 13:98632823-98632845 AAGAAACAGAAAAAGGAGGCCGG - Intergenic
1112554248 13:100452154-100452176 AAGAAAAAAGAGAAGGAGAGAGG - Intronic
1112766750 13:102753912-102753934 AAGAAAATGCTGAAGCAGGCTGG + Intronic
1113283819 13:108823087-108823109 AAGAAAAATCAGAAAAATGATGG - Intronic
1113455712 13:110447221-110447243 AGAAAAAATCCGAAGGCGGCTGG - Intronic
1113694915 13:112338192-112338214 TAGAAAGCTCAGGAGGAGGCTGG - Intergenic
1114217931 14:20671284-20671306 AGGAAAAATCAGGAGGGGGATGG - Intergenic
1114471497 14:22966084-22966106 AAAAAAAAAAAAAAGGAGGCAGG - Intronic
1114607717 14:24011339-24011361 AAGAGAAATCAGAAAGAGAAAGG - Intergenic
1114831514 14:26148275-26148297 AAGAAAAAACAGATGTTGGCAGG + Intergenic
1115312788 14:31996110-31996132 AAAAAAAACCACAAAGAGGCCGG - Intergenic
1115318046 14:32046941-32046963 CAGAAAAATGTGAAGGAGGAAGG + Intergenic
1115626887 14:35202403-35202425 AAAAAAAATCATAAGGTGACTGG - Intronic
1116242465 14:42362870-42362892 AAGAAAAATTAAAAGTAGTCAGG - Intergenic
1116483667 14:45420899-45420921 AAGAAAAATAAAAACTAGGCTGG + Intergenic
1116541559 14:46107832-46107854 AAAAAAAAAAAGAATGAGGCAGG - Intergenic
1116974799 14:51104281-51104303 AAAAAAAATCACAAGCAGCCAGG - Intergenic
1118209974 14:63756784-63756806 ATGAAAAATAATGAGGAGGCTGG + Intergenic
1118248233 14:64132904-64132926 AAATAAAATAGGAAGGAGGCCGG + Intronic
1118375534 14:65173664-65173686 AAGGAAAATCAGAAGCAGACAGG + Intergenic
1118816118 14:69315394-69315416 AAGAACTCTCAGCAGGAGGCTGG + Intronic
1118900398 14:69981063-69981085 AAGGCAGAGCAGAAGGAGGCTGG + Intronic
1119111872 14:71982306-71982328 AAAAATAAACAGAAGGAGGGAGG - Intronic
1119236110 14:73020680-73020702 AAGAAAAAAGAGCAGGAGCCAGG + Intronic
1119243437 14:73082254-73082276 AAAAAAAGACAGAAGGAGGAGGG - Intronic
1119825568 14:77654634-77654656 AAAAAAAAAAAAAAGGAGGCAGG + Intergenic
1119841260 14:77794817-77794839 AAGAAAACTCAGAGGCTGGCGGG - Intergenic
1120592740 14:86394986-86395008 AAGAAAAAAAAGAAAAAGGCTGG + Intergenic
1120717036 14:87851255-87851277 AACAAAAAGCAGAGGGAGGGAGG - Intronic
1121077035 14:91077455-91077477 AAGAAAAAACAAAAAGAGGCTGG + Intronic
1121624573 14:95374805-95374827 AAGAAAGAAAAGAAGGAGGGAGG - Intergenic
1122009675 14:98735781-98735803 AAGGAACATCAGAAGGAAGGAGG + Intergenic
1122621645 14:103061128-103061150 AAGAAAAAGAAAAAGAAGGCCGG + Intergenic
1122624333 14:103076433-103076455 AAGAAAAAAAAAAAGGAGCCAGG - Intergenic
1122749575 14:103922663-103922685 AATAAAAATTGGATGGAGGCTGG + Intronic
1123095325 14:105764427-105764449 AAGCACATTCAGGAGGAGGCTGG - Intergenic
1123394696 15:19920404-19920426 AAGACAAATCAGAAGAGGGCAGG + Intergenic
1124258043 15:28162030-28162052 ATAAAAAATTAGAAGAAGGCCGG + Intronic
1124455994 15:29843483-29843505 TAGAAAAATCAAAGGTAGGCTGG - Intronic
1124479172 15:30062771-30062793 AAGAAAAGACAGAAGGAAGAAGG + Intergenic
1124577046 15:30919083-30919105 AAGGAAAATCATAAGGGGGCTGG + Intronic
1125054926 15:35347446-35347468 AAAAAAAAAAAGGAGGAGGCTGG - Intronic
1125076924 15:35630315-35630337 AAGTAAAAAAAGAAGGAGGATGG + Intergenic
1125126109 15:36222359-36222381 AAGAAAAATCATAATGACACAGG - Intergenic
1125145243 15:36459930-36459952 AAAAGAAAACAAAAGGAGGCTGG + Intergenic
1125917679 15:43503749-43503771 AAGAAGAATCAGGAGAAGGCAGG - Intronic
1125990868 15:44106523-44106545 TTTAAAAATCAGAATGAGGCAGG - Intronic
1126442058 15:48700006-48700028 AAGAAAAAAAAGAAGGGGTCGGG + Intergenic
1126583292 15:50260315-50260337 AAAACAAAAAAGAAGGAGGCCGG - Intronic
1126657521 15:50995215-50995237 AAGAAAAATCAGTAGGGAACAGG - Intronic
1126693727 15:51308371-51308393 AAGAAAAAACAAGAGAAGGCAGG - Intronic
1126946230 15:53823471-53823493 AAGAGAAAACAGAGGGAGGAAGG + Intergenic
1127105438 15:55608851-55608873 AAAAAAAAAAAAAAGGAGGCAGG - Intergenic
1127436382 15:58962509-58962531 AAAAAAAAAAAAAAGGAGGCTGG - Intronic
1127808315 15:62541352-62541374 AAGAAATAACAGAATGAGGAAGG - Intronic
1127818228 15:62631714-62631736 AAGAAAAAGCGGGAGGAGGGAGG - Intronic
1127917786 15:63469635-63469657 ATGAAAAACAAAAAGGAGGCTGG + Intergenic
1127954643 15:63842760-63842782 AAAGATAATCATAAGGAGGCTGG + Intergenic
1128829570 15:70755371-70755393 AAAAAAAAAAAGAATGAGGCCGG + Intronic
1128860686 15:71068873-71068895 AAAAAAAATCAGAATGAGCCTGG + Intergenic
1129285675 15:74522640-74522662 AAAAAAAAAAAGAATGAGGCTGG + Intergenic
1129344989 15:74911735-74911757 GAGATAAATGAGAAGCAGGCAGG + Intergenic
1129638676 15:77351376-77351398 AAGTATGATCAGAATGAGGCAGG + Intronic
1129859427 15:78848754-78848776 AACAAAAATGGGAAGGAGCCAGG - Intronic
1129905248 15:79182627-79182649 AAGAAAAGACAGAAAGAGGAAGG - Intergenic
1129988413 15:79939643-79939665 AAGAAAAGACAGAGGGAGGAAGG + Intergenic
1130295012 15:82640577-82640599 AAATAACATCAGAAGTAGGCAGG - Intronic
1130528667 15:84728628-84728650 TAGAAAAAGCAGAAGAGGGCCGG - Intergenic
1130557251 15:84931251-84931273 AATAAAAATAAAAAGGAGGAGGG - Intronic
1130560120 15:84951443-84951465 AAAAAAAAAAAGAAGGAGTCTGG + Intergenic
1130610674 15:85358106-85358128 GAGAAAAATCAAAAGAGGGCAGG + Intergenic
1130795137 15:87199860-87199882 AAGAAAAAGAAGAAAGAGGAAGG + Intergenic
1131100236 15:89682751-89682773 AGCAAAAATCAGAAGCAGACCGG - Exonic
1131246690 15:90800384-90800406 AACAAAAGTCAGGAGGAGGCTGG + Intronic
1131405372 15:92160120-92160142 AAGAAAGGTCACAAGGAGGGAGG + Intronic
1131487193 15:92831021-92831043 AAAAAAATTCAAAAAGAGGCCGG - Intergenic
1131662872 15:94537607-94537629 ATGAAAAATGAAAAGGAGGTAGG + Intergenic
1131787268 15:95926507-95926529 AAGAAAAGTCAGAACCAGGCCGG + Intergenic
1131833303 15:96367832-96367854 GAGAAAATTCAGAAGGAAGGGGG + Intergenic
1131901056 15:97088472-97088494 AAGAAAAACAAGAGGGAGGCAGG - Intergenic
1132611459 16:818380-818402 AGGCCAAAGCAGAAGGAGGCAGG + Intergenic
1132789383 16:1677144-1677166 AAGAAAACAAGGAAGGAGGCCGG + Exonic
1132921684 16:2399294-2399316 AAGAAAAAACAGAATAAAGCTGG - Intergenic
1133320970 16:4913697-4913719 AGAAAACAACAGAAGGAGGCTGG - Intronic
1133385924 16:5370449-5370471 AAAAAAAAAGAGGAGGAGGCTGG - Intergenic
1133544156 16:6788769-6788791 CAGAAAAATCAGTGGGGGGCCGG - Intronic
1134311238 16:13077002-13077024 AAGCAAAATCCCACGGAGGCTGG + Intronic
1134392261 16:13830837-13830859 AAAAAAAAAAAGAAGGAGGTTGG - Intergenic
1134398214 16:13884944-13884966 AAAAAAAAGAAGAAGAAGGCCGG - Intergenic
1134426347 16:14150550-14150572 AAGAAAAATCATAAGGAGCTGGG + Intronic
1134434274 16:14241175-14241197 AAGAAAAAACAGCTGGATGCTGG + Intronic
1134676799 16:16096395-16096417 AAAAGAAATCAAAAGGTGGCAGG - Intronic
1135023535 16:18982207-18982229 AAAAAAAAAAAAAAGGAGGCTGG - Intergenic
1135179439 16:20260097-20260119 AAGAATGATGAGAAGAAGGCCGG + Intergenic
1135254532 16:20930488-20930510 AACAAAAAGCTGAGGGAGGCAGG - Intergenic
1135329110 16:21546429-21546451 AAGAAAAATATTAAGTAGGCTGG + Intergenic
1135342435 16:21660690-21660712 AATAAAAACAAGATGGAGGCTGG - Intergenic
1135470591 16:22726268-22726290 AAGAAAAAGAAAAAGGAAGCGGG - Intergenic
1135497453 16:22964956-22964978 AAGAAAGATGAAAAGGAGGGAGG - Intergenic
1135853552 16:25986131-25986153 AAAATAAATTAGAAGGAGACTGG - Intronic
1135943118 16:26840154-26840176 TAGTAAAATAAAAAGGAGGCTGG + Intergenic
1136053454 16:27670247-27670269 AACAAAAATCAGGAGAGGGCAGG - Intronic
1136102220 16:28004476-28004498 AAAAAAAAAAAAAAGGAGGCCGG + Intronic
1136134761 16:28248864-28248886 AAAAAAATAAAGAAGGAGGCCGG + Intergenic
1136229577 16:28878532-28878554 AAGAAAAACCTGGAGGGGGCAGG + Exonic
1136339451 16:29632373-29632395 AAGAAAAATATTAAGTAGGCTGG + Intergenic
1136519903 16:30788527-30788549 AAAAAAAAAAAGAAGGAGGGAGG + Intergenic
1136698700 16:32111958-32111980 AAGAAAAGTAAAAAGGAGGAGGG - Intergenic
1136768904 16:32815871-32815893 AAGAAAAGTAAAAAGGAGGAGGG + Intergenic
1136936684 16:34474214-34474236 AAGACAAATGAGAAGAGGGCAGG - Intergenic
1136947988 16:34678867-34678889 AAGACAAATGAGAAGAGGGCAGG + Intergenic
1136959102 16:34825251-34825273 AAGACAAATGAGAAGAGGGCAGG + Intergenic
1136963135 16:34874356-34874378 AAGACAAATGAGAAGAGGGCAGG + Intergenic
1136967226 16:34928559-34928581 AAGACAAATGAGAAGAGGGCAGG + Intergenic
1137085017 16:36109295-36109317 AAGACAAATGAGAAGAGGGCAGG - Intergenic
1137087838 16:36150670-36150692 AAGACAAATGAGAAGAGGGCAGG + Intergenic
1137221551 16:46456776-46456798 AAGACAAATGAGAAGAGGGCAGG - Intergenic
1137257914 16:46792767-46792789 AAGAAAAAAAAGAAGACGGCCGG + Intergenic
1137310007 16:47245820-47245842 AAAAAAAAAAAGGAGGAGGCAGG - Intronic
1137321842 16:47392115-47392137 AGTAAAGATCTGAAGGAGGCTGG + Intronic
1137529714 16:49271054-49271076 AAAAAAAAAAAAAAGGAGGCAGG + Intergenic
1137556991 16:49477122-49477144 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
1137856460 16:51799207-51799229 AAGAAATATCACAGGGAGCCTGG + Intergenic
1138109009 16:54308371-54308393 AAGAAAAATAGAAAGAAGGCTGG + Intergenic
1138155483 16:54698977-54698999 AAGCAAACTCAGAAGCAGCCTGG + Intergenic
1139121387 16:64022740-64022762 AAAAAAAGTCAAAATGAGGCCGG - Intergenic
1139449578 16:67018736-67018758 AAGAAAAAAGAAAAGGAGGCAGG + Intergenic
1139699127 16:68696427-68696449 AACAAAAATGATTAGGAGGCTGG + Intronic
1139715154 16:68807371-68807393 AAGAAAAATATAAAAGAGGCTGG + Intronic
1139718591 16:68834376-68834398 CAAAAAAATAAAAAGGAGGCTGG - Exonic
1139773391 16:69297321-69297343 AAAAAAAAAAAAAAGGAGGCCGG + Intronic
1139836826 16:69845751-69845773 AAGAATAATCAGATGAAGCCTGG + Intronic
1139918823 16:70445949-70445971 AAAAAAAAAAAGAAGGAGGAAGG - Intergenic
1139938096 16:70585826-70585848 AAAAAAAAAAACAAGGAGGCTGG - Intronic
1140826168 16:78708914-78708936 CAGAAAAATAAAAAGAAGGCAGG + Intronic
1141085964 16:81095984-81096006 AACAGAAATAAGAAGGGGGCAGG + Intronic
1141138428 16:81481869-81481891 AAAAAAAAAAAGAGGGAGGCGGG - Intronic
1141193813 16:81844287-81844309 AAGAAAAATGAAAAGGTGCCCGG - Intronic
1141417337 16:83886148-83886170 AGGAGGAAGCAGAAGGAGGCTGG + Intergenic
1141448991 16:84084252-84084274 AAGAAAGTTCTCAAGGAGGCCGG - Intronic
1141549614 16:84796766-84796788 AAAAAAAAGAAAAAGGAGGCTGG - Intergenic
1141867037 16:86757475-86757497 AAGAAAAATGAGAACCAGGAAGG + Intergenic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1141952401 16:87347395-87347417 AAGATGTATCAGAATGAGGCCGG + Intronic
1142021619 16:87786455-87786477 AAAAAAAAAAAAAAGGAGGCTGG + Intergenic
1203071321 16_KI270728v1_random:1077982-1078004 AAGAAAAGTAAAAAGGAGGAGGG + Intergenic
1142701332 17:1663253-1663275 AACTAAATTCAGAAGAAGGCAGG + Intronic
1142789420 17:2252115-2252137 AAAAAAGAAAAGAAGGAGGCCGG + Intronic
1142872726 17:2831371-2831393 AAGAAAAAGAAATAGGAGGCTGG - Intronic
1142894759 17:2966819-2966841 AATAAAAATCAGACCGAGACTGG + Intronic
1142964228 17:3571011-3571033 CAGAAAAACCCCAAGGAGGCCGG - Intronic
1143142595 17:4750187-4750209 AAAAAAAATCTGAAGGTGTCTGG + Intergenic
1143320866 17:6068191-6068213 AAGAAAAAGCAAAAGGCTGCTGG - Intronic
1143361204 17:6372771-6372793 GAGAAAAAAAAGAAGGAGGCAGG + Intergenic
1143549567 17:7621731-7621753 GAGAAATTACAGAAGGAGGCTGG + Intronic
1143770198 17:9163613-9163635 AAAAAAAATTAAAAGGAGACGGG + Intronic
1143832241 17:9661786-9661808 AAGAAAACCCTGAAAGAGGCTGG - Intronic
1144289135 17:13808734-13808756 AAAAAAAATCATAAGGAGGAGGG - Intergenic
1144400330 17:14891829-14891851 AATATAAATCAGAAGAAGGCTGG + Intergenic
1144431130 17:15192567-15192589 AAGAGAAATGAGAAGAAGGTGGG - Intergenic
1144488708 17:15688779-15688801 AAGAAAAAAAAAAAAGAGGCCGG + Intergenic
1144694740 17:17295144-17295166 AAGAAAAAAGAGAATGAGGCCGG - Intergenic
1144831654 17:18135160-18135182 AATAAAAAACAGAAACAGGCTGG - Intronic
1145101846 17:20084131-20084153 AACAAAAATAACAAAGAGGCTGG + Intronic
1145324032 17:21783580-21783602 AAGACAAATGAGAAGGGGGCAGG - Intergenic
1145326580 17:21835215-21835237 AAGACAAATGAGAAGGGGGCAGG + Intergenic
1145689559 17:26724381-26724403 AAGACAAATGAGAAGAGGGCAGG + Intergenic
1145692853 17:26762208-26762230 AAGAAAAGTAAAAAGGAGGAGGG - Intergenic
1145892508 17:28427033-28427055 AAAAAAAACAAGAAGAAGGCTGG + Intergenic
1146136791 17:30329046-30329068 AAGAAAATTTCAAAGGAGGCTGG + Intronic
1146969070 17:37057703-37057725 CAGAAAAACCACAACGAGGCCGG - Intergenic
1147570836 17:41569854-41569876 AAGAAGAATCATAAGGAGGTAGG - Exonic
1148096849 17:45058415-45058437 AAAAAAAATAAAAAGTAGGCTGG - Intronic
1148118443 17:45192425-45192447 AAGAAAAAAGAAAAGGAGGAAGG - Intergenic
1148140173 17:45322603-45322625 ATAAAAATTCAGAATGAGGCTGG - Intergenic
1148593384 17:48833258-48833280 AAGAAAAGTAAGCAGAAGGCCGG + Intronic
1148593441 17:48833830-48833852 TAGAAAGAGCAGAAGTAGGCTGG + Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148791747 17:50177092-50177114 GAGGAAAAGGAGAAGGAGGCTGG - Intergenic
1149219050 17:54393673-54393695 AATAAAAATCAGAAAGAGACAGG - Intergenic
1149465964 17:56879331-56879353 AAGAAAAAAGAGAGTGAGGCTGG + Intergenic
1149479005 17:56986512-56986534 AAGAAAGACCAGAAAGTGGCCGG - Intronic
1149505854 17:57193402-57193424 AATAAAAATAAAAAGGAGCCAGG + Intergenic
1149559318 17:57596827-57596849 AAGAAAAAACAAAGAGAGGCGGG - Intronic
1149893110 17:60407799-60407821 AAAAAAAAGCAGAAACAGGCCGG + Intronic
1149940706 17:60862295-60862317 AACAAAAAACAGAATGAGGCTGG + Intronic
1150052678 17:61980258-61980280 AAGGAAATTGAGAAGGAGGTTGG - Intronic
1150411552 17:64947683-64947705 AAAAAAAATAAAAAGGTGGCCGG + Intergenic
1150423612 17:65058952-65058974 AAGAAGAAGAAGAAGGAGGAAGG + Intergenic
1150430350 17:65110689-65110711 AAGACAAAAAAGAAGGAGGCCGG - Intergenic
1150702649 17:67461150-67461172 GAGAAGAAGCAGGAGGAGGCAGG - Intronic
1150716578 17:67577294-67577316 AATAAAAATAAAAAGAAGGCCGG + Intronic
1150883236 17:69055323-69055345 AACAATAATCAGAAGAAAGCTGG + Intronic
1151018256 17:70582654-70582676 AAGAAAAAATAGGAGGAGGAAGG - Intergenic
1151276989 17:73042502-73042524 AGCAATAATCAGAAAGAGGCTGG + Intronic
1151383570 17:73741756-73741778 GAGAAAAAGAAAAAGGAGGCAGG - Intergenic
1151742449 17:75992932-75992954 AGTAAGAATCAGAAGCAGGCAGG - Intronic
1151853263 17:76704186-76704208 AAAAAAAATCTGAAGGAAGCTGG - Intronic
1151915495 17:77114845-77114867 AAAAAAAAAAAAAAGGAGGCAGG + Intronic
1152019646 17:77773820-77773842 TAAGAAAATCATAAGGAGGCTGG - Intergenic
1152026767 17:77814946-77814968 AACAAAAATTAAAAAGAGGCCGG - Intergenic
1152083490 17:78203354-78203376 AAAAAAAAAAAAAAGGAGGCTGG - Intronic
1152163564 17:78685332-78685354 AATAAAAATCAGGAGGTGGGAGG - Intronic
1152439960 17:80300846-80300868 AATCAAAATCACAATGAGGCCGG - Intronic
1152621651 17:81367890-81367912 AAAAAAAAAAAAAAGGAGGCTGG - Intergenic
1152653719 17:81509728-81509750 AAGCAACATCATAAGCAGGCTGG - Intergenic
1203182830 17_KI270729v1_random:80349-80371 AAGACAAATGAGAAGAGGGCAGG + Intergenic
1203190770 17_KI270729v1_random:185806-185828 AAGACAAATGAGAAGGGGGCAGG + Intergenic
1153177875 18:2399428-2399450 AAGACAAAACAGAAGGATTCTGG + Intergenic
1153359879 18:4182231-4182253 AAGAACAAGCAGAAGCAGGAAGG + Intronic
1153423502 18:4936048-4936070 AACACAAATCAGAAGGAAACTGG + Intergenic
1153482627 18:5562832-5562854 AATAAACATCCGAAGAAGGCTGG - Intronic
1153716580 18:7855920-7855942 TAGAAAAAGCAGAAGGTGCCTGG + Intronic
1153750830 18:8228544-8228566 AGAAAAAATCAGAAATAGGCTGG + Intronic
1153806470 18:8712519-8712541 AAGAGAAAGGAGGAGGAGGCGGG - Intronic
1153833880 18:8947326-8947348 AAAAAAAGGCAGAAGGAGGCTGG + Intergenic
1153876913 18:9382199-9382221 TAGAAAAAACAAGAGGAGGCTGG + Intronic
1154178294 18:12104856-12104878 AATAAAAATCAGAAGATGACTGG - Intronic
1154183983 18:12164812-12164834 AAGAAAAATCAGACCTAGTCTGG - Intergenic
1154385796 18:13890788-13890810 AAGAAATTCCAGAAGGAGACCGG - Intronic
1154516438 18:15171967-15171989 AAGACAAATGAGAAGAGGGCAGG - Intergenic
1155125027 18:22865836-22865858 AAGCATAAACAGTAGGAGGCAGG - Intronic
1155185189 18:23381499-23381521 TAGAAAATACAGATGGAGGCCGG - Intronic
1155830204 18:30507455-30507477 AAGAAAAATCAGAAAGGTTCAGG + Intergenic
1155887783 18:31228871-31228893 AAAAAAAAAAAGAAGGAGGAAGG + Intergenic
1155961549 18:31999662-31999684 AAGAAAAGACAGGAAGAGGCCGG - Intergenic
1156357667 18:36356476-36356498 AATAAAAATCAGAAGGAAAAAGG - Intronic
1156446101 18:37237988-37238010 AAAAAAAATCAGAAGAAAGAAGG + Intergenic
1156867564 18:41905759-41905781 AAGAAAAATCAGAAACAGAAAGG - Intergenic
1157150199 18:45209192-45209214 AAAAAAAATCAGGTGGTGGCAGG + Intergenic
1157420197 18:47541370-47541392 CAGAAATATCAGGTGGAGGCTGG + Intergenic
1157868493 18:51207699-51207721 AAGAAAAATGAAAAAAAGGCTGG + Intronic
1157954245 18:52078566-52078588 AGGAAATATAAGGAGGAGGCTGG - Intergenic
1158494656 18:57943480-57943502 AAGAAAAATGAGGAGAAGGAGGG - Intergenic
1158523015 18:58187387-58187409 AAGGAAAATCAGCAGAGGGCAGG + Intronic
1158701887 18:59755552-59755574 AAAAAAAAGAAGAAGAAGGCTGG + Intergenic
1159612988 18:70546931-70546953 AAGAAAAAGCAGGAAGAGCCTGG - Intergenic
1159783786 18:72690745-72690767 AAGTAGAAGCAGAAGGAAGCAGG + Intergenic
1159885583 18:73901263-73901285 AAGAAAAAGCAAAAGGAGCTTGG - Intergenic
1161062596 19:2222602-2222624 AAGAAAGACCAGAGGGAGACCGG + Intronic
1161062659 19:2222895-2222917 AAAAAAAAACAGGTGGAGGCAGG + Intronic
1161236268 19:3199678-3199700 AAAAAAAAAAAGGAGGAGGCAGG - Intronic
1161292321 19:3501300-3501322 AAGAAAGACCTGAAAGAGGCCGG + Intergenic
1161309035 19:3583789-3583811 ATGAAATATCAGCAGGGGGCTGG + Intergenic
1161503207 19:4629085-4629107 AAAAAAAAAAAGAAGGAAGCAGG - Intergenic
1161510278 19:4666766-4666788 CAGAAAAATCTCTAGGAGGCCGG + Intronic
1161598814 19:5167520-5167542 AAGAAAAAAAAAAAAGAGGCTGG + Intronic
1161621170 19:5298088-5298110 AAGAAAGACTGGAAGGAGGCCGG - Intronic
1161658101 19:5528363-5528385 AAGAAAAATAAGAAGAAGAAAGG + Intergenic
1161704573 19:5813236-5813258 AAAAAAAAACAGATGGAGGCTGG + Intergenic
1161914944 19:7221410-7221432 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
1162180005 19:8862032-8862054 AAATAAAATCAAAAGTAGGCTGG - Intronic
1162404364 19:10464699-10464721 AAGAAAAATGAAAACAAGGCCGG - Intronic
1162415030 19:10530728-10530750 AAAAAAAATTAGAAACAGGCCGG + Intergenic
1162466543 19:10844856-10844878 AAAAAAAAAATGAAGGAGGCTGG + Intronic
1162484334 19:10949758-10949780 AAAAAAAAAAAGAAGAAGGCCGG + Intergenic
1162485191 19:10956025-10956047 AAAAAAAAAAAGAAGAAGGCCGG + Intergenic
1162776308 19:12981774-12981796 AAAAAAAAAAAAAAGGAGGCCGG - Intergenic
1162797427 19:13094198-13094220 AAGAAAACTCAGCAAGAAGCTGG + Intronic
1162839235 19:13343418-13343440 AAGAAAGACCAGAAGGAGGCTGG - Intronic
1162871199 19:13588041-13588063 AAGAAAAGAAAGAAAGAGGCCGG + Intronic
1162950036 19:14065839-14065861 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1163286260 19:16350123-16350145 TTTAAAAATCAGATGGAGGCTGG + Intergenic
1163358831 19:16832492-16832514 AAAAAAAAAAAAAAGGAGGCTGG - Intronic
1163531482 19:17851966-17851988 AAGAAAAAGCAGGCTGAGGCAGG + Intergenic
1163731325 19:18951150-18951172 AAAAAAAGTCACCAGGAGGCTGG + Intergenic
1163771698 19:19195028-19195050 AAGAAAAAAAAAACGGAGGCGGG - Intronic
1163983183 19:20921073-20921095 AAAGAAAAACAGAAGCAGGCCGG - Intergenic
1163998570 19:21076136-21076158 AAGAAAAAAGAAAAAGAGGCCGG - Intergenic
1164211940 19:23106207-23106229 AAGAAAAAAGAGGAGGAGGAAGG + Intronic
1164258935 19:23552536-23552558 AAGAGAAAGCAAAAAGAGGCTGG - Intronic
1164614832 19:29660894-29660916 AAAAGAAAACAGAAGCAGGCAGG - Intergenic
1164644476 19:29848195-29848217 AAGAAAAATCAGAATGACTGAGG + Intergenic
1164702154 19:30293282-30293304 AAGAAATATCAGAAGGTTCCTGG - Intronic
1164734036 19:30527211-30527233 AAAAAAAAAAAAAAGGAGGCTGG - Intronic
1164833171 19:31338803-31338825 AAGAAAAAAAAGATGGAGGGAGG - Intronic
1164841250 19:31394122-31394144 AGGAAAAATCAGAAGGACTCAGG + Intergenic
1164944528 19:32282331-32282353 AAGAAAAAGCTGAAAGATGCTGG - Intergenic
1165401919 19:35606512-35606534 AATAAAAATAACAAGGAGGGTGG - Intergenic
1165451188 19:35884394-35884416 AAAAAAAAAAAGAAGGAGACAGG - Intergenic
1165706122 19:37977464-37977486 AATAAAAATAATAATGAGGCCGG - Intronic
1165786970 19:38467428-38467450 CAGAAAAGTCAGAGAGAGGCAGG - Intronic
1165936670 19:39393390-39393412 AAAAAAAAAGAAAAGGAGGCTGG - Intronic
1165941820 19:39418280-39418302 AAGAAAAAAAAGGAGAAGGCTGG + Intronic
1166037014 19:40175906-40175928 TAGAAAAATAAAAAGCAGGCCGG - Intergenic
1166103519 19:40585834-40585856 AAGTGAAATAAGAAAGAGGCCGG - Intronic
1166196735 19:41211298-41211320 AAAAAAAATAATAAAGAGGCGGG + Intergenic
1166215781 19:41334049-41334071 AAAATAAACCAGAAGAAGGCAGG - Intronic
1166579580 19:43882802-43882824 AAAAAAAATTAAAAAGAGGCTGG + Intronic
1166691658 19:44825183-44825205 ATGAAATATCAGAAAGAGGCAGG + Intergenic
1166857288 19:45788975-45788997 AATAAAGACCTGAAGGAGGCAGG - Intronic
1166860334 19:45806695-45806717 AAAAAAAAAAAAAAGGAGGCCGG + Intronic
1167069921 19:47215374-47215396 AAAAAAAAAAAAAAGGAGGCCGG + Intergenic
1167078446 19:47263338-47263360 AAGCAAAATCAGCAGGGGGCGGG + Intronic
1167097659 19:47382993-47383015 AAAAAAAATCAGGCTGAGGCAGG + Intergenic
1167139215 19:47638113-47638135 AAGAAAGAGCAGGAGGAGGAGGG - Intronic
1167265601 19:48481464-48481486 AAAAAAAATCAGAAGCGTGCTGG - Intronic
1167322348 19:48805011-48805033 AGGAAAAAACAGAGGGAGGGAGG + Intronic
1167459361 19:49616117-49616139 AAGAAATGGCTGAAGGAGGCAGG + Exonic
1167726094 19:51213830-51213852 AAGAAAAAGAAAAATGAGGCTGG - Intergenic
1168054207 19:53852568-53852590 AAGAAGAAGAAGAAGAAGGCTGG - Intergenic
1168058251 19:53875546-53875568 AAAAAAAAAAAGAAGGAGTCGGG + Exonic
1168159443 19:54499603-54499625 AAGAAGAGTCAGAAGCAGGAAGG + Intronic
1168220873 19:54959431-54959453 TAGAAAAAAAACAAGGAGGCCGG - Intronic
1168281476 19:55308318-55308340 AAGAAAAATAAGTTGGAGCCAGG - Intronic
1168630259 19:57950626-57950648 AAGAAGCATGGGAAGGAGGCCGG - Intergenic
925142222 2:1558255-1558277 AAAAAAGACCGGAAGGAGGCAGG - Intergenic
925142307 2:1558715-1558737 TAAGAAGATCAGAAGGAGGCAGG - Intergenic
925279607 2:2673827-2673849 AGGCAAAATCACCAGGAGGCAGG + Intergenic
925330334 2:3053566-3053588 AAGAAAAGTAGGAAGGAGGGAGG + Intergenic
925508471 2:4597081-4597103 AAGAAAAAGGAGGAGGAGGAAGG + Intergenic
926140375 2:10364578-10364600 AAAAAAAAAAAAAAGGAGGCGGG - Intronic
926190650 2:10724943-10724965 AAGAAAAATAATTAGGAGGCTGG - Intronic
926199955 2:10787766-10787788 AAGATAAATAGGAAGGAGGCTGG + Intronic
926225050 2:10961372-10961394 AAGGAAGACCAGAAGGCGGCTGG + Intergenic
926715865 2:15922990-15923012 AAGAAAAAAAAGAAGGTGTCAGG - Intergenic
926725054 2:15991206-15991228 AAGAAGAAGAAGAAGGTGGCCGG - Intergenic
926726928 2:16005675-16005697 AAGAAAGAGGAGAAGGAGGGTGG - Intergenic
926825164 2:16898903-16898925 AAGGATAAGCAGATGGAGGCTGG + Intergenic
926847310 2:17156017-17156039 AATATAAATAAGAAGGAGGAAGG - Intergenic
926927783 2:18005126-18005148 AACAAAAACCAGTAGGAAGCTGG - Intronic
927285117 2:21349283-21349305 AAGGAAGATCACAAGCAGGCCGG + Intergenic
927493858 2:23539424-23539446 AAAAAAAAAAAAAAGGAGGCAGG - Intronic
927599637 2:24429609-24429631 GAGAAAAATCAGCAGGACACGGG - Intergenic
927761696 2:25762367-25762389 AAGAAGAGTAAGAAAGAGGCTGG + Intronic
927773078 2:25880491-25880513 AAGGAAATCCAGAAGGAGGGTGG - Intergenic
927789407 2:25998717-25998739 AAAAAAAAAAAAAAGGAGGCTGG - Intergenic
928546902 2:32336847-32336869 AATAAAAATAAAAAGTAGGCTGG + Intergenic
928564149 2:32526231-32526253 AAAAAATATCTGAAGGGGGCTGG - Intronic
928573598 2:32632105-32632127 AAAAAAAATTAAATGGAGGCTGG - Intronic
928660882 2:33500638-33500660 TAAAAAAATGAGAAGGAGGTGGG + Intronic
928861297 2:35860484-35860506 AAGAAATAGCACAAGAAGGCAGG - Intergenic
928879123 2:36077261-36077283 AAGAAAAATCAGAGAAAGGCAGG + Intergenic
929113914 2:38428488-38428510 AAGAAAAAATAGAAGAAGGAGGG - Intergenic
929154970 2:38780966-38780988 AAAAAAAAAAAGAAGAAGGCAGG - Intronic
929199898 2:39223892-39223914 ATTAAAAAAGAGAAGGAGGCTGG - Intronic
929619589 2:43341334-43341356 GAGAAAAATCAGAAGTGGGGTGG + Intronic
929714181 2:44293742-44293764 AAGAAAAATCCAAGGGAGCCAGG + Intronic
929868832 2:45740772-45740794 AGGTAGAATCAGAATGAGGCAGG - Intronic
930063266 2:47308579-47308601 AAAAAAAAAGAGAAGGTGGCAGG - Intergenic
930333792 2:50019648-50019670 AAAAAAAAAAAAAAGGAGGCTGG + Intronic
930405844 2:50954628-50954650 AAGAAAGAAGAGAAGCAGGCAGG + Intronic
930756336 2:54977268-54977290 CAGAAAAATTAGAAGGAAGTGGG - Intronic
931090464 2:58880574-58880596 AGGAAAGAGGAGAAGGAGGCCGG + Intergenic
931152309 2:59587977-59587999 AAGAAAAATGAGAGAGAGGAAGG + Intergenic
931174075 2:59835325-59835347 AAGAAAAAAGAGAAGGGGGAAGG - Intergenic
931231158 2:60375989-60376011 AAGGGAAAGCAGGAGGAGGCAGG + Intergenic
931374771 2:61697141-61697163 AACAAAAATAAAAATGAGGCCGG + Intergenic
931538532 2:63303978-63304000 AAAAAAAAACAGATGTAGGCAGG + Intronic
931677302 2:64710006-64710028 ATTTAAAATCAGAGGGAGGCTGG - Intronic
932129286 2:69173287-69173309 TAGAAATATCAGATGGAGTCAGG - Intronic
932415898 2:71573789-71573811 AAGAAAAATCAGGAGGGGAGAGG - Intronic
932600081 2:73117879-73117901 AAGAAAAAGAAAAAGAAGGCCGG + Intronic
932672321 2:73748962-73748984 AAGAAAAAGAAAAAGGACGCTGG - Intergenic
932684734 2:73858434-73858456 AAGAAAAAACAAAAACAGGCTGG - Intronic
932686380 2:73874011-73874033 AAAAAAAAAAAAAAGGAGGCTGG - Intergenic
932890533 2:75592586-75592608 AAGAAAGAACAGAAGGAGACTGG - Intergenic
933366017 2:81355069-81355091 AAGGCAAATAAGAAGGAGGGAGG + Intergenic
933422046 2:82061314-82061336 AACAAAAATCTGAAGCAGGTAGG + Intergenic
933771700 2:85748790-85748812 AACAAAAAACAGGAGGAGGCTGG - Intergenic
934027796 2:88015626-88015648 AACAAAGATAAAAAGGAGGCCGG - Intergenic
934056942 2:88259015-88259037 AAGAAAAAAAAGAAGAAGACTGG + Intergenic
934212478 2:89994969-89994991 AAGAAAAATGAAAGGGAGGAAGG - Intergenic
934252286 2:90367622-90367644 AAGACAAATGAGAAGAGGGCAGG - Intergenic
934257156 2:91435323-91435345 AAGACAAATGAGAAGAGGGCAGG + Intergenic
934728953 2:96644180-96644202 AAAAAAAAAAAGAAAGAGGCTGG + Intergenic
934887624 2:98038816-98038838 TAGAAAAGAAAGAAGGAGGCCGG - Intergenic
935490921 2:103718914-103718936 AAGAGAAATCAGAACAAAGCAGG + Intergenic
935504672 2:103885405-103885427 AAGGAAGATGAGCAGGAGGCTGG + Intergenic
935917641 2:107972967-107972989 AAGAAAAATCAAACCTAGGCAGG + Intergenic
935977858 2:108596828-108596850 AATAAAAATAAAAAGGAGGGGGG + Intronic
936716490 2:115192554-115192576 AAGAGAATTCAGAAGGAAACTGG - Intronic
937112904 2:119380396-119380418 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
937357289 2:121206004-121206026 AAGAAGAATCTGGAGGAGGTGGG + Intergenic
937549791 2:123073680-123073702 TAGAAATAACAGAAGGAGCCAGG - Intergenic
938028764 2:127973534-127973556 TAGAAAATTCTGAAGGAAGCCGG - Intronic
938145587 2:128832499-128832521 AAGAAAAAAGAAAAGGAGGGAGG - Intergenic
938516759 2:132016961-132016983 AAGACAAATGAGAAGAGGGCAGG - Intergenic
938657418 2:133448253-133448275 AAAAAAAAAAAGAGGGAGGCGGG + Intronic
938709140 2:133960404-133960426 AAGAAAAAGAAAAAAGAGGCTGG - Intergenic
938842792 2:135179259-135179281 AAGAAAGAACAGAATGAGGCTGG + Intronic
939054822 2:137352126-137352148 AATAAAAAAGAGAAGGGGGCAGG + Intronic
939130651 2:138232258-138232280 AAGAAAGATCAGAAGTATGGGGG + Intergenic
939547940 2:143576669-143576691 CAGAAGAATCAGAAGAAGGGAGG + Intronic
939550329 2:143607227-143607249 AAGACAACTCAAAAAGAGGCTGG + Intronic
939772630 2:146340979-146341001 AAGAAAACTAAGAAGTAGGCAGG - Intergenic
940164056 2:150748397-150748419 AAGAAAAAGAAGAAAGAGGAAGG - Intergenic
940216128 2:151305390-151305412 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
940434668 2:153637407-153637429 AAGAAAAAACAAAAAAAGGCAGG - Intergenic
941069906 2:160944276-160944298 AAGAGACATCTGCAGGAGGCTGG + Intergenic
941610437 2:167654790-167654812 AAAAAAAAAAAGAAAGAGGCTGG - Intergenic
941778367 2:169417329-169417351 CAGAAAATTCAGAGGGAGGGAGG + Intergenic
941834074 2:169996993-169997015 AAAAAAAATCCAAAGCAGGCCGG - Intronic
942207728 2:173638192-173638214 AAGAAGAAGGAGGAGGAGGCAGG + Intergenic
942454108 2:176125721-176125743 AAGAAAAAGCATAGGGGGGCTGG + Intergenic
942466309 2:176210480-176210502 TAAAAAAATCAGAATCAGGCCGG - Intergenic
942602681 2:177657672-177657694 GAGAGAAAGCAGAAAGAGGCGGG + Intronic
942645514 2:178106661-178106683 CAGAAAAATCAGATTGAGGCTGG + Intronic
942648214 2:178137822-178137844 AGCAAAAATCAGCATGAGGCTGG + Intronic
942724291 2:178989841-178989863 AAAAAAAAAAAAAAGGAGGCCGG + Intronic
942993527 2:182232229-182232251 AAGCAAAATCATGAGGTGGCTGG - Intronic
943020420 2:182565943-182565965 AAGAAAAAGAAGAAAGAGACAGG + Intergenic
943043071 2:182825814-182825836 AAAAAAAAAAAAAAGGAGGCGGG + Intergenic
943464958 2:188217867-188217889 AAGAAAAGGGAGCAGGAGGCTGG - Intergenic
943519267 2:188927499-188927521 AATAAAAATCTGAAGAAGGTAGG - Intergenic
943561794 2:189472920-189472942 AAGAAATATCATAAGGAGGCCGG + Intronic
943577136 2:189643072-189643094 AAAAAAAAGGAGAAGGAGGGAGG - Intergenic
944117875 2:196208741-196208763 AGGAATACACAGAAGGAGGCTGG + Intronic
944746061 2:202657777-202657799 AACAAAAAGCAGAAGGGGCCAGG - Intronic
944886894 2:204072270-204072292 AAGATATTTCAGAAGGAGGCAGG - Intergenic
945231158 2:207591727-207591749 AATACTAATCAAAAGGAGGCTGG - Intronic
945322905 2:208447290-208447312 AAAATAAATTGGAAGGAGGCTGG + Intronic
945483551 2:210368844-210368866 AAGAAAATTCAGAAGGAAAATGG - Intergenic
945929593 2:215841784-215841806 TAGAAAATTCAGGAGCAGGCCGG + Intergenic
946098103 2:217292832-217292854 AAGCAAAAACAGAAAGAGGGAGG - Intronic
946115496 2:217458427-217458449 AAGGAGAATAAGAAAGAGGCTGG - Intronic
946439285 2:219681442-219681464 AAGGAAAATAAGAAGGAGATAGG - Intergenic
947147019 2:227077700-227077722 AAAAAAAAAAAGAAGGAGGAGGG + Intronic
947629371 2:231642003-231642025 AAGAAGAATGAGAAGGCTGCCGG - Intergenic
947682941 2:232052318-232052340 AAAGAAATTAAGAAGGAGGCTGG - Intronic
947943343 2:234077667-234077689 AATTAAAATCAGAAATAGGCCGG - Intergenic
948030205 2:234811492-234811514 AAGAAAAACCAGAAGAAGAGTGG - Intergenic
948302140 2:236915508-236915530 CAGGAAATTCAGAAGGAGGTTGG - Intergenic
948564376 2:238874437-238874459 AAGAAAAATGTTAAGGATGCAGG + Intronic
948683051 2:239649732-239649754 TAAAAAAATCAGGAGTAGGCTGG + Intergenic
948959645 2:241323160-241323182 AAAAAAAATTAGATGGTGGCTGG - Intronic
949066818 2:241996004-241996026 AAGCACATTGAGAAGGAGGCTGG - Intergenic
1168891344 20:1296942-1296964 ATGGAAAACCAGAAGAAGGCTGG - Intronic
1169253299 20:4077090-4077112 AAGAAACCAAAGAAGGAGGCAGG - Intergenic
1169259348 20:4124507-4124529 AAGAAAAAAGAGAGGGGGGCGGG - Intronic
1169369400 20:5016983-5017005 AAAAAAAAAGAGAAGGAGACAGG - Intergenic
1169371829 20:5033907-5033929 AAGAAAAATCAGAAAGTGGGTGG - Intergenic
1169376112 20:5067748-5067770 AAAAAAAAGCAGAGGGGGGCTGG - Intergenic
1169608570 20:7352318-7352340 AAATATAATCAGAAGGAGCCTGG - Intergenic
1169792364 20:9425025-9425047 AAGACAAAGGAGAAGGAGGAAGG - Intronic
1170089891 20:12579300-12579322 TAGAAAAATCAGGATGAGGAAGG - Intergenic
1170480926 20:16764190-16764212 AAGAAACATCAGTAGGAGAGTGG - Intronic
1172281640 20:33711992-33712014 AAAAAAAATCACTAGGGGGCAGG + Intronic
1172325701 20:34032825-34032847 AAGAAAAATCAGAATTAGAGAGG - Intronic
1172567842 20:35944898-35944920 AAAAAAAACTAGAAGGAGACAGG - Intronic
1172569790 20:35960932-35960954 AAGAAAAAGCGGGAGGAGGGGGG - Intronic
1172728360 20:37064920-37064942 AAAAAAAAAAAGAAAGAGGCCGG - Intronic
1173163916 20:40672617-40672639 AAGAAAAAGAAGAAGAAGGTGGG + Intergenic
1173186008 20:40840801-40840823 AAGGAAAAACAGAAGGAAGGAGG + Intergenic
1173281772 20:41634847-41634869 AAAAAAAATAAATAGGAGGCTGG + Intergenic
1173442938 20:43094380-43094402 AAAAAAAAAAAGAAAGAGGCCGG - Intronic
1173613242 20:44386145-44386167 AAAAAAAATCAGATGGTGGCTGG - Intronic
1173622952 20:44450500-44450522 AAGAACCATCACAGGGAGGCAGG - Intergenic
1173782442 20:45767729-45767751 AATAAAAAGGAGAAGGAGGAAGG + Intronic
1173890923 20:46509600-46509622 ATGGAAAATGAGAAGGAGGTGGG - Intronic
1173991240 20:47305236-47305258 AAGAAAAAAAAAAAAGAGGCAGG - Intronic
1174003324 20:47390637-47390659 AAAAAAAAACAGGAGGCGGCCGG - Intergenic
1174116540 20:48230289-48230311 AGTAAAGATGAGAAGGAGGCGGG - Intergenic
1174147109 20:48459662-48459684 AAGAAAAATCACCTGGGGGCCGG - Intergenic
1174310318 20:49648256-49648278 AAGAAAGAAGAGAAAGAGGCTGG + Intronic
1174325361 20:49774480-49774502 AAGAAAAAAAAAAATGAGGCTGG + Intergenic
1174660225 20:52205937-52205959 ATGAAAAATCAGAAGGTAGGTGG - Intergenic
1174817214 20:53697298-53697320 AAAAAAAAAAAAAAGGAGGCCGG + Intergenic
1174992980 20:55534186-55534208 AAGAAAAGGAAGAAGGTGGCCGG + Intergenic
1175065311 20:56279619-56279641 AAGAAAAATGAAAAGGAGAGGGG + Intergenic
1175069682 20:56322726-56322748 AGGAGAAACGAGAAGGAGGCAGG + Intergenic
1175779448 20:61672955-61672977 TAGAAGAAGAAGAAGGAGGCAGG + Intronic
1176721412 21:10396801-10396823 AAAAAAAAGGAGAAGAAGGCTGG + Intergenic
1176929386 21:14789884-14789906 AAGAAAAATTAGAAGAAGCAAGG - Intergenic
1177115953 21:17087640-17087662 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
1177307777 21:19342548-19342570 ATTAAAAACCAGACGGAGGCTGG - Intergenic
1177372103 21:20217956-20217978 AAGGAAATTCATAAGGAGCCTGG - Intergenic
1178184957 21:30208617-30208639 AAGAAAGAAAAGAAGGAGGCAGG + Intergenic
1178370557 21:32023575-32023597 AAGAAAAGTCAGAGGGAGCTGGG - Intronic
1178455295 21:32744275-32744297 AAGAAAAAAAAAAAGGAGGGGGG + Intronic
1178559989 21:33629557-33629579 ATAAAAAATCAGTAGGAGGCTGG - Intronic
1178711082 21:34917280-34917302 AAGAGAAAGCAGATGGAGACAGG + Intronic
1179147546 21:38781619-38781641 AAGAGAAATCAAAATGTGGCTGG - Intergenic
1179356491 21:40665181-40665203 AAGAAAACACAGAGGCAGGCTGG + Intronic
1179396218 21:41042817-41042839 AAGAAAAATAAGAAGGAAGACGG - Intergenic
1179992651 21:44956690-44956712 AAGGAAAATCAGCATGAGACCGG - Intronic
1180371251 22:12039292-12039314 AATAAAAATAAGAAGGAGGTTGG + Intergenic
1180439071 22:15346277-15346299 AAAAAAAATCAGTGAGAGGCCGG - Intergenic
1180521929 22:16216709-16216731 AAAAAAAATCAGTGAGAGGCCGG - Intergenic
1180897408 22:19346909-19346931 AAGAATAATCAGCAGGAAGGAGG + Intronic
1180928451 22:19572570-19572592 AAAATAAAACAGCAGGAGGCTGG + Intergenic
1181449387 22:23008395-23008417 AAGAAAAAAAAGCAAGAGGCAGG + Intergenic
1181469662 22:23130157-23130179 AAGAAAAAGAAAAAGAAGGCCGG + Intronic
1181577530 22:23804835-23804857 TAAAGAAATCAGAAAGAGGCTGG - Intronic
1181704482 22:24641112-24641134 AAAAAAAAAAAAAAGGAGGCTGG - Intergenic
1182282281 22:29224538-29224560 AATGAAAACCAGAGGGAGGCTGG - Intronic
1182367969 22:29791381-29791403 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
1182488372 22:30653363-30653385 AAAAAAAAAAAGAAGGAGGAAGG - Intronic
1182631693 22:31690934-31690956 AAAAAAAATTAGCTGGAGGCCGG - Intronic
1182860681 22:33556709-33556731 AAGAAAAAAAAAAAAGAGGCTGG + Intronic
1182912504 22:33996860-33996882 AACAAAAATAAGAAGCAGGCTGG - Intergenic
1183255404 22:36758569-36758591 AAGGAAACTCAGATGGAGTCAGG + Intronic
1183257335 22:36770968-36770990 AAGAAAAAGGAGAAGCAGGCGGG - Intronic
1183389003 22:37533135-37533157 AAGAAAAAAGAAAAGAAGGCGGG + Intergenic
1183438051 22:37806697-37806719 AACAAAAATGAGAAGGAAACTGG - Exonic
1183670863 22:39271776-39271798 AAAAAAAAATAGAAGGTGGCTGG - Intergenic
1183804179 22:40194166-40194188 AAGGAAAAGAAGAAGGAGTCTGG + Intronic
1183884813 22:40870721-40870743 AAGAAAAATTAAAAGGGGCCGGG + Intronic
1183974936 22:41506547-41506569 TATAAAAAACAGAATGAGGCCGG - Intronic
1184003798 22:41694334-41694356 AATAGAAACCAGAGGGAGGCTGG + Exonic
1184064498 22:42109743-42109765 AAGAAAACTCAGAAGGAAAATGG - Intergenic
1184458169 22:44623075-44623097 TAGAAAAATGAGAAAGAGGCCGG + Intergenic
1184506233 22:44905217-44905239 AAGAAAAAATAGGAGCAGGCAGG - Intronic
1184515354 22:44958584-44958606 AAAAAAAATCAAAGGAAGGCTGG - Intronic
1184632849 22:45798686-45798708 AAGAAAAATCAGATGCATGCAGG + Intronic
1184791077 22:46700427-46700449 ATGCAAAATCAGAAGTAGGCCGG + Intronic
1185177876 22:49340354-49340376 AAGAAGAAAAAGAAGGAGGCTGG - Intergenic
1185304942 22:50109852-50109874 AAGAGAAAGGAAAAGGAGGCTGG + Intronic
1203325638 22_KI270738v1_random:13100-13122 AAGACAAATGAGAAGAGGGCAGG - Intergenic
949121263 3:387366-387388 AAGAAAGAACAAAAGGAGCCAGG - Intronic
949502323 3:4692822-4692844 CATAAAAATAAGATGGAGGCAGG + Intronic
949665736 3:6337489-6337511 AAGATAAAAAAGAAGGAGGAGGG + Intergenic
949937079 3:9124302-9124324 AACAAAATTCAGAAGAAGGCTGG + Intronic
949976518 3:9465990-9466012 TATGAAAATTAGAAGGAGGCCGG + Intronic
950035626 3:9883157-9883179 AAAAAAAAAAAGAAGAAGGCCGG - Intergenic
950071779 3:10158444-10158466 AAAAAAAAAGAAAAGGAGGCCGG - Intergenic
950403923 3:12792763-12792785 AAGAAAAAAGAAAAAGAGGCTGG - Intergenic
950771386 3:15314368-15314390 AAGAAAAACCAGACAGAGGCGGG - Intronic
950908209 3:16558360-16558382 AAGAAAAATAAAATGGAGCCAGG + Intergenic
951037382 3:17948809-17948831 AAGAAAGAGCAGAGGAAGGCAGG - Intronic
951044844 3:18026568-18026590 AAGAGAAATAGGAAGGAGGGGGG - Intronic
951534185 3:23726531-23726553 AAGAAAGAAAAGAAGGAGGAAGG + Intergenic
951679936 3:25284060-25284082 CAGCAAAATGAGAAGGAGGGAGG - Intronic
951846307 3:27088381-27088403 AAGGAAAATGATATGGAGGCTGG + Intergenic
952064277 3:29549046-29549068 AAAAAAAAACAGAAGTAGGAGGG - Intronic
952395248 3:32915334-32915356 AATAAAAATGAGAAAGAGGCCGG - Intergenic
952647621 3:35680777-35680799 AAGAAGAAAGAGAAGGAGGGAGG - Intronic
952832932 3:37580313-37580335 AAGAAAAATCAGTGGATGGCTGG + Intronic
952874977 3:37937185-37937207 AAGAAACATCAGAGGTAGGGGGG + Intronic
952882100 3:37991514-37991536 AAGAAGAACCAGGGGGAGGCAGG + Intronic
953164234 3:40450245-40450267 CAGAAAAATAAAAAGGAGGATGG - Intergenic
953313347 3:41902281-41902303 AAGAAAACACAAAAAGAGGCCGG + Intronic
953907858 3:46877304-46877326 CAGAGAAATCAGAGGGGGGCTGG - Intronic
953969536 3:47336332-47336354 AAGGAAAATCAGAATCAGACAGG - Intronic
954015594 3:47687382-47687404 CAGAAAAAACAGGAAGAGGCTGG + Intronic
954189617 3:48948255-48948277 AAATAAAATAAAAAGGAGGCCGG - Intronic
954191928 3:48969167-48969189 AAAAAAAAAAAGAAAGAGGCTGG - Intronic
954345594 3:49995267-49995289 AAAAAAAAATATAAGGAGGCCGG + Intronic
954487606 3:50868366-50868388 AAGAAAAAACAAAAGCAGGCCGG - Intronic
954653347 3:52178612-52178634 AAGGACAATAAGGAGGAGGCTGG + Intergenic
954843196 3:53531146-53531168 TACAAAAATGAGGAGGAGGCTGG - Intronic
954900739 3:54017111-54017133 AAAAAAACTCAGAGGGAGGAAGG - Intergenic
954946618 3:54431041-54431063 AAGAAAAATCATAAGGGGCCTGG + Intronic
954951135 3:54474708-54474730 AACAAACAGAAGAAGGAGGCTGG + Intronic
955002778 3:54942591-54942613 AAGAAAAAGAAGCAGGAGCCAGG + Intronic
955307450 3:57848549-57848571 AAGAAAAAGGAGAAGGAGGGAGG - Intronic
955598711 3:60621130-60621152 AAAAAAAATCAAAAGTAGACTGG - Intronic
955620126 3:60854542-60854564 AAAAAAAAATAGAAGTAGGCTGG - Intronic
955824731 3:62934055-62934077 CAAAAAAATCAAAATGAGGCCGG + Intergenic
956058224 3:65323000-65323022 TAGAAAAAGAAAAAGGAGGCCGG - Intergenic
956198803 3:66683940-66683962 AAGAAAAAGGAGGAGGAGGAGGG - Intergenic
956657573 3:71567162-71567184 AAGAAAAATGAGAAAGTGGACGG + Intronic
956693688 3:71900931-71900953 AAGAAAAACCATAAGGGGCCAGG - Intergenic
956960387 3:74392399-74392421 AAGAAAAAGAAGAAGCAGGGTGG - Intronic
957188442 3:76974296-76974318 AAGAAAAATAAGAAAAAGGGGGG - Intronic
957307668 3:78479284-78479306 AAGAAAAATAAGGTGGAGGCAGG - Intergenic
957422903 3:79994860-79994882 CAGAAATATCAGAAGGAGCATGG - Intergenic
957598619 3:82302103-82302125 AAAAGAAGTCAGAAGGAGCCAGG - Intergenic
957751656 3:84426582-84426604 AAGAAAAATAGGATGGAGGCTGG + Intergenic
957765953 3:84623913-84623935 AAGAAAAATAAGAACGAGAAAGG + Intergenic
957842754 3:85692931-85692953 AAGAAAAATCAGAAGGAGGCCGG + Intronic
957842853 3:85693589-85693611 AGAAAAAATCAGAAGGAGGCTGG + Intronic
957883084 3:86247995-86248017 AAAAAAAAAAAGGAGGAGGCCGG + Intergenic
958720349 3:97836218-97836240 GAGAAAAATCAGGAGGAGAGAGG - Intronic
959069431 3:101688587-101688609 AAAAAAAAAAAAAAGGAGGCCGG + Intergenic
959114615 3:102161963-102161985 AAGAAATAAGAGGAGGAGGCAGG + Intronic
959127248 3:102305058-102305080 AAGAAAAATCAGAATGACATTGG + Intronic
959320160 3:104863370-104863392 AAAAAAAATCAAATGGAGGCTGG + Intergenic
959581401 3:107986619-107986641 AAGAAAAAACAGTAAGAGGCTGG + Intergenic
959951159 3:112181936-112181958 AAGACAAAGCTGAAGTAGGCAGG + Intronic
960246370 3:115404603-115404625 AAGAAAAGAAAGAAGGAGGGTGG + Intergenic
960350383 3:116585757-116585779 AAGAAAGAGGAGAAGGAGGAGGG + Intronic
960925801 3:122794190-122794212 CACTAAAATCAGAAGGAGTCAGG - Intergenic
961156749 3:124686082-124686104 AAGAAGCATAAGAAGGAGGCAGG + Intronic
961228049 3:125271815-125271837 TAAAAGAACCAGAAGGAGGCAGG - Intronic
961529333 3:127530742-127530764 AAAAAAAAACAGAAACAGGCTGG + Intergenic
961723291 3:128909841-128909863 AAGGGAAAACAGAAGGTGGCTGG + Intronic
962005796 3:131348417-131348439 AAGAACTATGAGAAGGAGCCTGG + Intronic
962156321 3:132952449-132952471 AAGAAATATCAGAAAGAGCCTGG - Intergenic
962646090 3:137441749-137441771 AAGAAAATTCAGAGCAAGGCTGG - Intergenic
963047326 3:141112347-141112369 ATCAAAAGACAGAAGGAGGCCGG + Intronic
963235580 3:142952790-142952812 AACAAAAAGCAGCAGAAGGCAGG - Intronic
963291774 3:143497536-143497558 ATGAGAAATCAGAAAGATGCTGG + Intronic
963411952 3:144939837-144939859 AACAAAAATAGGAAGGAAGCTGG + Intergenic
963831228 3:150011801-150011823 AAGAAGAAGAAGAAGAAGGCCGG + Intronic
963834003 3:150037831-150037853 AAGAAAGAAAGGAAGGAGGCAGG + Intronic
963896707 3:150694107-150694129 AAGAAAAAATAGGAGGAGGAAGG - Intronic
963988215 3:151622468-151622490 AAGAAAGATGGGAAGGAGGAGGG - Intergenic
964106570 3:153046637-153046659 AAGAAAAACCAAAAGCAGGTCGG - Intergenic
964139820 3:153384835-153384857 CAGAAAAAACAGAAGCAAGCAGG + Intergenic
964236002 3:154528592-154528614 AAGAAAAAGGAAAAGGAGGAAGG - Intergenic
964607818 3:158576631-158576653 TAGAAAGCTCAGAAGCAGGCTGG + Intronic
965048948 3:163618883-163618905 AAGAAAAGTCAAATAGAGGCTGG - Intergenic
965323116 3:167271490-167271512 AAGAAAACTCAGAAGGAAAATGG + Intronic
965611540 3:170549203-170549225 AAAAAAAAAAAGAAGAAGGCCGG - Intronic
965747262 3:171938450-171938472 GAGACATATCAGAAGGTGGCAGG + Intronic
965764526 3:172115937-172115959 AACAGAAATCAGAAGGAGGAGGG - Intronic
966195071 3:177304953-177304975 CTTAAAGATCAGAAGGAGGCCGG - Intergenic
966233800 3:177678302-177678324 AAGCAAAATCATATTGAGGCTGG + Intergenic
966428064 3:179802236-179802258 AAGAAAAAAGAAAAGCAGGCTGG + Intronic
966705276 3:182906790-182906812 AAGAAGAAGAAGAAGAAGGCCGG + Intronic
966963289 3:184963109-184963131 AAGAAAAAGAATAAGGAGGGAGG - Intronic
967277104 3:187786816-187786838 AAGAAAGAGCAGACAGAGGCAGG - Intergenic
967336687 3:188352045-188352067 AAGAAAAATGACAAGGGGGGAGG - Intronic
967563251 3:190942754-190942776 AAGGGAAATAAGAAGGAGGGAGG - Intergenic
967864933 3:194182291-194182313 AAGGAAGAGCAGAAGGAGGAGGG - Intergenic
968120001 3:196119528-196119550 AAGAATGATTAGAAGGAGGCTGG + Intergenic
968210619 3:196845648-196845670 AAAAAAAAGAAGAAGAAGGCCGG - Intergenic
968315514 3:197720967-197720989 AAAAAAAATCAGAAGATAGCCGG - Intronic
968795416 4:2700499-2700521 AAGAAAAATAAGAAGAAGAAAGG + Exonic
968842580 4:3018579-3018601 AAGAAATTAAAGAAGGAGGCTGG + Intronic
969255075 4:5995959-5995981 AAGAAGAACCTGAAGGAGGTAGG - Intergenic
969270280 4:6095000-6095022 AAGAAAAATAAAAAGGAAGAGGG + Intronic
969372633 4:6743515-6743537 AAGAAAAAGAAGAAGGGGGAGGG - Intergenic
970347005 4:15162134-15162156 AAGAATAAGCAGGAGGAGGTGGG - Intergenic
970553098 4:17203930-17203952 TGGAAAAATCAGAAGGAAGAGGG + Intergenic
970674921 4:18438223-18438245 AAAAAAAAAAAGAAGGAGCCTGG - Intergenic
970735781 4:19165870-19165892 CAGACAAATCAGAAGGAGTCTGG + Intergenic
970750995 4:19360917-19360939 AAGGAAAATGGGAAGGAGACAGG - Intergenic
970994580 4:22250642-22250664 AAGAATAACCAGAAGCAGGTTGG - Intergenic
971164243 4:24166246-24166268 AAGAAAAGTCCGAAGCTGGCAGG + Intergenic
971400923 4:26274637-26274659 AAAAAAAAGAAGAAGAAGGCTGG + Intronic
971445909 4:26748720-26748742 AAGAAAGACTAGAAGTAGGCTGG - Intronic
971488321 4:27185069-27185091 AATAAATATCAGGAGGAAGCTGG - Intergenic
971790137 4:31159593-31159615 AAGAAAGAAGAGAAGAAGGCAGG + Intergenic
971846251 4:31922753-31922775 AAGAGACATCCGAAGGAGGTAGG + Intergenic
971919443 4:32917820-32917842 AAGAAAAGAAAGAAGGAGGAAGG - Intergenic
972289897 4:37681821-37681843 GTCAAAAATCAGAAGGAAGCCGG - Intronic
972356668 4:38285500-38285522 AAGAAAACTCAAGACGAGGCTGG - Intergenic
972433437 4:39007233-39007255 AAGAAAAATAACAAGGCGACGGG - Intronic
972776097 4:42242020-42242042 AACAAAAGGCAGAAGGAGGGAGG + Intergenic
973314978 4:48750162-48750184 AAGAAAAAAAAGGAAGAGGCTGG + Intronic
973344918 4:49044646-49044668 AAAAAAGATCAGTAGGAGCCAGG + Intronic
974144543 4:57930641-57930663 ATGAGAAGACAGAAGGAGGCCGG + Intergenic
974229283 4:59088962-59088984 TAGAAAAAGAAGAAGGAGGAGGG - Intergenic
974305582 4:60134549-60134571 ATGAAGCATCAGAAGCAGGCTGG - Intergenic
974583431 4:63836948-63836970 AAGAATCATCAGGTGGAGGCAGG + Intergenic
974938084 4:68431627-68431649 AAAAAAAAAAAGAAGGAGGTGGG + Intergenic
975067759 4:70089362-70089384 AGGAAAAAAAAGAGGGAGGCTGG + Intergenic
975129948 4:70823097-70823119 AAAAAAAATAAAAAGTAGGCCGG + Intronic
975176292 4:71293265-71293287 CATAAAATCCAGAAGGAGGCTGG + Intronic
975378662 4:73673341-73673363 AAAAAAAATTAGAAAGTGGCCGG - Intergenic
975476136 4:74825316-74825338 AATAAAAATCAGAAGTCGGCCGG - Intergenic
975868296 4:78749152-78749174 AAAAAAAATCAGAAGGATGAAGG + Intergenic
975931805 4:79533564-79533586 AAGAAAAAACAGAAGTAAACAGG - Intergenic
976103629 4:81593047-81593069 AAGAACAAGCAGAAGGAGCAGGG + Intronic
976283604 4:83349278-83349300 GAGAAAAATGAGTAGGAGGATGG - Intergenic
977005453 4:91563831-91563853 AAGCAAATTCAGTAGGATGCTGG + Intronic
977129846 4:93222324-93222346 AAAGAAAATCAGAAGTTGGCAGG + Intronic
977232344 4:94466699-94466721 CTGAAAAATCAGGAAGAGGCTGG - Intronic
977254450 4:94725518-94725540 AGTAAAAATCAAAAGGGGGCTGG - Intergenic
977539292 4:98297005-98297027 AAAAAAAAAGAGAACGAGGCAGG - Intronic
978167045 4:105622002-105622024 AGAAAAAATCAGCAGGAAGCAGG + Intronic
978336179 4:107672063-107672085 AATAAAAATGAGATGGAGGTGGG + Intronic
978404542 4:108365107-108365129 AAGAAGAAACAGAAGAAGGCAGG + Intergenic
978445051 4:108772449-108772471 AAGAAATATTAGCAGAAGGCTGG - Intergenic
978858321 4:113418646-113418668 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
979092111 4:116497273-116497295 AAGAAATATAAGACGGAAGCAGG - Intergenic
979405014 4:120299168-120299190 AAGAAAAAGGAGAAAGAGGAAGG - Intergenic
980223574 4:129951137-129951159 AGGAAAAGACAGAAGGAGGGAGG + Intergenic
980652139 4:135731770-135731792 AGGAAAAAGCAAAAGGAGCCTGG - Intergenic
980777854 4:137460308-137460330 AAGAGAAATCTGAAGTTGGCAGG - Intergenic
980841060 4:138261913-138261935 AAGAAGAAACAGGAGGAGGGAGG - Intergenic
981034792 4:140158152-140158174 ATGAGAAATGAGATGGAGGCTGG + Intergenic
981315169 4:143334786-143334808 AAGAAAAATCTGAAAAAGCCTGG - Intergenic
981640070 4:146931975-146931997 AAGAAAAAGCAGAAAGAAGAAGG - Intronic
981766640 4:148258337-148258359 AAGGAAAGAGAGAAGGAGGCAGG + Intronic
982217695 4:153096282-153096304 AATAAAAATAAAAAGGAGGAGGG + Intergenic
982265299 4:153533279-153533301 AAAAGAATTAAGAAGGAGGCTGG - Intronic
982458550 4:155639275-155639297 AAAAAAAATTAAAAGTAGGCCGG + Intergenic
982765148 4:159337956-159337978 AAGAAACAGCAAAATGAGGCTGG + Intronic
982840968 4:160185588-160185610 AAGACAGATGAGCAGGAGGCTGG - Intergenic
982922073 4:161288368-161288390 AAGAAAAATCAAAAAGAGGCCGG + Intergenic
982947252 4:161639952-161639974 AAGAAAAAAATGAAGGAAGCAGG - Intronic
983019134 4:162653529-162653551 AAGAAAAAGGACAAGGAGGTTGG - Intergenic
983417724 4:167479993-167480015 AATAAACATCAGAAGTAGCCAGG + Intergenic
983967244 4:173827909-173827931 AAAAACAAACAGAAGGGGGCAGG - Intergenic
984090993 4:175375461-175375483 AGGAAAGATCAAAAGCAGGCCGG + Intergenic
984450522 4:179895196-179895218 AAGAAAAATCAAGAGTTGGCCGG - Intergenic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
984741957 4:183173581-183173603 AAAACAAGTCAGATGGAGGCAGG - Intronic
984766857 4:183406476-183406498 TAAAAAAATAAAAAGGAGGCCGG + Intergenic
984833641 4:183999421-183999443 GAGAAAAATCAGCAGAAGCCAGG - Intronic
984908780 4:184652849-184652871 AAGAAAAAAGAAAAGGAGGGAGG + Intronic
985135977 4:186786543-186786565 AAGAAAAATGAAAATGATGCTGG + Intergenic
985260297 4:188108602-188108624 TAGAGAGATCAGAAGAAGGCAGG - Intronic
985416178 4:189737913-189737935 CAGGAAAATCAGAAGGATGCTGG + Intergenic
985811230 5:2088465-2088487 AAGAAAAGTAAGAACCAGGCAGG + Intergenic
986248050 5:6029019-6029041 AACAAAAAGCAAAAGGAGGCTGG - Intergenic
986310575 5:6547827-6547849 AAGAAAAGGAAGAGGGAGGCAGG + Intergenic
986372669 5:7096025-7096047 AAGAAAAATCAAAGTGAGACAGG - Intergenic
986393426 5:7305472-7305494 TAGAAAAGTAAGAAGTAGGCAGG + Intergenic
986541663 5:8851021-8851043 AAGAAAAATAAGAAGCAGCCCGG - Intergenic
986568476 5:9139872-9139894 TAGAAGAATCAGAAGGAATCGGG - Intronic
986854925 5:11857376-11857398 AACAAAAATGACAATGAGGCTGG + Intronic
986968344 5:13302432-13302454 AAGAAAGATTATAAAGAGGCAGG + Intergenic
987047919 5:14124828-14124850 AAAAAAATGGAGAAGGAGGCCGG + Intergenic
987290773 5:16505999-16506021 AAGATAAACCACAAGGAGGGGGG + Intronic
988185746 5:27859359-27859381 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
988581956 5:32476204-32476226 AAAAAAAATCAAAATTAGGCTGG + Intergenic
988967091 5:36430306-36430328 AATAAAAAACAGAAAGAAGCAGG - Intergenic
988985555 5:36615110-36615132 GATACAAATCAGAAGGAGGGTGG - Intronic
989079707 5:37605009-37605031 AAAAAAAAAAAGAAGGAGGGGGG - Intronic
989325190 5:40184909-40184931 AAGAAAAAAAGGAAGGAGGGAGG + Intergenic
989408269 5:41086725-41086747 AAGAGAAACCAGAAGGAGGCTGG - Intergenic
989414874 5:41162272-41162294 AACATAAATCAGAAGCAGGGCGG - Intronic
989784055 5:45305744-45305766 AAGAAGAAACAGAAGAAGGGAGG + Intronic
989796344 5:45478825-45478847 AAGAATAAGCTGAAGAAGGCAGG + Intronic
990208149 5:53452455-53452477 AAGAAATATGAGAAGGTGACAGG + Intergenic
990569068 5:57059701-57059723 CAGAAATATCAGAAACAGGCTGG - Intergenic
991077383 5:62555944-62555966 AAAAAAAAACTGAAGGTGGCTGG - Intronic
991515264 5:67428055-67428077 AAGAAAACTAAGAAATAGGCGGG - Intergenic
992306743 5:75447768-75447790 AACAAAAAAAAAAAGGAGGCCGG - Intronic
992689032 5:79225493-79225515 GAGGAAAATGAGAAGGAAGCTGG - Intronic
992742660 5:79789830-79789852 AAGAATAAACAGAACAAGGCTGG - Intronic
992790182 5:80206494-80206516 AAGAAGAATCTGGAGGAAGCTGG - Intronic
992861813 5:80918949-80918971 AAGAAAAAAGTGAAGGAGGAAGG + Intergenic
992880708 5:81106526-81106548 CAGAGAAATCAGTTGGAGGCAGG - Intronic
993070375 5:83154598-83154620 AAGAAAAACCAGAAAGACTCAGG - Intronic
993127357 5:83851583-83851605 AAGAAAAACCAGATGCAGGCCGG - Intergenic
993138335 5:83998420-83998442 AATAAATATCAGCAGGAGACAGG + Intronic
993403341 5:87480287-87480309 AAGAAAAGTCAGAAATAGGAAGG - Intergenic
993961834 5:94307357-94307379 AAGAAACATCAGAGGGTGACAGG - Intronic
994476111 5:100272444-100272466 AAGAAAAGTTAGAAGCTGGCCGG + Intergenic
994483979 5:100372241-100372263 AAGAAAAATAAAAAGAAGGGAGG + Intergenic
994627107 5:102233553-102233575 AAAAAAAAGCTGAAGGAGCCTGG + Intergenic
994801262 5:104380196-104380218 AATAAAACTGAGCAGGAGGCAGG + Intergenic
994901115 5:105770688-105770710 AAGAAAATTCAAAAGTAGGTTGG + Intergenic
995308728 5:110687094-110687116 AAGAAAGGTCAGAAGGAGAATGG - Intronic
995345694 5:111114310-111114332 GAGAAAAATGAGAAGGAAGGTGG + Intronic
996199800 5:120657817-120657839 AACAAAAAGCAGAAGGTGGGAGG - Intronic
996281042 5:121729243-121729265 AGGAGAAGACAGAAGGAGGCGGG - Intergenic
996380976 5:122862317-122862339 AAGAAAAAAAAGAAAGAGGCTGG + Intronic
996397386 5:123026896-123026918 TAGAAAACCCAGAAGTAGGCTGG + Intronic
996501395 5:124220560-124220582 AAGAAAAAGAAGAAAGAGGAGGG - Intergenic
997464604 5:134078963-134078985 AAGAAAAAAAAAAAGGAGGGGGG - Intergenic
997475066 5:134138036-134138058 CTGAAAAATGAGAAGGAGGGTGG - Intronic
997509946 5:134447186-134447208 AAGAAAGAACAGGAGGAGGAGGG + Intergenic
997763360 5:136472518-136472540 AAGAAGAATCAAAAGGAGATGGG - Intergenic
997982880 5:138480589-138480611 AAGAAAGAAAAGAAAGAGGCCGG - Intergenic
998209051 5:140179957-140179979 AAGAAAAAAGAGAGTGAGGCTGG - Intronic
998671966 5:144363524-144363546 AAAAAAAAACAGTAAGAGGCAGG - Intronic
998858597 5:146420782-146420804 AATAAAAAAGAGACGGAGGCTGG + Intergenic
999115265 5:149157433-149157455 ATAAAGAATCAGAAGGAGGAAGG - Intronic
999320807 5:150613952-150613974 ATGGGGAATCAGAAGGAGGCTGG + Intronic
999493023 5:152070339-152070361 TTGAAAAAACAGAAGGAAGCAGG - Intergenic
999543355 5:152598798-152598820 AACATAAATCAGAAGAAGGGTGG + Intergenic
999674780 5:153987986-153988008 AAGAAAAGGAAGGAGGAGGCAGG - Intergenic
999721925 5:154405011-154405033 AAGAAAAATGAAGAGGAGGGAGG + Intronic
999809962 5:155118252-155118274 AAGAAAAAGCAGAGGAAGGAGGG + Intergenic
999874013 5:155782319-155782341 AAGAAAAATAAAAATGAGGCCGG - Intergenic
999908203 5:156166998-156167020 AGGAGAAATCAGAAGGAAGTAGG - Intronic
1000491262 5:161916385-161916407 AAAAAAAATCATAAAGAAGCAGG + Intergenic
1000598534 5:163244806-163244828 AAGACAGATCAGAATCAGGCAGG - Intergenic
1000716386 5:164650138-164650160 AAGAAAATTCAATGGGAGGCCGG + Intergenic
1001290495 5:170454664-170454686 AAGAAAAATGAGTAGGAAGTTGG + Intronic
1001468664 5:171992131-171992153 AAAAAAAAAAAAAAGGAGGCCGG + Intronic
1001890973 5:175338239-175338261 AAGAAGAAGAAGAAGGAGACAGG - Intergenic
1002062458 5:176633903-176633925 TAGAAAGATCAGTAGGAGGCTGG + Intronic
1002269576 5:178061601-178061623 AAGAAAAGCCACAAGGTGGCCGG - Intergenic
1002507351 5:179688950-179688972 AAAAAACAACAGAAAGAGGCCGG + Intronic
1002809681 6:615539-615561 ATGAAAAACCAGAAACAGGCTGG + Intronic
1002823953 6:755760-755782 GGGAAACATCAGCAGGAGGCGGG + Intergenic
1003034634 6:2632277-2632299 CAGAAAAATCAGAGGGAGGTGGG + Intronic
1003228560 6:4228731-4228753 TAGAAAAATGAGTAGAAGGCTGG + Intergenic
1003358694 6:5402103-5402125 AAAAACAACCAGAAGGAGGATGG - Intronic
1003376236 6:5580298-5580320 AAAAAAAAAGAGAAGGAGGGAGG + Intronic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003595364 6:7469594-7469616 AAAAAAAATCAAAAAGAGGCAGG - Intergenic
1004387211 6:15183534-15183556 AAAAAGAAGAAGAAGGAGGCTGG - Intergenic
1004390109 6:15202849-15202871 AAGAGAAATGAGAAGGGGTCAGG + Intergenic
1004569932 6:16835237-16835259 AAAAAAAAAGAAAAGGAGGCTGG - Intergenic
1004798494 6:19116728-19116750 AACCAAAATTAGAAGGAGGAAGG + Intergenic
1004849289 6:19680485-19680507 AAGAAATAACAGAAGAATGCGGG + Intergenic
1005458823 6:26047995-26048017 AAGAAATACCAGAAGGAGAAAGG + Intergenic
1005478785 6:26234851-26234873 AAGAAAAAGGCGAAGAAGGCAGG - Exonic
1005662477 6:28013203-28013225 AAGAACAATCAGAAGCAGTTTGG - Intergenic
1005741852 6:28799251-28799273 AAGAAAGAAGAGAGGGAGGCAGG + Intergenic
1006016416 6:31084749-31084771 AAAAAAAAAGAGGAGGAGGCAGG - Intergenic
1006024208 6:31137158-31137180 AAGAAAAAGAAGAAAGAGGCCGG + Intronic
1006112158 6:31754020-31754042 AAAAAAAAAAAGAGGGAGGCCGG - Intronic
1006179149 6:32143559-32143581 AAGAAAAAAGAAAAAGAGGCTGG + Intergenic
1006352126 6:33528713-33528735 GAAAAAAAACAGAAGGAGCCTGG + Intergenic
1006677579 6:35775579-35775601 AAAAAAAAGCAGAAGCAGGCAGG + Intergenic
1006716862 6:36126007-36126029 AAGCAAAATTACAAGGAGGCAGG - Intergenic
1006751316 6:36379579-36379601 AAGAAGAAAAAGAAGAAGGCCGG + Intronic
1007367714 6:41406635-41406657 AAGCAGAAGCAGAAGGAGGTTGG + Intergenic
1007514305 6:42399218-42399240 AACAAAAATCAGAAGGAAGTAGG + Intronic
1007647456 6:43393976-43393998 AAGAAAAATGAGTAAGGGGCTGG + Intergenic
1007671443 6:43557796-43557818 AAAAAAAAAAAAAAGGAGGCTGG + Intronic
1007732615 6:43957272-43957294 AAAAAAAATAAGAAAAAGGCAGG + Intergenic
1008003565 6:46386300-46386322 AATCAAAACCACAAGGAGGCCGG + Intronic
1009441247 6:63681492-63681514 AAGAAAAATTACAAAGAGGTAGG - Intronic
1009514533 6:64598163-64598185 AAGAAAAAAGAGAAGGGGCCAGG + Intronic
1009514935 6:64603265-64603287 AAGAAAGAAGAGAAGGAGGATGG - Intronic
1010237851 6:73589969-73589991 AAGAGAAATATGAAGGTGGCAGG + Intergenic
1010327692 6:74583998-74584020 AAAAATGATCAGAAGGAGGAAGG + Intergenic
1010591043 6:77712673-77712695 AAGGAACAACAAAAGGAGGCCGG + Intronic
1010949292 6:82016087-82016109 AAGAACATTCAGTAGTAGGCAGG + Intergenic
1011440955 6:87386722-87386744 AAGAAAAAAAAGCAGGGGGCGGG + Intronic
1011659032 6:89578278-89578300 AAAAAAAAAAAAAAGGAGGCGGG - Intronic
1011843346 6:91529306-91529328 AAGAAAGAGGAGAGGGAGGCAGG + Intergenic
1011910217 6:92426448-92426470 AAAAAAAAATACAAGGAGGCCGG - Intergenic
1012127374 6:95447784-95447806 AAGAAACATCAGAAGCAGTCGGG + Intergenic
1012917176 6:105182486-105182508 GAGAAAAATCAGAATGCAGCAGG - Intergenic
1013199706 6:107881504-107881526 AATAAAAAGCACAAGGAGGGAGG - Intronic
1013210607 6:107983518-107983540 AAAAAAAAACAGAATCAGGCTGG + Intergenic
1013314024 6:108924219-108924241 TTGAAAAATGAGCAGGAGGCCGG + Intronic
1013327612 6:109063271-109063293 AAGAGAAATAAGTAGGAGGGTGG + Intronic
1013424945 6:110003160-110003182 AAGAATAAGCAGAAGAAGGAAGG + Intergenic
1013793590 6:113860094-113860116 AAGAAGAACAAGAAGGAGGCTGG + Exonic
1014026708 6:116656378-116656400 AACAAAAGTGAAAAGGAGGCTGG - Intronic
1014562608 6:122909363-122909385 AAAAAAAAAAAGAAGAAGGCAGG - Intergenic
1014940262 6:127429834-127429856 AAACAATAACAGAAGGAGGCTGG + Intergenic
1015935345 6:138402831-138402853 AAGAGAAATGGGAAGGAGGGTGG - Intergenic
1016653484 6:146490178-146490200 CAGAAAAATCAGAATCAGCCAGG + Intergenic
1017092335 6:150771114-150771136 AAGAAAAATAAGAATGAGGGTGG + Intronic
1017225021 6:152010955-152010977 AACAATAATGAGAAGGAGGTAGG - Intronic
1017741159 6:157407895-157407917 AAGTAAAATAAGCAGGAAGCAGG + Intronic
1017757920 6:157545378-157545400 AAAAAAAAGGAGGAGGAGGCCGG + Intronic
1017757974 6:157545682-157545704 AAAAAAAAGTAGAAGGAGGGTGG + Intronic
1018130420 6:160725781-160725803 AATAAGAATCAGAAGAAAGCTGG + Intronic
1018302905 6:162422646-162422668 AAGAGTCATAAGAAGGAGGCTGG + Intronic
1018342958 6:162870883-162870905 AAGAAACAAGAGAAGGAGGGAGG - Intronic
1018461690 6:164004773-164004795 AAGAAAAAGAAGAGGGAGGGAGG + Intergenic
1018693562 6:166370555-166370577 AAGAAAACTAAAAAGAAGGCCGG + Intronic
1018816789 6:167338895-167338917 AAGAAAAAGAAGAAGGAAGAGGG - Intronic
1019794436 7:3039351-3039373 AAGAAAAATTAGAAGGCAGCTGG - Intronic
1019807283 7:3137202-3137224 AGAACAAATCAGAGGGAGGCAGG - Intergenic
1020043325 7:5020762-5020784 AAGAAAACTCTAAAGGTGGCAGG - Intronic
1020289610 7:6712632-6712654 AAGAAAACTCTAAAGGTGGCAGG - Intergenic
1020522472 7:9209652-9209674 AAGAATAATCAGAATGAGATAGG - Intergenic
1020571344 7:9866954-9866976 AAGAAAATTCAGAAGAAAGACGG - Intergenic
1020802464 7:12748544-12748566 TAGAAATATCCGATGGAGGCCGG + Intergenic
1020820208 7:12957883-12957905 AAAAAAAAAAAAAAGGAGGCGGG - Intergenic
1020907677 7:14084653-14084675 AAGGAAAACCAGAAGGAGACAGG - Intergenic
1020914876 7:14180363-14180385 GAAAAAAATCAGAAGGAGGGTGG - Intronic
1020954893 7:14728694-14728716 AAAAAAAAAAAAAAGGAGGCTGG - Intronic
1021167176 7:17355582-17355604 AAGAAAAAATAGAATGAGCCTGG + Intergenic
1021402088 7:20220874-20220896 AAGAAAAATCTGAACAAGGGGGG - Intergenic
1021449320 7:20768059-20768081 AAGAAATAACACAAGAAGGCCGG + Intronic
1021467339 7:20959997-20960019 AGGAAGAAACAGAAGGAGGGAGG - Intergenic
1022001850 7:26233494-26233516 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1022018926 7:26379500-26379522 AAGAAAAATAAGAATGAAGAGGG - Intergenic
1022037809 7:26550568-26550590 AAGAAAAATGAGGAGGAAGAGGG + Intergenic
1022076785 7:26979153-26979175 AAGAAATAACAAAAGCAGGCTGG - Intronic
1022268647 7:28784462-28784484 AAGCAAAATGAGCAGGAGGGAGG - Intronic
1022612183 7:31886893-31886915 AAGATAAAACAGAAGAAGGTAGG + Intronic
1022636596 7:32142172-32142194 AAGAAAAGGCAGAAGGAGAAGGG + Intronic
1022731282 7:33028703-33028725 TAGAAAAATCAGAAAAAGGATGG + Intronic
1023013751 7:35945118-35945140 AAAAAAAAAAAAAAGGAGGCTGG + Intergenic
1023114687 7:36851062-36851084 AAGAAAAATGAGAAAGAGAAAGG - Intergenic
1023291652 7:38674381-38674403 AAGAAACAACAGAAGGAATCTGG - Intergenic
1023567813 7:41540940-41540962 AGGAAGAAACAGGAGGAGGCTGG + Intergenic
1023757211 7:43431070-43431092 AAGAAAAATAAAAATGGGGCTGG - Intronic
1023826107 7:44010811-44010833 AAGAAAACTCTAAAGGTGGCCGG + Intergenic
1024077379 7:45828719-45828741 AAAAAAAAAAAAAAGGAGGCTGG - Intergenic
1024807171 7:53156397-53156419 AAGACAAATGAGAAGAGGGCGGG - Intergenic
1024840036 7:53575007-53575029 AAGAACCATCAGGTGGAGGCAGG - Intergenic
1025127030 7:56352684-56352706 AAAAAAAAAAAAAAGGAGGCTGG + Intergenic
1025319516 7:58079792-58079814 AAGACAAATGAGAAGAGGGCAGG + Intergenic
1025489153 7:61090255-61090277 AAGACAAATGAGAAGAGGGCAGG - Intergenic
1025554199 7:62283679-62283701 AAGACAAATGAGAAGAGGGCAGG - Intergenic
1025560582 7:62369595-62369617 AAGACAAATGAGAAGAGGGCAGG + Intergenic
1025562304 7:62382692-62382714 AAGAAAAATGGGAAGCAGGTAGG - Intergenic
1025635596 7:63317261-63317283 AAAAAAAAAAAAAAGGAGGCGGG + Intergenic
1025647100 7:63430919-63430941 AAAAAAAAAAAAAAGGAGGCGGG - Intergenic
1025840692 7:65143108-65143130 AAGAAAAATGGCAAGCAGGCAGG - Intergenic
1025878019 7:65507055-65507077 AAGAAAAATGGCAAGCAGGCAGG + Intergenic
1025882356 7:65552849-65552871 AAGAAAAATGGCAAGCAGGCAGG + Intergenic
1025891086 7:65649753-65649775 AAGAAAAATGGCAAGCAGGCAGG - Intergenic
1025936624 7:66043169-66043191 AAAAAAACTCAAAAGGAGCCAGG + Intergenic
1026087119 7:67271561-67271583 TATAAAAATCATAAGGTGGCCGG + Intergenic
1026089678 7:67289680-67289702 AAGAAAACTCTAAAGGTGGCCGG + Intergenic
1026217663 7:68364018-68364040 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
1026341263 7:69436175-69436197 AAGAAAAATAAGAAGGTGGATGG - Intergenic
1026344649 7:69463775-69463797 AAAAAAAAACAGAAACAGGCTGG - Intergenic
1026689978 7:72543138-72543160 TATAAAAATCATAAGGTGGCCGG - Intergenic
1026724607 7:72860829-72860851 AAGAAAACTCTAAAGGTGGCCGG - Intergenic
1026733161 7:72928952-72928974 AAGAAAGACTAGAATGAGGCAGG + Intronic
1026746747 7:73019054-73019076 AAGAAAACTCTAAAGGTGGCTGG - Intergenic
1026750399 7:73047197-73047219 AAGAAAACTCTAAAGGTGGCTGG - Intergenic
1026754046 7:73075307-73075329 AAGAAAACTCTAAAGGTGGCTGG - Intergenic
1026757697 7:73103343-73103365 AAGAAAACTCTAAAGGTGGCTGG - Intergenic
1026865371 7:73820966-73820988 AACAAAAATAAAATGGAGGCCGG - Intronic
1026963608 7:74425358-74425380 AAGAAAAAAAAGAGGGAGGGAGG + Intergenic
1027032851 7:74903632-74903654 AAGAAAACTCTAAAGGTGGCTGG - Intergenic
1027089706 7:75290144-75290166 AAGAAAACTCTAAAGGTGGCTGG + Intergenic
1027093351 7:75318072-75318094 AAGAAAACTCTAAAGGTGGCTGG + Intergenic
1027096994 7:75346039-75346061 AAGAAAACTCTAAAGGTGGCTGG + Intergenic
1027110869 7:75438637-75438659 AAGAAAGACTAGAATGAGGCAGG - Intronic
1027119271 7:75504991-75505013 AAGAAAACTCTAAAGGTGGCCGG + Intergenic
1027272554 7:76530620-76530642 AAGAAAACTCTAAAGGTGGCCGG - Intergenic
1027322354 7:77021649-77021671 AAGAAAACTCTAAAGGTGGCTGG - Intergenic
1027326007 7:77049703-77049725 AAGAAAACTCTAAAGGTGGCCGG - Intergenic
1027460795 7:78450986-78451008 AAGAAAAGACAGAAAGCGGCAGG + Intronic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1027949596 7:84797583-84797605 AAGCACAATCAGAAGGACACGGG - Intergenic
1028152247 7:87387653-87387675 AAGAAAAATCATAAGGAGGCTGG + Intronic
1028326581 7:89534307-89534329 TAGAAAAATGAGGAGGAGGCAGG + Intergenic
1028550078 7:92050588-92050610 AAAAAATATCAGAGAGAGGCAGG - Intronic
1028625262 7:92870473-92870495 AAAAAAAAAAAAAAGGAGGCCGG + Intergenic
1028848494 7:95510129-95510151 AAAAAAAATGAGAAGGCAGCTGG + Intronic
1028877425 7:95839325-95839347 AAGAAAAAGAGAAAGGAGGCTGG - Intronic
1029180759 7:98700053-98700075 AAGAAAAAGAAAAAGGAGGGAGG + Intergenic
1029273547 7:99391340-99391362 AAGAAAAAAAGGAGGGAGGCAGG - Intronic
1029398103 7:100323024-100323046 AAGAAAACTCTAAAGGTGGCTGG + Intergenic
1029539752 7:101175629-101175651 AAAAAAAAGAAGAAGAAGGCTGG + Intronic
1029718222 7:102345043-102345065 AAGAAAACTCTAAAGGTGGCCGG - Intergenic
1029754393 7:102564213-102564235 AAGAAAACTCTAAAGGTGGCCGG + Intronic
1029772342 7:102663294-102663316 AAGAAAACTCTAAAGGTGGCCGG + Intronic
1029992468 7:104974751-104974773 TAGAAAAATCAAATGTAGGCCGG + Intergenic
1030034652 7:105398373-105398395 AAAAAAAAAAAAAAGGAGGCTGG - Intronic
1030074479 7:105724590-105724612 AAAAAAAAAAAAAAGGAGGCCGG + Intronic
1030885825 7:114935903-114935925 TAAATAAATCATAAGGAGGCTGG - Intronic
1031350816 7:120728584-120728606 CAAAAACATAAGAAGGAGGCTGG - Intronic
1031431509 7:121676411-121676433 AAGAGGAATCAGGAGCAGGCAGG + Intergenic
1031895746 7:127346758-127346780 AAGGATAAACAGAAGGAAGCAGG + Intergenic
1032131814 7:129235403-129235425 AAGAAGAATGAGAAGGAGGCTGG - Intronic
1032486593 7:132292265-132292287 CAGGTAAATCAGAGGGAGGCTGG + Intronic
1032661445 7:133988366-133988388 AAGAAAAATCAGAAAAAAGAAGG - Intronic
1033017314 7:137684964-137684986 ATGAAAAGCCAGAAGGAGGCAGG - Intronic
1033190938 7:139278473-139278495 AAAAAAAGGGAGAAGGAGGCTGG - Intronic
1033331467 7:140420447-140420469 AAGAAGGAGCAGAAGGAGGCAGG + Intronic
1033334196 7:140438371-140438393 AAAAAAAAAAAAAAGGAGGCCGG + Intergenic
1033493540 7:141869863-141869885 AAGAAAAATCAAGATAAGGCTGG + Intergenic
1033874938 7:145804426-145804448 AATAAAAATCAAATGAAGGCAGG - Intergenic
1033874981 7:145804734-145804756 AATAAAAATCAAATGAAGGCAGG - Intergenic
1034457330 7:151177950-151177972 ATGAAAAATAAGAAGGAGCCGGG + Intronic
1034978901 7:155463399-155463421 AGGAAAAAGGAGAAGGAGGAGGG - Exonic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1035380791 7:158439438-158439460 AGGAAAAATGAGATGGAGACAGG + Intronic
1035789849 8:2294816-2294838 AAGAAATATCAAAATTAGGCTGG - Intergenic
1035802956 8:2426889-2426911 AAGAAATATCAAAATTAGGCTGG + Intergenic
1036010094 8:4712402-4712424 AAATAAAACCAGAAGGATGCAGG + Intronic
1036016609 8:4792147-4792169 AAGAAAGATAGGAAGGAGGAAGG - Intronic
1037277719 8:17199663-17199685 AAGAAGAAGAAGAAGGAGGGAGG - Intronic
1037473279 8:19231832-19231854 AAGAAATATAAGAAGAAGGCAGG - Intergenic
1037473327 8:19232190-19232212 AAGAAATATAAGGAGAAGGCTGG - Intergenic
1037483142 8:19323675-19323697 TAAAAAAATCAAAAGGAGGCCGG - Intronic
1038286186 8:26208235-26208257 AGAAAAAATCAGAAGGAACCAGG - Intergenic
1038392586 8:27217714-27217736 AAGAAAATTCAGAAGAGAGCTGG + Intergenic
1038735706 8:30167138-30167160 AAGAAAAATTAGCAGAAGGAAGG + Intronic
1038779742 8:30559751-30559773 AAGAAAAATGAGAAGAGGGAGGG + Intronic
1038890208 8:31713095-31713117 AAAAAAAATTAGAAGGAGTATGG - Intronic
1038907830 8:31927002-31927024 AAAAAAAATCAGAAAAATGCAGG - Intronic
1039262585 8:35787987-35788009 AAGAAAAAAGAAAAGGAGGAAGG + Intronic
1039284315 8:36023964-36023986 GAGAAAAACCAGATGGGGGCCGG + Intergenic
1039287019 8:36052779-36052801 AAGGAAGATCACAAGCAGGCTGG - Intergenic
1039839543 8:41284156-41284178 AAGAATAATAAGAAAGAGTCTGG + Intronic
1039870468 8:41541043-41541065 AACAAAAATCAAAAGGTGGGGGG - Intronic
1039871539 8:41549997-41550019 AAGGAAGCTCAGAGGGAGGCAGG - Intergenic
1040018159 8:42717071-42717093 AGGAAAAATAAGAAGCAGACTGG + Intronic
1040513360 8:48114920-48114942 AAAAAAAAAAAAAAGGAGGCGGG - Intergenic
1040728397 8:50411489-50411511 AAATAAAAACAGAAGGAGGAAGG + Intronic
1040769073 8:50951023-50951045 GACAGAAAACAGAAGGAGGCAGG + Intergenic
1041270785 8:56106671-56106693 AAGAAAGTTCAGAAAGAGACAGG - Intergenic
1041615254 8:59899229-59899251 AAAAAAAAAAAGAAGGAGACTGG - Intergenic
1041866670 8:62582084-62582106 AAGGAAAGACAGAAGGAGGGAGG - Intronic
1042142055 8:65688739-65688761 AAGAAAAACTAAAAGCAGGCTGG - Intronic
1042190757 8:66184572-66184594 ATGAAAAATGAGAATCAGGCTGG - Intergenic
1042709984 8:71706760-71706782 AAGAAAAGGCAGAAAGAGGCTGG + Intergenic
1043195491 8:77287378-77287400 CATAAACACCAGAAGGAGGCAGG + Intergenic
1043407868 8:79957154-79957176 AAGAAAAAACAGAATGTGGCAGG - Intronic
1043427141 8:80158643-80158665 AAAAAAAAAAAGAAGTAGGCCGG + Intronic
1044357691 8:91243458-91243480 AGGATAACTCAGGAGGAGGCTGG + Intronic
1044585386 8:93864919-93864941 AAAAAAAAAAAAAAGGAGGCTGG - Intronic
1044867377 8:96585520-96585542 AAGAGAAATGAGAAGGATGGGGG + Intronic
1044985631 8:97754094-97754116 AAAAAAAATCAGAAGAAGAGGGG + Intergenic
1045369051 8:101502827-101502849 AAGAAAAAAAAGAAGGAGAAGGG - Intronic
1045475482 8:102548832-102548854 AAGAAAAATCACTAGGAAGGTGG + Intergenic
1045776625 8:105811000-105811022 ATGAAAAATCAGACGCAGGCTGG + Intergenic
1045865468 8:106860517-106860539 AATAAAAAAGAGAAGGAGGCCGG + Intergenic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046160127 8:110351563-110351585 AAAAAAAAAAAGAAGAAGGCAGG - Intergenic
1046283556 8:112066287-112066309 AAGAAATAGCTGAAAGAGGCAGG - Intergenic
1046368935 8:113274853-113274875 AAGAAAAAAAGGAAGGAAGCAGG + Intronic
1046652373 8:116851235-116851257 AAGAATTACCAGAAGGAGGGTGG + Intronic
1047296425 8:123574445-123574467 AAGATAAATCAACAAGAGGCAGG + Intergenic
1047417505 8:124677164-124677186 TACACAAATCAGGAGGAGGCAGG + Intronic
1047532568 8:125690608-125690630 AACAAAAATTAGAAATAGGCCGG - Intergenic
1047556739 8:125940228-125940250 AAGAAACATCAGTAGGGGGCTGG - Intergenic
1048073828 8:131047072-131047094 AAGGAAAAACAGAAGAAGGCAGG - Intergenic
1048085819 8:131178332-131178354 TAAAAAAAGTAGAAGGAGGCTGG + Intergenic
1048413802 8:134203866-134203888 AATAAAAAGTGGAAGGAGGCTGG - Intergenic
1048525466 8:135198352-135198374 ATGAAAAATCAGAGGGAGGGAGG + Intergenic
1048912592 8:139150351-139150373 AAGAAAAATGGGAAGGAGACTGG - Intergenic
1049768574 8:144367882-144367904 AAGAAATATCAGATTGGGGCTGG - Intergenic
1049862286 8:144907680-144907702 AATAAAAACCACAATGAGGCTGG - Intergenic
1049926972 9:418890-418912 AAAAAAAGACTGAAGGAGGCTGG + Intronic
1050102305 9:2131682-2131704 TAGAAAAAACAAAATGAGGCCGG + Intronic
1050454615 9:5821873-5821895 AAGAAAATTCTGAAGGAGAGAGG - Intronic
1050513668 9:6420052-6420074 AAGAAAAAAAAAAAGGTGGCGGG - Intronic
1050548912 9:6732391-6732413 AAAAAAAAAAAGAATGAGGCCGG + Intronic
1050574342 9:6977569-6977591 AAGTAAAATAAGATGGAGGCAGG - Intronic
1051010700 9:12409966-12409988 AAGAAAAATGGGAAGGAATCCGG - Intergenic
1051187901 9:14479974-14479996 AGGAAGAAGGAGAAGGAGGCAGG + Intergenic
1051465996 9:17378473-17378495 AAGAAAGAACAAAAGAAGGCCGG - Intronic
1051546737 9:18283932-18283954 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1051623769 9:19078856-19078878 AAAAAAGACCAGAAAGAGGCCGG + Intronic
1051630776 9:19138890-19138912 AAGCAAAATTAAAAGGAGACAGG - Intronic
1051638747 9:19204856-19204878 AATAAAAAAAATAAGGAGGCTGG - Intergenic
1051640567 9:19221071-19221093 AATAAAAAGCAGAACCAGGCTGG + Intergenic
1051782135 9:20700967-20700989 AAGAAGAATCAGAAGTGGGAAGG - Intronic
1052587574 9:30448928-30448950 AATAAAAATCAAAAGAAGGTGGG + Intergenic
1052656304 9:31366146-31366168 AATAAAAATCAGATGGAGAAAGG + Intergenic
1052685692 9:31752678-31752700 AAAAAAAAAAAGATGGAGGCTGG - Intergenic
1052777035 9:32742606-32742628 CAGGACAATCAGCAGGAGGCAGG + Intergenic
1052874083 9:33540016-33540038 GAGAAAATTCAGAAGCATGCAGG + Intronic
1052918564 9:33943768-33943790 AAGAAAAATTAAAAGTTGGCTGG + Intronic
1052951017 9:34211697-34211719 AAGGAAAAGTTGAAGGAGGCAGG - Intronic
1053116521 9:35509051-35509073 AATCAGAATCAGAATGAGGCTGG + Intronic
1053489889 9:38490642-38490664 AATAAAAATCTTCAGGAGGCTGG + Intergenic
1053501963 9:38604326-38604348 GAGAAAATTCAGAAGCATGCAGG - Intergenic
1053720612 9:40943272-40943294 AAGAAAGAGCAAAAGCAGGCCGG + Intergenic
1054411135 9:64814654-64814676 AAAAAAAATCAGTGAGAGGCCGG + Intergenic
1054739228 9:68787927-68787949 TAGAAAGATTAGAAAGAGGCTGG - Intronic
1054748451 9:68880078-68880100 AAGAAAAATCTGAGGGAAGTAGG + Intronic
1054752672 9:68924116-68924138 AAAAAAAAAAAAAAGGAGGCCGG + Intronic
1054759950 9:68995507-68995529 ATGAAAAAGCAAATGGAGGCCGG + Intronic
1054858801 9:69928843-69928865 AAGAAAACTCAGAAGGAAAATGG - Intergenic
1055232009 9:74077583-74077605 AAGGAAAATCAGCAGGAGTCTGG + Intergenic
1055327086 9:75142042-75142064 AATAAAGAACAAAAGGAGGCTGG - Intronic
1055405044 9:75965526-75965548 AACAAAAAGCAGAAGAAGGGAGG - Intronic
1055432320 9:76256704-76256726 AAGAAAAATAAAAATGAGTCTGG + Intronic
1055584398 9:77742961-77742983 TAGAAAGATCAGCAGGAGGCTGG + Intronic
1056558700 9:87711021-87711043 AAGAATAAAAAGATGGAGGCGGG + Intergenic
1056645642 9:88409289-88409311 AAGAAAAAAGAAAAGCAGGCCGG - Intronic
1056804502 9:89718205-89718227 CAGAAAAATCAGAAAGAGTTTGG + Intergenic
1056983741 9:91341820-91341842 TAGAAAAATGTGATGGAGGCTGG + Intronic
1057154118 9:92825379-92825401 GAGAAAACTCAGAAGCATGCAGG + Intergenic
1057357859 9:94346536-94346558 AAGTAAAGTCAGAAGTAGGACGG + Intergenic
1057364776 9:94409121-94409143 AAAAAAAAAAAAAAGGAGGCCGG - Intronic
1057471298 9:95359295-95359317 AATAAAAACCACAATGAGGCCGG + Intergenic
1057649890 9:96911073-96911095 AAGTAAAGTCAGAAGTAGGACGG - Intronic
1058411221 9:104734274-104734296 TATAAAAATAAAAAGGAGGCTGG - Intergenic
1058971252 9:110085141-110085163 AGGAAAAATCGGAGGGAAGCAGG + Intronic
1059003461 9:110375477-110375499 AAAAAAAAAAAAAAGGAGGCAGG + Intronic
1059248414 9:112867232-112867254 AGGAAAAATCCTGAGGAGGCAGG - Intronic
1059846059 9:118278211-118278233 AAGAGAATTCAGAAGGAACCAGG + Intergenic
1060529280 9:124339005-124339027 AAAAAAAATCAGGATGGGGCTGG - Intronic
1060649220 9:125310832-125310854 AAAAAAAAAAAGAAGAAGGCTGG - Intronic
1060678569 9:125540193-125540215 GTGAAAAATCAGAAGGTGGTAGG - Intronic
1060871001 9:127040102-127040124 AAGAAAAGGCTGAAGTAGGCCGG + Intronic
1061000685 9:127900576-127900598 AAAAAAAAAAAGAAGGATGCAGG + Intronic
1061166626 9:128926534-128926556 AAGAAAAAGAAAAAGGAAGCTGG - Intronic
1061347268 9:130036747-130036769 AAGAAAAAGGAGCAGTAGGCCGG + Intronic
1061358358 9:130123496-130123518 AAGAAAAAAAAGAAATAGGCCGG - Intronic
1061551605 9:131337957-131337979 AATTAAAATCAAAAGGAGGGGGG + Intergenic
1061832649 9:133305225-133305247 AAAAAAAACAAGAAGGAGGCCGG + Intergenic
1062605564 9:137347102-137347124 TAGAAAAATGACATGGAGGCTGG - Intronic
1062632630 9:137472288-137472310 AAAGAAAATGAGATGGAGGCTGG + Intronic
1203454518 Un_GL000219v1:152611-152633 AAGAAAGAGCAAAAGCAGGCCGG - Intergenic
1185510425 X:660049-660071 AAGAAGAAGAAGAAGAAGGCTGG - Intergenic
1185610954 X:1393259-1393281 AAGAAAAAACAGAGGAAGGGCGG - Intergenic
1185611093 X:1394136-1394158 AAGAAAAAAGAAAAGGAGGCGGG - Intergenic
1185611105 X:1394206-1394228 AAGAAAAAGGAAAAGGAGGGAGG - Intergenic
1186065097 X:5754772-5754794 AATTAAAATCAGAAGTAGCCTGG - Intergenic
1186213777 X:7277792-7277814 AGGAAAAAATAAAAGGAGGCAGG - Intronic
1186456873 X:9716645-9716667 AAAAAAAATCCCAAGGAGGAGGG - Exonic
1186679728 X:11859711-11859733 AACAAAAAACAGAAGCAGGATGG - Intergenic
1186707576 X:12158006-12158028 AATAAAAATCAGAAGAAAGGAGG + Intronic
1186948829 X:14599245-14599267 AACAAAAATCAAAAGGAAGAGGG + Intronic
1187395539 X:18916117-18916139 ATCAAAAATCAGAATGAGCCGGG + Intronic
1187997830 X:24947565-24947587 TAGAAAAATCTGCAGGTGGCTGG - Intronic
1188018552 X:25131514-25131536 ACAAATAATCAGAAGAAGGCTGG + Intergenic
1188096686 X:26032223-26032245 AAAAAAATTCAGCAGGAAGCAGG - Intergenic
1188609611 X:32079631-32079653 AAGAAAAAAAAGAAAGAGGGAGG + Intronic
1188696565 X:33199446-33199468 AAAAACAATGAGAAGGAAGCAGG + Intronic
1189262023 X:39686180-39686202 AAGAAAAAAAAGAAGGAAGGAGG + Intergenic
1189306764 X:39992722-39992744 AATAAAAAACAAAAAGAGGCCGG + Intergenic
1189630236 X:42944621-42944643 AAGGAAAAACACAAGCAGGCTGG + Intergenic
1189650840 X:43187938-43187960 AAGAAGAAGTAGAAGGGGGCAGG + Intergenic
1189703635 X:43737533-43737555 CAGAAAAGGCAGAAGGAGGAAGG + Intronic
1189805108 X:44727709-44727731 AAGAAGAAGAAGAAGAAGGCCGG + Intergenic
1190017004 X:46836012-46836034 AAGAAAACACAGAAGCAGCCTGG + Intergenic
1190047480 X:47124281-47124303 AAGAAGAAAGAGAAAGAGGCCGG + Intergenic
1190536517 X:51433594-51433616 GAGAAAAATCAGCAGGAGGGGGG - Intergenic
1190883288 X:54508888-54508910 AAAAAAAAATAGAAGGAGGCTGG - Intergenic
1191612674 X:63133818-63133840 AAGAAAAAACAGGAGGAAGAAGG + Intergenic
1191623623 X:63245108-63245130 AAGAAAAAACAGGAGGAAGAAGG - Intergenic
1192143953 X:68668206-68668228 AAGAGAAAGAAGAAGGAGGAGGG - Intronic
1192202941 X:69078425-69078447 AAGAAAGAAGAGAAGGAGGTGGG - Intergenic
1192474600 X:71429277-71429299 AAAAAAAAGCAGAAGGAAGCAGG + Intronic
1192806804 X:74517817-74517839 AAAACAAATCAGTAGGTGGCAGG - Intronic
1193071616 X:77312124-77312146 TAGAAAAATAAGAGGGAGGCTGG + Intergenic
1193333692 X:80263107-80263129 AATAAAAATCACATTGAGGCCGG + Intergenic
1194127547 X:90038969-90038991 AAGAAAAATAAGAAGGAAAATGG + Intergenic
1194396914 X:93397426-93397448 AGGAAAAATTAAAAGGAGGCTGG + Intergenic
1194430285 X:93795075-93795097 AAGAAAGATCAGAAGGAGCTGGG + Intergenic
1195113960 X:101677094-101677116 AAGGGAAATCAGAAAGAGGGTGG - Intergenic
1195282585 X:103350350-103350372 CAGGAAACTCAGGAGGAGGCTGG + Intergenic
1195493604 X:105503457-105503479 AAGAGAAAAAAGAAGGAAGCTGG + Intronic
1195821135 X:108946423-108946445 AAGAAACATCAGCAGTAGTCTGG - Intergenic
1195894773 X:109733875-109733897 ATGAAATATCACAAGGACGCAGG + Intergenic
1196292563 X:113960498-113960520 AAGAACACTCAAAGGGAGGCAGG - Intergenic
1196556343 X:117089032-117089054 AAGAGAAATCAGGAAGACGCTGG + Intergenic
1196769799 X:119282107-119282129 AAGAAAATGGAGAGGGAGGCCGG - Intergenic
1196799382 X:119528987-119529009 AAAAAAAATCAGATTAAGGCCGG + Intergenic
1197046596 X:122004772-122004794 AATAAAAATCACAGGGGGGCAGG - Intergenic
1197221729 X:123921064-123921086 AAGAAAAAAAGAAAGGAGGCCGG - Intergenic
1197685413 X:129434606-129434628 TAGAAAATTCAGAGGGAGCCAGG - Intergenic
1197741331 X:129896623-129896645 AAAAAAAATAAGAAGAGGGCTGG - Intergenic
1197744528 X:129922711-129922733 AAGGAAAAAAAAAAGGAGGCTGG - Intronic
1197873958 X:131084718-131084740 AAGAAAGAGCAGGAGGAGGTGGG + Intronic
1197910669 X:131479714-131479736 AAGAACCATCAAATGGAGGCAGG - Intergenic
1198080132 X:133231865-133231887 AAAAAAAAAGAGAAGGAGGGAGG + Intergenic
1198182738 X:134225340-134225362 AATTAAAACCAAAAGGAGGCTGG + Intergenic
1198467512 X:136916910-136916932 AAGAATAAGAAGAAGGAGGAGGG - Intergenic
1198683682 X:139205965-139205987 AAGAAAAGAGAGAAGGAGGGAGG + Intronic
1199406083 X:147462421-147462443 AAAAAAAAAGATAAGGAGGCTGG + Intergenic
1199435152 X:147804672-147804694 AAGAAAAATGACAGGGATGCTGG + Intergenic
1199767872 X:150953873-150953895 AAGAAAACAGAGAAGGAGGGGGG - Intergenic
1200415621 Y:2906915-2906937 AAAAATAAGGAGAAGGAGGCTGG - Intronic
1201171978 Y:11275858-11275880 AAAAAAAAAAAGAAGGAGGTTGG + Intergenic
1201461675 Y:14232565-14232587 AAGAAGAAGCAGAAGAAGGAAGG - Intergenic
1201461748 Y:14233042-14233064 AAGAAGAATGAGGAGGAGGAGGG - Intergenic
1201698875 Y:16858136-16858158 TACAAAAATCACAAGCAGGCCGG + Intergenic
1201782931 Y:17743279-17743301 AAGAAAGATGAGAGGGAGGGTGG + Intergenic
1201818622 Y:18162708-18162730 AAGAAAGATGAGAGGGAGGGTGG - Intergenic